TY - JOUR T1 - Growth response and resistance to Streptococcus iniae of Nile tilapia, Oreochromis niloticus, fed diets containing different levels of wheat distiller's dried grains with solubles with or without lysine supplementation AN - 907189692; 16049405 AB - A study was conducted to evaluate the effect of dietary levels of wheat distiller's dried grains with solubles (DDGS) with or without lysine supplementation on growth, body composition, hematology, immune response, and resistance of Nile tilapia, Oreochromis niloticus, to Streptococcus iniae challenge. Nine isonitrogenous, isocaloric diets were formulated to contain 0 (control), 100, 200, 300 and 400 g/kg wheat DDGS without (W0-W400) and with (WL100-WL400) lysine supplementation to a level equal to that of the control diet as partial replacement of a combination of soybean meal (SBM) and maize meal (MM) on an equal protein basis. Each diet was fed to juvenile Nile tilapia (3.92 +/- 0.07 g) in triplicate aquaria twice daily to apparent satiation for 10 weeks. Fish fed W400 had lower (P0.05) were observed among whole body moisture, protein and fat of fish receiving various diets. Whole body ash tended to increase with increasing levels of dietary wheat DDGS, but the differences were not always significant. Hematological and immunological parameters, the average number of days to first mortality after S. iniae challenge and cumulative mortality 4 weeks post challenge were not affected (P>0.05) by dietary treatments. Results of this study suggest that wheat DDGS can be incorporated in Nile tilapia diets at a level of 300 g/kg as a substitute, on an equal protein basis, for a combination of SBM and MM without requiring lysine supplementation. The inclusion level of wheat DDGS can be increased to at least 400 g/kg (highest level evaluated) if lysine was supplemented to a level equal to that of the control diet. JF - Animal Feed Science and Technology AU - Li, Erchao AU - Lim, Chhorn AU - Cai, Chunfang AU - Klesius, Phillip H AD - Aquatic Animal Health Research Unit, USDA-ARS, MSA, 990 Wire Road, Auburn, AL 36832, USA, chhorn.lim@ars.usda.gov Y1 - 2011/12/22/ PY - 2011 DA - 2011 Dec 22 SP - 246 EP - 255 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 170 IS - 3-4 SN - 0377-8401, 0377-8401 KW - Microbiology Abstracts B: Bacteriology; ASFA 1: Biological Sciences & Living Resources KW - Wheat DDGS KW - Lysine KW - Nile tilapia KW - Growth KW - Disease resistance KW - Defence mechanisms KW - Aquaria KW - Triticum aestivum KW - Zea mays KW - Body composition KW - Brackishwater fish KW - Diets KW - Mortality KW - Satiety KW - Feed KW - Brackish KW - Soybeans KW - Dietary supplements KW - Grain KW - Feeding experiments KW - Streptococcus iniae KW - Immune response KW - Mortality causes KW - Oreochromis niloticus KW - Feed efficiency KW - J 02350:Immunology KW - Q1 08485:Species interactions: pests and control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907189692?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Animal+Feed+Science+and+Technology&rft.atitle=Growth+response+and+resistance+to+Streptococcus+iniae+of+Nile+tilapia%2C+Oreochromis+niloticus%2C+fed+diets+containing+different+levels+of+wheat+distiller%27s+dried+grains+with+solubles+with+or+without+lysine+supplementation&rft.au=Li%2C+Erchao%3BLim%2C+Chhorn%3BCai%2C+Chunfang%3BKlesius%2C+Phillip+H&rft.aulast=Li&rft.aufirst=Erchao&rft.date=2011-12-22&rft.volume=170&rft.issue=3-4&rft.spage=246&rft.isbn=&rft.btitle=&rft.title=Animal+Feed+Science+and+Technology&rft.issn=03778401&rft_id=info:doi/10.1016%2Fj.anifeedsci.2011.09.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-09-18 N1 - SubjectsTermNotLitGenreText - Diets; Growth; Feed; Feeding experiments; Lysine; Defence mechanisms; Brackishwater fish; Mortality causes; Feed efficiency; Aquaria; Mortality; Satiety; Dietary supplements; Grain; Immune response; Body composition; Soybeans; Triticum aestivum; Zea mays; Streptococcus iniae; Oreochromis niloticus; Brackish DO - http://dx.doi.org/10.1016/j.anifeedsci.2011.09.002 ER - TY - JOUR T1 - Forage soybean yield and quality response to water use AN - 902375231; 15912429 AB - Forages could be used to diversify reduced and no-till dryland cropping systems from the traditional wheat (Triticum aestivum L.)-fallow system in the semiarid central Great Plains. Forages present an attractive alternative to grain and seed crops because of greater water use efficiency and less susceptibility to potentially devastating yield reductions due to severe water stress during critical growth stages. However, farmers need a simple tool to evaluate forage productivity under widely varying precipitation conditions. The objectives of this study were to (1) quantify the relationship between crop water use and dry matter (DM) yield for soybean (Glycine max L. Merrill), (2) evaluate changes in forage quality that occur as harvest date is delayed, and (3) determine the range and distribution of expected DM yields in the central Great Plains based on historical precipitation records. Forage soybean was grown under a line-source gradient irrigation system to impose a range of water availability conditions at Akron, CO. Dry matter production was linearly correlated with water use resulting in a production function slope of 21.2 kg ha super(-1 mm) super(-)1. The slope was much lower than previously reported for forage production functions for triticale (X Triticosecale Wittmack) and millet (Setaria italic L. Beauv.), and only slightly lower than slopes previously reported for corn (Zea mays L.) and pea (Pisum sativa L.) forage. Forage quality was relatively stable during the last four weeks of growth, with small declines in crude protein (CP) concentration. Values of CP concentration and relative feed value indicated that forage soybean was of sufficient quality to be used for dairy feed. A standard seed variety of maturity group VII was found to be similar (in both productivity and quality) to a variety designated as a forage type. The probability of obtaining a break-even yield of at least 4256 kg ha super(-1 was 90% as determined from long-term precipitation records used with the production function. The average estimated DM yield was 5890 kg ha) super(-)1 and ranged from 2437 to 9432 kg ha super(-1. Regional estimates of mean forage soybean DM yield ranged from 4770 kg ha) super(-)1 at Fort Morgan, CO to 6911 kg ha super(-1 at Colby, KS. Forage soybean should be considered a viable alternative crop for dryland cropping systems in the central Great Plains.) JF - Field Crops Research AU - Nielsen, David C AD - USDA-ARS, Central Great Plains Research Station, 40335 County Road GG, Akron, CO 80720, United States, david.nielsen@ars.usda.gov Y1 - 2011/12/20/ PY - 2011 DA - 2011 Dec 20 SP - 400 EP - 407 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 124 IS - 3 SN - 0378-4290, 0378-4290 KW - Pollution Abstracts; Sustainability Science Abstracts; Environment Abstracts KW - Crops KW - forage KW - Glycine max KW - ENA 06:Food & Drugs KW - P:9999 KW - M3:1010 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902375231?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Field+Crops+Research&rft.atitle=Forage+soybean+yield+and+quality+response+to+water+use&rft.au=Nielsen%2C+David+C&rft.aulast=Nielsen&rft.aufirst=David&rft.date=2011-12-20&rft.volume=124&rft.issue=3&rft.spage=400&rft.isbn=&rft.btitle=&rft.title=Field+Crops+Research&rft.issn=03784290&rft_id=info:doi/10.1016%2Fj.fcr.2011.07.007 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - forage; Glycine max DO - http://dx.doi.org/10.1016/j.fcr.2011.07.007 ER - TY - JOUR T1 - Methodologies for simulating impacts of climate change on crop production AN - 902375201; 15912424 AB - Ecophysiological models are widely used to forecast potential impacts of climate change on future agricultural productivity and to examine options for adaptation by local stakeholders and policy makers. However, protocols followed in such assessments vary to such an extent that they constrain cross-study syntheses and increase the potential for bias in projected impacts. We reviewed 221 peer-reviewed papers that used crop simulation models to examine diverse aspects of how climate change might affect agricultural systems. Six subject areas were examined: target crops and regions; the crop model(s) used and their characteristics; sources and application of data on [CO sub(2] and climate; impact parameters evaluated; assessment of variability or risk; and adaptation strategies. Wheat, maize, soybean and rice were considered in approximately 170 papers. The USA (55 papers) and Europe (64 papers) were the dominant regions studied. The most frequent approach used to simulate response to CO) sub(2) involved adjusting daily radiation use efficiency (RUE) and transpiration, precluding consideration of the interacting effects of CO sub(2, stomatal conductance and canopy temperature, which are expected to exacerbate effects of global warming. The assumed baseline [CO) sub(2)] typically corresponded to conditions 10-30 years earlier than the date the paper was accepted, exaggerating the relative impacts of increased [CO sub(2]. Due in part to the diverse scenarios for increases in greenhouse gas emissions, assumed future [CO) sub(2)] also varied greatly, further complicating comparisons among studies. Papers considering adaptation predominantly examined changes in planting dates and cultivars; only 20 papers tested different tillage practices or crop rotations. Risk was quantified in over half the papers, mainly in relation to variability in yield or effects of water deficits, but the limited consideration of other factors affecting risk beside climate change per se suggests that impacts of climate change were overestimated relative to background variability. A coordinated crop, climate and soil data resource would allow researchers to focus on underlying science. More extensive model intercomparison, facilitated by modular software, should strengthen the biological realism of predictions and clarify the limits of our ability to forecast agricultural impacts of climate change on crop production and associated food security as well as to evaluate potential for adaptation. JF - Field Crops Research AU - White, Jeffrey W AU - Hoogenboom, Gerrit AU - Kimball, Bruce A AU - Wall, Gerard W AD - ALARC, USDA-ARS, 21881 North Cardon Lane, Maricopa, AZ 85138, United States, jeffrey.white@ars.usda.gov Y1 - 2011/12/20/ PY - 2011 DA - 2011 Dec 20 SP - 357 EP - 368 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 124 IS - 3 SN - 0378-4290, 0378-4290 KW - Sustainability Science Abstracts; Environment Abstracts KW - Adaptation, Agricultural impacts, Climate change, Crop growth simulation, Global warming, Modeling KW - Climate change KW - Temperature KW - Oryza sativa KW - Europe KW - crop production KW - Crops KW - adaptability KW - Soil KW - Triticum aestivum KW - Computer programs KW - USA KW - Zea mays KW - Carbon dioxide KW - Greenhouse gases KW - ENA 06:Food & Drugs KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902375201?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Field+Crops+Research&rft.atitle=Methodologies+for+simulating+impacts+of+climate+change+on+crop+production&rft.au=White%2C+Jeffrey+W%3BHoogenboom%2C+Gerrit%3BKimball%2C+Bruce+A%3BWall%2C+Gerard+W&rft.aulast=White&rft.aufirst=Jeffrey&rft.date=2011-12-20&rft.volume=124&rft.issue=3&rft.spage=357&rft.isbn=&rft.btitle=&rft.title=Field+Crops+Research&rft.issn=03784290&rft_id=info:doi/10.1016%2Fj.fcr.2011.07.001 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2016-07-07 N1 - SubjectsTermNotLitGenreText - Soil; Computer programs; Climate change; Temperature; crop production; Greenhouse gases; Carbon dioxide; Crops; adaptability; Triticum aestivum; Zea mays; Oryza sativa; USA; Europe DO - http://dx.doi.org/10.1016/j.fcr.2011.07.001 ER - TY - JOUR T1 - Snow-covered Landsat time series stacks improve automated disturbance mapping accuracy in forested landscapes AN - 911158458; 16077281 AB - Accurate landscape-scale maps of forests and associated disturbances are critical to augment studies on biodiversity, ecosystem services, and the carbon cycle, especially in terms of understanding how the spatial and temporal complexities of damage sustained from disturbances influence forest structure and function. Vegetation change tracker (VCT) is a highly automated algorithm that exploits the spectral-temporal properties of summer Landsat time series stacks (LTSSs) to generate spatially explicit maps of forest and recent forest disturbances. VCT performs well in contiguous forest landscapes with closed or nearly closed canopies, but often incorrectly classifies large patches of land as forest or forest disturbance in the complex and spatially heterogeneous environments that typify fragmented forest landscapes. We introduce an improved version of VCT (dubbed VCTw) that incorporates a nonforest mask derived from snow-covered winter Landsat time series stacks (LTSSw) and compare it with VCT across nearly 25million ha of land in the Lake Superior (Canada, USA) and Lake Michigan (USA) drainage basins. Accuracy assessments relying on 87 primary sampling units (PSUs) and 2640 secondary sampling units (SSUs) indicated that VCT performed with an overall accuracy of 86.3%. For persisting forest, the commission error was 14.7% and the omission error was 4.3%. Commission and omission errors for the two forest disturbance classes fluctuated around 50%. VCTw produced a statistically significant increase in overall accuracy to 91.2% and denoted about 1.115million ha less forest (-.371million ha disturbed and -0.744million ha persisting). For persisting forest, the commission error decreased to 9.3% and the omission error was relatively unchanged at 5.0%. Commission errors decreased considerably to near 22% and omission errors remained near 50% in both forest disturbance classes. Dividing the assessments into three geographic strata demonstrated that the most dramatic improvement occurred across the southern half of the Lake Michigan basin, which contains a highly fragmented agricultural landscape and relatively sparse deciduous forest, although substantial improvements occurred in other geographic strata containing little agricultural land, abundant wetlands, and extensive coniferous forest. Unlike VCT, VCTw also generally corresponded well with field-based estimates of forest cover in each stratum. Snow-covered winter imagery appears to be a valuable resource for improving automated disturbance mapping accuracy. About 34% of the world's forests receive sufficient snowfall to cover the ground and are potentially suitable for VCTw; other season-based techniques may be worth pursuing for the remaining 66%. JF - Remote Sensing of Environment AU - Stueve, Kirk M AU - Housman, Ian W AU - Zimmerman, Patrick L AU - Nelson, Mark D AU - Webb, Jeremy B AU - Perry, Charles H AU - Chastain, Robert A AU - Gormanson, Dale D AU - Huang, Chengquan AU - Healey, Sean P AU - Cohen, Warren B AD - United States Department of Agriculture Forest Service, Northern Research Station, Forest Inventory and Analysis, 1992 Folwell Avenue, Saint Paul, MN 55108, USA, kstueve@biogeography.us Y1 - 2011/12/15/ PY - 2011 DA - 2011 Dec 15 SP - 3203 EP - 3219 PB - Elsevier B.V., Box 882 New York NY 10159 United States VL - 115 IS - 12 SN - 0034-4257, 0034-4257 KW - Meteorological & Geoastrophysical Abstracts; Aqualine Abstracts; Environment Abstracts; Ecology Abstracts; Sustainability Science Abstracts; Water Resources Abstracts KW - Automated disturbance mapping KW - Eastern deciduous forest KW - Forest disturbance commission errors KW - Landsat time series stacks KW - Great Lakes KW - Mixed northern hardwoods KW - Satellite remote sensing KW - Snow KW - Southern boreal forest KW - Validation KW - Vegetation change tracker KW - Winter KW - Remote Sensing KW - Ecosystems KW - Remote sensing of environment KW - Algorithms KW - Automation KW - Forests KW - Basins KW - Maps KW - Time series analysis KW - Lakes KW - Structure-function relationships KW - Wetlands KW - Canopies KW - Topography KW - disturbance KW - time series analysis KW - Landscape KW - Carbon cycle KW - Errors KW - USA, Michigan L. KW - Canada, Ontario, Superior L. KW - winter KW - Canada KW - Vegetation changes KW - Statistical analysis KW - Remote sensing KW - Biodiversity KW - LANDSAT KW - Habitat fragmentation KW - commissions KW - Agricultural land KW - Assessments KW - Mapping KW - Sampling KW - Drainage KW - Snow cover KW - Landsat KW - Forest canopy KW - Disturbance KW - SW 5040:Data acquisition KW - M3 1010:Issues in Sustainable Development KW - D 04030:Models, Methods, Remote Sensing KW - M2 551.5:General (551.5) KW - AQ 00005:Underground Services and Water Use KW - ENA 21:Wildlife UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911158458?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Remote+Sensing+of+Environment&rft.atitle=Snow-covered+Landsat+time+series+stacks+improve+automated+disturbance+mapping+accuracy+in+forested+landscapes&rft.au=Stueve%2C+Kirk+M%3BHousman%2C+Ian+W%3BZimmerman%2C+Patrick+L%3BNelson%2C+Mark+D%3BWebb%2C+Jeremy+B%3BPerry%2C+Charles+H%3BChastain%2C+Robert+A%3BGormanson%2C+Dale+D%3BHuang%2C+Chengquan%3BHealey%2C+Sean+P%3BCohen%2C+Warren+B&rft.aulast=Stueve&rft.aufirst=Kirk&rft.date=2011-12-15&rft.volume=115&rft.issue=12&rft.spage=3203&rft.isbn=&rft.btitle=&rft.title=Remote+Sensing+of+Environment&rft.issn=00344257&rft_id=info:doi/10.1016%2Fj.rse.2011.07.005 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Drainage; Landscape; Remote sensing; Statistical analysis; Algorithms; Carbon cycle; Biodiversity; Basins; Forests; Habitat fragmentation; Agricultural land; Landsat; Lakes; Vegetation changes; Structure-function relationships; Wetlands; Canopies; Disturbance; Sampling; Mapping; Forest canopy; Remote sensing of environment; LANDSAT; Time series analysis; Snow cover; Topography; commissions; disturbance; winter; time series analysis; Remote Sensing; Ecosystems; Assessments; Automation; Maps; Errors; USA, Michigan L.; Canada, Ontario, Superior L.; Canada DO - http://dx.doi.org/10.1016/j.rse.2011.07.005 ER - TY - JOUR T1 - Haemophilus parasuis exhibits IgA protease activity but lacks homologs of the IgA protease genes of Haemophilus influenzae AN - 907181952; 15746801 AB - Haemophilus parasuis, the bacterium responsible for Glaesser's disease, is a pathogen of significant concern in modern high-health swine production systems but there is little information regarding the identity or function of its virulence factors. Several important human mucosal pathogens, including the closely related bacterium Haemophilus influenzae, utilize IgA proteases to aid in defeating the host immune response and facilitate disease but it is unknown whether H. parasuis synthesizes any product with IgA protease activity. To investigate potential virulence mechanisms of H. parasuis, we evaluated five strains for their ability to digest purified IgA. Western blotting demonstrated cleavage of swine IgA, but not human IgA1, following incubation with culture supernatants from three strains, two of which are known to cause invasive disease. No genes with homology to the H. influenzae IgA protease genes iga and igaB could be identified in any H. parasuis strain using either PCR or Southern blotting. These results demonstrate that a novel IgA protease produced by some strains of H. parasuis cleaves the swine IgA heavy chain at a site not found in human IgA1. JF - Veterinary Microbiology AU - Mullins, Michael A AU - Register, Karen B AU - Bayles, Darrell O AU - Butler, John E Y1 - 2011/12/15/ PY - 2011 DA - 2011 Dec 15 SP - 407 EP - 412 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 153 IS - 3-4 SN - 0378-1135, 0378-1135 KW - Genetics Abstracts; Microbiology Abstracts B: Bacteriology KW - Haemophilus parasuis KW - IgA protease KW - Swine IgA KW - Southern blotting KW - Western blotting KW - Haemophilus influenzae KW - virulence factors KW - Mucosa KW - Pathogens KW - Immunoglobulin A KW - Homology KW - Polymerase chain reaction KW - Proteinase KW - Immune response KW - G 07720:Immunogenetics KW - J 02350:Immunology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907181952?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Veterinary+Microbiology&rft.atitle=Haemophilus+parasuis+exhibits+IgA+protease+activity+but+lacks+homologs+of+the+IgA+protease+genes+of+Haemophilus+influenzae&rft.au=Mullins%2C+Michael+A%3BRegister%2C+Karen+B%3BBayles%2C+Darrell+O%3BButler%2C+John+E&rft.aulast=Mullins&rft.aufirst=Michael&rft.date=2011-12-15&rft.volume=153&rft.issue=3-4&rft.spage=407&rft.isbn=&rft.btitle=&rft.title=Veterinary+Microbiology&rft.issn=03781135&rft_id=info:doi/10.1016%2Fj.vetmic.2011.06.004 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-09-05 N1 - SubjectsTermNotLitGenreText - Western blotting; Southern blotting; Immunoglobulin A; Homology; virulence factors; Mucosa; Polymerase chain reaction; Proteinase; Immune response; Pathogens; Haemophilus influenzae; Haemophilus parasuis DO - http://dx.doi.org/10.1016/j.vetmic.2011.06.004 ER - TY - JOUR T1 - Some theoretical and practical aspects in the separation of humic substances by combined liquid chromatography methods AN - 1266754037; 16072626 AB - Permanent need to understand nature, structure and properties of humic substances influences also separation methods that are in a wide scope used for fractionation, characterization and analysis of humic substances (HS). At the first glance techniques based on size-exclusion phenomena are the most useful and utilized for relating elution data to the molecular mass distribution of HS, however, with some limitations and exceptions, respectively, in the structural investigation of HS. The second most abundant separation mechanism is reversed-phase based on weak hydrophobic interactions beneficially combined with the step gradients inducing distinct features in rather featureless analytical signal of HS. Relatively great effort is invested to the developments of immobilized-metal affinity chromatography mimicking chelate-forming properties of HS as ligands in the environment. Surprisingly, relatively less attention is given to the ion-ion interactions based ion-exchange chromatography of HS. Chromatographic separation methods play also an important role in the examination of interactions of HS with pesticides. They allow us to determine binding constants and the other data necessary to predict the mobility of chemical pollutants in the environment. HS is frequently adversely acting in analytical procedures as interfering substance, so more detailed information is desired on manifestation of its numerous properties in analytical procedures. The article topic is covered by the review emphasizing advances in the field done in the period of last 10 years from 2000 till 2010. JF - Journal of Chromatography A AU - Hutta, Milan AU - Gora, Robert AU - Halko, Radoslav AU - Chalanyova, Maria AD - Department of Analytical Chemistry, Faculty of Natural Sciences, Comenius University in Bratislava, Mlynska dolina CH-2, 842 15 Bratislava, Slovakia, hutta@fns.uniba.sk Y1 - 2011/12/09/ PY - 2011 DA - 2011 Dec 09 SP - 8946 EP - 8957 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 1218 IS - 49 SN - 0021-9673, 0021-9673 KW - ASFA 3: Aquatic Pollution & Environmental Quality; Water Resources Abstracts; Aqualine Abstracts KW - Humic substances KW - RP HPLC KW - SEC KW - IMAC KW - IEC KW - Combination KW - Interferences KW - Pesticides KW - Chromatography KW - Chromatographic techniques KW - Agricultural Chemicals KW - Pollutants KW - Analytical Methods KW - Reviews KW - Molecular weight KW - Analytical techniques KW - Liquid Chromatography KW - Chemical pollutants KW - Ligands KW - SW 5010:Network design KW - Q5 08502:Methods and instruments KW - AQ 00002:Water Quality UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1266754037?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Chromatography+A&rft.atitle=Some+theoretical+and+practical+aspects+in+the+separation+of+humic+substances+by+combined+liquid+chromatography+methods&rft.au=Hutta%2C+Milan%3BGora%2C+Robert%3BHalko%2C+Radoslav%3BChalanyova%2C+Maria&rft.aulast=Hutta&rft.aufirst=Milan&rft.date=2011-12-09&rft.volume=1218&rft.issue=49&rft.spage=8946&rft.isbn=&rft.btitle=&rft.title=Journal+of+Chromatography+A&rft.issn=00219673&rft_id=info:doi/10.1016%2Fj.chroma.2011.06.107 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-12-01 N1 - Last updated - 2016-09-29 N1 - SubjectsTermNotLitGenreText - Chromatographic techniques; Molecular weight; Pesticides; Analytical techniques; Chemical pollutants; Ligands; Agricultural Chemicals; Pollutants; Chromatography; Analytical Methods; Reviews; Liquid Chromatography DO - http://dx.doi.org/10.1016/j.chroma.2011.06.107 ER - TY - CPAPER T1 - Conservation of the marbled murrelet in the Pacific Northwest, USA T2 - 25th International Congress for Conservation Biology (ICCB 2011) AN - 1312961102; 6039984 JF - 25th International Congress for Conservation Biology (ICCB 2011) AU - Raphael, M Y1 - 2011/12/05/ PY - 2011 DA - 2011 Dec 05 KW - USA, Pacific Northwest KW - Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312961102?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=25th+International+Congress+for+Conservation+Biology+%28ICCB+2011%29&rft.atitle=Conservation+of+the+marbled+murrelet+in+the+Pacific+Northwest%2C+USA&rft.au=Raphael%2C+M&rft.aulast=Raphael&rft.aufirst=M&rft.date=2011-12-05&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=25th+International+Congress+for+Conservation+Biology+%28ICCB+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.conbio.org/Activities/Meetings/2011/program/ICCB2011_Programme_web.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Genomic information reveals threatened species isolated before European settlement: implications for reintroduction efforts T2 - 25th International Congress for Conservation Biology (ICCB 2011) AN - 1312922304; 6040163 JF - 25th International Congress for Conservation Biology (ICCB 2011) AU - Schwartz, Michael AU - Knaus, Brian AU - Liston, Aaron AU - Pilgrim, Kristy AU - Cronn, Richard Y1 - 2011/12/05/ PY - 2011 DA - 2011 Dec 05 KW - reintroduction KW - threatened species KW - Reintroduction KW - genomics KW - Threatened species UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312922304?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=25th+International+Congress+for+Conservation+Biology+%28ICCB+2011%29&rft.atitle=Genomic+information+reveals+threatened+species+isolated+before+European+settlement%3A+implications+for+reintroduction+efforts&rft.au=Schwartz%2C+Michael%3BKnaus%2C+Brian%3BListon%2C+Aaron%3BPilgrim%2C+Kristy%3BCronn%2C+Richard&rft.aulast=Schwartz&rft.aufirst=Michael&rft.date=2011-12-05&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=25th+International+Congress+for+Conservation+Biology+%28ICCB+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.conbio.org/Activities/Meetings/2011/program/ICCB2011_Programme_web.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - JOUR T1 - Analysis of therapeutic peptides in human urine by combination of capillary zone electrophoresis-electrospray mass spectrometry with preparative capillary isotachophoresis sample pretreatment AN - 1635016775; 16041289 AB - The presented study deals with the off-line coupling of preparative isotachophoresis (pITP) with on-line combination of capillary zone electrophoresis with electrospray mass spectrometric detection (CZE-ESI-MS) used for the analysis of therapeutic peptides (anserine, carnosine, and buserelin) in complex matrix (urine). Preparative capillary isotachophoresis, operating in a discontinuous fractionation mode in column-coupling configuration, served as a sample pretreatment technique to separation, and fractionation of mixture of therapeutic peptides present in urine at low concentration level. The fractions isolated by pITP procedure were subsequently analyzed by capillary zone electrophoresis with electrospray mass spectrometric detection. Acetic acid at 200 mmol L super(-1 concentration served as background electrolyte in CZE stage and it is compatible with MS detection in positive ionization mode. In pITP fractionation procedure, sodium cation (10 mmol L) super(-)1 concentration) as leading ion and beta-alanine as terminating ion (20 mmol L super(-1 concentration) were used. While using CZE-ESI-MS, the limits of detection were 0.18 mu g mL) super(-)1 for carnosine, 0.17 mu g mL super(-1 for anserine and 0.64 mu g mL) super(-)1 for buserelin in water and 0.19 mu g mL super(-1 for carnosine, 0.50 mu g mL) super(-)1 for anserine and 0.74 mu g mL super(-1 for buserelin in 10 times diluted urine, respectively. The cleaning power of pITP sample pretreatment was proved as the peptides provided the higher MS signals at lower concentration levels resulting from the minimized matrix effects. The quality of obtained MS/MS spectra was very good so that they can provide information about the structure of analytes, and they were used for verification of the analytes identities. The pITP pretreatment improved the detection limits of the analyzed therapeutic peptides at least 25 times compared to the CZE-ESI-MS itself.) JF - Journal of Chromatography A AU - Stanova, Andrea AU - Marak, Jozef AU - Rezeli, Melinda AU - Pager, Csilla AU - Kilar, Ferenc AU - Kaniansky, Dusan AD - Department of Analytical Chemistry, Faculty of Natural Sciences, Comenius University, Mlynska Dolina CH-2, SK-842 15 Bratislava, Slovak Republic, marak@fns.uniba.sk Y1 - 2011/12/02/ PY - 2011 DA - 2011 Dec 02 SP - 8701 EP - 8707 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 1218 IS - 48 SN - 0021-9673, 0021-9673 KW - ASFA 3: Aquatic Pollution & Environmental Quality; Water Resources Abstracts; Aqualine Abstracts KW - Capillary zone electrophoresis KW - Electrospray mass spectrometry KW - Preparative capillary isotachophoresis KW - Therapeutic peptides KW - Urine KW - Mass Spectrometry KW - Electrolytes KW - Electrophoresis KW - Capillary Zone KW - Chromatographic techniques KW - Mass spectroscopy KW - Sodium KW - Detection Limits KW - Peptides KW - AQ 00001:Water Resources and Supplies KW - SW 0810:General KW - Q5 08502:Methods and instruments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1635016775?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Chromatography+A&rft.atitle=Analysis+of+therapeutic+peptides+in+human+urine+by+combination+of+capillary+zone+electrophoresis-electrospray+mass+spectrometry+with+preparative+capillary+isotachophoresis+sample+pretreatment&rft.au=Stanova%2C+Andrea%3BMarak%2C+Jozef%3BRezeli%2C+Melinda%3BPager%2C+Csilla%3BKilar%2C+Ferenc%3BKaniansky%2C+Dusan&rft.aulast=Stanova&rft.aufirst=Andrea&rft.date=2011-12-02&rft.volume=1218&rft.issue=48&rft.spage=8701&rft.isbn=&rft.btitle=&rft.title=Journal+of+Chromatography+A&rft.issn=00219673&rft_id=info:doi/10.1016%2Fj.chroma.2011.09.080 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-12-01 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Electrolytes; Electrophoresis; Chromatographic techniques; Urine; Peptides; Mass spectroscopy; Sodium; Mass Spectrometry; Detection Limits; Capillary Zone DO - http://dx.doi.org/10.1016/j.chroma.2011.09.080 ER - TY - JOUR T1 - Long-term Selenium Deficiency Increases the Pathogenicity of a Citrobacter rodentium Infection in Mice AN - 968169527; 16357937 AB - Citrobacter rodentium is a mouse pathogen that causes infectious colitis and shares characteristics with human enteropathogenic (EPEC) and enterohemorrhagic (EHEC) Escherichia coli, including the ability to cause attaching and effacing lesions in the colon and serves as a useful model to study the pathogenicity of these bacteria. In this study, mice were fed a selenium-deficient diet for 5 or 20 weeks and then infected with C. rodentium. Colonization of the colon by C. rodentium was similar in mice fed adequate or selenium-deficient diets, but total bacterial colonization of the spleen was elevated in mice fed selenium-deficient diet for 20 weeks. Infection-induced changes to the colon included inflammatory cell infiltration, gross changes in crypt architecture, and ulceration and denuding of the epithelial layer that were greatest in mice fed a selenium-deficient diet for 20 weeks. Expression of pro-inflammatory genes was significantly higher 12-days post-infection in mice fed the selenium-deficient diet for 20 weeks compared to mice fed a selenium-adequate diet or selenium-deficient diet for 5 weeks. Diarrhea was prevalent in mice fed the selenium-deficient diet for 20 weeks but not 5 weeks, and this was associated with decreased expression of solute carrier family 26a3 and carbonic anhydrase IV, genes involved in ion transport. These results indicated that selenium played an important role in resistance to the pathological effects of a C. rodentium infection, and therefore, selenium status may be important in the expression of human disease caused by common food-borne bacteria. JF - Biological Trace Element Research AU - Smith, Allen D AU - Cheung, Lumei AU - Botero, Sebastian AD - Agricultural Research Service, Beltsville Human Nutrition Research Center, Diet, Genomics, and Immunology Laboratory, United States Department of Agriculture, 10300 Baltimore Ave., B307C, Rm. 228, BARC-East, Beltsville, MD, 20705, USA, allen.smith@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 965 EP - 982 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 144 IS - 1-3 SN - 0163-4984, 0163-4984 KW - Microbiology Abstracts B: Bacteriology KW - Animal models KW - Carbonate dehydratase KW - Colitis KW - Colon KW - Colonization KW - Diarrhea KW - Diets KW - Food KW - Infection KW - Inflammation KW - Pathogenicity KW - Pathogens KW - Selenium KW - Solutes KW - Spleen KW - Escherichia coli KW - Citrobacter rodentium KW - J 02310:Genetics & Taxonomy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/968169527?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biological+Trace+Element+Research&rft.atitle=Long-term+Selenium+Deficiency+Increases+the+Pathogenicity+of+a+Citrobacter+rodentium+Infection+in+Mice&rft.au=Crosslin%2C+JM%3BLin%2C+H%3BMunyaneza%2C+JE&rft.aulast=Crosslin&rft.aufirst=JM&rft.date=2011-06-01&rft.volume=36&rft.issue=2&rft.spage=125&rft.isbn=&rft.btitle=&rft.title=Southwestern+Entomologist&rft.issn=01471724&rft_id=info:doi/10.3958%2F059.036.0202 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Last updated - 2012-06-18 N1 - SubjectsTermNotLitGenreText - Diets; Diarrhea; Food; Animal models; Spleen; Carbonate dehydratase; Pathogens; Infection; Inflammation; Selenium; Colonization; Solutes; Colon; Pathogenicity; Colitis; Escherichia coli; Citrobacter rodentium DO - http://dx.doi.org/10.1007/s12011-011-9071-4 ER - TY - JOUR T1 - Multimodal Cues Drive Host-Plant Assessment in Asian Citrus Psyllid (Diaphorina citri) AN - 954730657; 16388021 AB - Asian citrus psyllid (Diaphorina citri) transmits the causal agent of Huanglongbing, a devastating disease of citrus trees. In this study we measured behavioral responses of D. citri to combinations of visual, olfactory, and gustatory stimuli in test arenas. Stimuli were presented to the psyllids in droplets or lines of an emulsified wax formulation in two different arena types in no-choice tests. First, when placed on a colored ring situated halfway between the center and perimeter of a petri dish, D. citri spent more time on yellow versus gray rings; however, this response disappeared when either gray or yellow wax droplets were applied. When the psyllids were presented with droplets scented with terpenes, the response to both scent and color was increased. The addition of a dilute ( approximately 0.1 M) sucrose solution to the wax droplets increased the magnitude of D. citri responses. Next, groups of D. citri were placed on plastic laboratory film covering a sucrose solution, to mimic a leaf surface. Test stimuli were presented via two 'midribs' made from lines of emulsified wax formulation. Probing levels were measured as a function of color saturation and scent composition, and concentration. The test scents were based on qualitatively major volatiles emitted by Murraya paniculata (L.) Jack, Citrus aurantifolia (Christm.) Swingle, and C. sinensis (L.) Osbeck. The highest probing response was observed on the middle concentration (20- mu l scent/10 ml wax formulation) of the C. aurantifolia-scented wax lines. Results indicate that there are interactive effects between the different sensory modalities in directing host-plant assessment behavior. JF - Environmental Entomology AU - Patt, Joseph M AU - Meikle, William G AU - Mafra-Neto, Agenor AU - Setamou, Mamoudou AU - Mangan, Robert AU - Yang, Chenghai AU - Malik, Nasir AU - Adamczyk, John J AD - USDA-Agricultural Research Service, Subtropical Agricultural Research Center, Weslaco, TX., joseph.patt@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1494 EP - 1502 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 6 SN - 0046-225X, 0046-225X KW - Entomology Abstracts; Ecology Abstracts KW - Color KW - Leaves KW - Plastics KW - Scents KW - Sucrose KW - Taste stimuli KW - Terpenes KW - Trees KW - Volatiles KW - Citrus aurantifolia KW - Diaphorina citri KW - Murraya paniculata KW - D 04040:Ecosystem and Ecology Studies KW - Z 05350:Medical, Veterinary, and Agricultural Entomology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954730657?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Multimodal+Cues+Drive+Host-Plant+Assessment+in+Asian+Citrus+Psyllid+%28Diaphorina+citri%29&rft.au=Patt%2C+Joseph+M%3BMeikle%2C+William+G%3BMafra-Neto%2C+Agenor%3BSetamou%2C+Mamoudou%3BMangan%2C+Robert%3BYang%2C+Chenghai%3BMalik%2C+Nasir%3BAdamczyk%2C+John+J&rft.aulast=Patt&rft.aufirst=Joseph&rft.date=2011-12-01&rft.volume=40&rft.issue=6&rft.spage=1494&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN11149 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 51 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Terpenes; Scents; Trees; Volatiles; Taste stimuli; Sucrose; Leaves; Plastics; Color; Diaphorina citri; Murraya paniculata; Citrus aurantifolia DO - http://dx.doi.org/10.1603/EN11149 ER - TY - JOUR T1 - Assessment of Bird-Management Strategies to Protect Sunflowers AN - 954730323; 16387731 AB - Even though avian damage to sunflower (Helianthus annuus L.) is a worldwide economic issue, several of the current methods used to reduce sunflower damage were developed and tested in the Prairie Pothole Region of the United States. An intensive research program was conducted in that area because of the regionalized concentration of sunflower production and the severe incidences of blackbird (Icteridae) depredation. During the past 40 years, federal and university scientists tested chemical and physical frightening agents, aversive repellents, bird-resistant sunflowers, decoy crops, habitat management, population management, and cultural modifications in cropping. Some of these techniques have broad applicability and may be useful in depredation scenarios involving other bird species and crops. Population suppression is intuitively appealing, but it typically fails beyond local scales because of avian mobility, population dynamics, and public antipathy. Scare devices, repellents, habitat management, and decoy crops are more likely to meet the test of predictable efficacy and practicality. JF - Bioscience AU - Linz, George M AU - Homan, HJeffrey AU - Werner, Scott J AU - Hagy, Heath M AU - Bleier, William J AD - George M. Linz is a supervisory research wildlife biologist at the US Department of Agriculture, Wildlife Services, National Wildlife Research Center (USDA-WS-NWRC) in Bismarck, North Dakota, and is an adjunct professor of zoology in the Department of Biological Sciences at North Dakota State University, in Fargo., george.m.linz@aphis.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 960 EP - 970 PB - American Institute of Biological Sciences, 1444 Eye St. N.W. Washington, DC 20005 United States VL - 61 IS - 12 SN - 0006-3568, 0006-3568 KW - Sustainability Science Abstracts KW - Crops KW - Economics KW - Ethnic groups KW - Habitat KW - Mobility KW - Research programs KW - culture KW - prairies KW - Icteridae KW - Canada, Saskatchewan, Prairie Pothole Region KW - USA KW - Helianthus annuus KW - Helianthus KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954730323?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Bioscience&rft.atitle=Assessment+of+Bird-Management+Strategies+to+Protect+Sunflowers&rft.au=Linz%2C+George+M%3BHoman%2C+HJeffrey%3BWerner%2C+Scott+J%3BHagy%2C+Heath+M%3BBleier%2C+William+J&rft.aulast=Linz&rft.aufirst=George&rft.date=2011-12-01&rft.volume=61&rft.issue=12&rft.spage=960&rft.isbn=&rft.btitle=&rft.title=Bioscience&rft.issn=00063568&rft_id=info:doi/10.1525%2Fbio.2011.61.10.10 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 63 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Mobility; prairies; Economics; Habitat; Research programs; Ethnic groups; culture; Crops; Helianthus annuus; Icteridae; Helianthus; USA; Canada, Saskatchewan, Prairie Pothole Region DO - http://dx.doi.org/10.1525/bio.2011.61.10.10 ER - TY - JOUR T1 - Life History and Ecology of Coyotes in the Mid-Atlantic States: A Summary of the Scientific Literature AN - 954697512; 16386956 AB - Relatively little information has been published on Coyotes in the eastern United States, particularly in the mid-Atlantic region, the last area of the contiguous US to be colonized by Coyotes. Increases in eastern Coyote distribution and abundance have been documented, and concerns about their impact on wildlife and livestock are growing. Information from published and unpublished manuscripts, theses, dissertations, and state wildlife agency records in the mid-Atlantic region were examined and synthesized. This review provides a comprehensive summary of Coyote ecology in the mid-Atlantic for natural resource managers and researchers. JF - Southeastern Naturalist AU - Mastro, Lauren L AD - US Department of Agriculture, Animal and Plant Health Inspection Service, Wildlife Services, National Wildlife Research Center, Logan Field Station, 730 Yokum Street, Elkins, WV 26241, Lauren.L.Mastro@aphis.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 721 EP - 730 PB - Humboldt Field Research Institute, PO Box 9 Steuben ME 04680-0009 United States VL - 10 IS - 4 SN - 1528-7092, 1528-7092 KW - Ecology Abstracts KW - Life history KW - Wildlife KW - Abundance KW - Livestock KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954697512?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Southeastern+Naturalist&rft.atitle=Life+History+and+Ecology+of+Coyotes+in+the+Mid-Atlantic+States%3A+A+Summary+of+the+Scientific+Literature&rft.au=Mastro%2C+Lauren+L&rft.aulast=Mastro&rft.aufirst=Lauren&rft.date=2011-12-01&rft.volume=10&rft.issue=4&rft.spage=721&rft.isbn=&rft.btitle=&rft.title=Southeastern+Naturalist&rft.issn=15287092&rft_id=info:doi/10.1656%2F058.010.0411 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 65 N1 - Last updated - 2013-06-28 N1 - SubjectsTermNotLitGenreText - Life history; Abundance; Wildlife; Livestock DO - http://dx.doi.org/10.1656/058.010.0411 ER - TY - JOUR T1 - Foliar Resistance to Fall Armyworm in Corn Germplasm Lines that Confer Resistance to Root- and Ear-Feeding Insects** AN - 954695366; 16386583 AB - A holistic approach to developing new corn germplasm that confers multiple insect resistance in various plant tissues at different growth stages was examined. Eight corn germplasm lines were examined for their foliar resistance to fall armyworm [Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae)] and natural enemy attraction at V6-V8 (or 6-8 leaf) stages in 2008 and 2009. Four corn germplasm lines with known levels of resistance to root- and ear-feeding insects ['CRW3(S1)C6', 'B37**H84', 'SIM6' and 'EPM6'], and four germplasm entries with different levels of S. frugiperda resistance ('Mp708', 'Ab24E', 'FAW7061' and 'FAW7111') were evaluated in the study. All plants were manually infested with 15-20 neonate S. frugiperda larvae per plant, and injury was rated 7 and 14 d after infestation. Based on cluster analysis of S. frugiperda injury rating and predator survey data, 'Mp708' and 'FAW7061' were the most resistant, whereas 'Ab24E' and 'EPM6' were the most susceptible to fall armyworm feeding. The western corn rootworm-resistant 'CRW3(S1)C6' showed resistance to S. frugiperda feeding. Surveys for the diversity and abundance of predators of S. frugiperda in each experimental plot were also conducted 7 d after infestation. 'CRW3(S1)C6' and 'Ab24E' had the highest and lowest predator abundance, respectively. However, there was no direct correlation between S. frugiperda injury ratings and predator abundance. The current study demonstrated the feasibility of developing foliage-, root-, and ear-feeding insect-resistant germplasm covering multiple corn growth stages. In addition, the possibility of utilizing plant volatiles to attract predators, and reduce pest populations and crop damage is discussed. JF - Florida Entomologist AU - Ni, Xinzhi AU - Chen, Yigen AU - Hibbard, Bruce E AU - Wilson, Jeffrey P AU - Williams, WPaul AU - Buntin, GDavid AU - Ruberson, John R AU - Li, Xianchun AD - Crop Genetics and Breeding Research Unit, USDA-ARS, University of Georgia, Tifton, GA 31793 Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 971 EP - 981 PB - Florida Entomological Society, PO Box 1007 Lutz FL 33548-1007 United States VL - 94 IS - 4 SN - 0015-4040, 0015-4040 KW - Ecology Abstracts; Entomology Abstracts KW - Feeding KW - Data processing KW - Natural enemies KW - Spodoptera frugiperda KW - Injuries KW - Allelochemicals KW - Abundance KW - Leaves KW - Predators KW - Growth stage KW - Crops KW - Lepidoptera KW - Infestation KW - Germplasm KW - Noctuidae KW - Pests KW - Neonates KW - D 04040:Ecosystem and Ecology Studies KW - Z 05350:Medical, Veterinary, and Agricultural Entomology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954695366?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Florida+Entomologist&rft.atitle=Foliar+Resistance+to+Fall+Armyworm+in+Corn+Germplasm+Lines+that+Confer+Resistance+to+Root-+and+Ear-Feeding+Insects**&rft.au=Ni%2C+Xinzhi%3BChen%2C+Yigen%3BHibbard%2C+Bruce+E%3BWilson%2C+Jeffrey+P%3BWilliams%2C+WPaul%3BBuntin%2C+GDavid%3BRuberson%2C+John+R%3BLi%2C+Xianchun&rft.aulast=Ni&rft.aufirst=Xinzhi&rft.date=2011-12-01&rft.volume=94&rft.issue=4&rft.spage=971&rft.isbn=&rft.btitle=&rft.title=Florida+Entomologist&rft.issn=00154040&rft_id=info:doi/10.1653%2F024.094.0434 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2012-04-06 N1 - SubjectsTermNotLitGenreText - Feeding; Natural enemies; Data processing; Injuries; Abundance; Allelochemicals; Leaves; Predators; Growth stage; Crops; Infestation; Germplasm; Neonates; Pests; Spodoptera frugiperda; Noctuidae; Lepidoptera DO - http://dx.doi.org/10.1653/024.094.0434 ER - TY - JOUR T1 - Biology and Life History of Tetrastichus planipennisi (Hymenoptera: Eulophidae), a Larval Endoparasitoid of the Emerald Ash Borer (Coleoptera: Buprestidae) AN - 954695286; 16386579 AB - Tetrastichus planipennisi (Hymenoptera: Eulophidae) is a gregarious larval endoparasitoid from China that is being released in the United States as a biocontrol agent of the emerald ash borer (Agrilus planipennis Fairmaire), an exotic beetle responsible for widespread ash mortality. The developmental time of immature stages, adult longevity, reproductive age, oviposition rate, and realized fecundity were determined in the laboratory under normal rearing conditions (25 +/- 2 degree C, 65 +/- 10% RH, and L:D 16:8 hr photoperiod). It takes approximately four weeks to complete a single generation (from egg to adult) under normal rearing conditions. While male wasps lived for a median of 5 weeks, females lived significantly longer with a median survival time of 6 weeks and a maximum survival time of 9 weeks. Newly emerged females appeared to be as capable of producing progeny as older females, indicating that T. planipennisi may be synovigenic. The average number of progeny per reproductive female remained relatively constant through the first 6 weeks of the trial with each reproductively active female producing 23-26 progeny each week. Lifetime realized fecundity of the adults averaged 57 progeny per reproductively active female with a female-tomale sex ratio of approximately 3:1; the maximum number of progeny produced by a single female was 108. These results suggest that T. planipennisi may have several generations in the mid-Atlantic and Midwestern regions of United States, where normal growing seasons (with average temperature >25 degree C) are normally four to five months (May-Sep). Because of the gregarious nature, long life span and oviposition period of adults, T. planipennisi is likely to have multiple overlapping generations and has the potential to be an effective biocontrol agent against EAB. JF - Florida Entomologist AU - Duan, Jian J AU - Oppel, Craig B AU - Ulyshen, Michael D AU - Bauer, Leah S AU - LeLito, Jonathan AD - USDA ARS, Beneficial Insects Introduction Research Unit, Newark, DE 19713, jian.duan@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 933 EP - 940 PB - Florida Entomological Society, PO Box 1007 Lutz FL 33548-1007 United States VL - 94 IS - 4 SN - 0015-4040, 0015-4040 KW - Ecology Abstracts; Entomology Abstracts KW - Age KW - Biological control KW - Fecundity KW - Life history KW - Life span KW - Longevity KW - Mortality KW - Oviposition KW - Photoperiods KW - Progeny KW - Sex ratio KW - Survival KW - Temperature effects KW - Buprestidae KW - Eulophidae KW - Hymenoptera KW - Coleoptera KW - Agrilus KW - Tetrastichus KW - Z 05330:Reproduction and Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954695286?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Soil+and+Tillage+Research&rft.atitle=Effects+of+transmission+gear+selection+on+tractor+performance+and+fuel+costs+during+deep+tillage+operations&rft.au=Kichler%2C+C+M%3BFulton%2C+J+P%3BRaper%2C+R+L%3BMcDonald%2C+T+P%3BZech%2C+W+C&rft.aulast=Kichler&rft.aufirst=C&rft.date=2011-06-01&rft.volume=113&rft.issue=2&rft.spage=105&rft.isbn=&rft.btitle=&rft.title=Soil+and+Tillage+Research&rft.issn=01671987&rft_id=info:doi/10.1016%2Fj.still.2011.03.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 17 N1 - Last updated - 2012-12-03 N1 - SubjectsTermNotLitGenreText - Biological control; Temperature effects; Mortality; Age; Photoperiods; Sex ratio; Life span; Survival; Longevity; Fecundity; Life history; Progeny; Oviposition; Coleoptera; Buprestidae; Hymenoptera; Tetrastichus; Agrilus; Eulophidae DO - http://dx.doi.org/10.1653/024.094.0430 ER - TY - JOUR T1 - Effects of Sublethal Pyrethroid Exposure on the Host-Seeking Behavior of Female Mosquitoes AN - 954665556; 16388186 AB - A common method of adult mosquito control consists of residual application on surfaces and aerial spraying often using pyrethroids. However, not all insects that contact insecticides are killed. Sublethal exposure to neurotoxic compounds can negatively affect sensory organs and reduce efficiency of host location. Flight tracks of host-seeking female Culex quinquefasciatus, Anopheles albimanus, and Aedes aegypti in a wind tunnel were video-recorded to compare activation of host-seeking and patterns of flight orientation to host odors. During host-seeking flights, all three mosquito species differed significantly in flight duration, velocity, turn angle, and angular velocity. Mosquitoes were then exposed to sublethal levels (LD25) of pyrethroid insecticides to evaluate the effects of the neurotoxicants 24 hours post-exposure. Significant reductions in time of activation to flight and flight direction were observed in mosquitoes exposed to deltamethrin and permethrin. Additionally, pesticide-treated Cx. quinquefasciatus mosquitoes flew significantly slower, spent more time in flight, and turned more frequently than untreated controls. JF - Journal of Vector Ecology AU - Cohnstaedt, Lee W AU - Allan, Sandra A AD - USDA-ARS-CMAVE, 1600 SW 23 Drive, Gainesville, FL 32608, U.S.A., Sandy.Allan@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 395 EP - 403 PB - Society for Vector Ecology VL - 36 IS - 2 SN - 1081-1710, 1081-1710 KW - Entomology Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources; Ecology Abstracts KW - Culex quinquefasciatus KW - Aedes aegypti KW - Anopheles albimanus KW - pesticide exposure KW - host orientation KW - Vectors KW - Permethrin KW - Pest control KW - Hosts KW - Spraying KW - Deltamethrin KW - Sense organs KW - Disease transmission KW - Flight KW - Host searching behavior KW - Insecticides KW - Neurotoxicity KW - Host location KW - Wind tunnels KW - Odor KW - Females KW - Pyrethroids KW - Aquatic insects KW - D 04040:Ecosystem and Ecology Studies KW - Z 05350:Medical, Veterinary, and Agricultural Entomology KW - Q1 08485:Species interactions: pests and control KW - Q5 08524:Public health, medicines, dangerous organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954665556?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Vector+Ecology&rft.atitle=Effects+of+Sublethal+Pyrethroid+Exposure+on+the+Host-Seeking+Behavior+of+Female+Mosquitoes&rft.au=Cohnstaedt%2C+Lee+W%3BAllan%2C+Sandra+A&rft.aulast=Cohnstaedt&rft.aufirst=Lee&rft.date=2011-12-01&rft.volume=36&rft.issue=2&rft.spage=395&rft.isbn=&rft.btitle=&rft.title=Journal+of+Vector+Ecology&rft.issn=10811710&rft_id=info:doi/10.1111%2Fj.1948-7134.2011.00180.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 37 N1 - Last updated - 2014-11-12 N1 - SubjectsTermNotLitGenreText - Insecticides; Wind tunnels; Pest control; Hosts; Females; Aquatic insects; Disease transmission; Flight; Host searching behavior; Neurotoxicity; Host location; Odor; Permethrin; Vectors; Spraying; Pyrethroids; Deltamethrin; Sense organs; Culex quinquefasciatus; Aedes aegypti; Anopheles albimanus DO - http://dx.doi.org/10.1111/j.1948-7134.2011.00180.x ER - TY - JOUR T1 - Efficacy of Aerial Ultra-Low Volume Applications of Two Novel Water-Based Formulations of Unsynergized Pyrethroids Against Riceland Mosquitoes In Greece AN - 954665089; 16387285 AB - We assessed the efficacy of ultra-low volume aerial adulticiding with 2 new water-based, unsynergized formulations of Aqua-K-Othrin (2% deltamethrin) and Pesguard S102 (10% d-phenothrin) against the riceland mosquitoes of Greece. A helicopter with Global Positioning System (GPS) navigation, real-time weather recording, and spray dispersal modeling (AgDISP) was utilized to accurately treat the experimental blocks by adjusting spray line positions to changing meteorological conditions. Two application rates were applied per formulation that corresponded to 0.75 and 1.00 g AI/ha of deltamethrin and 7.50 and 10.00 g AI/ha of d-phenothrin. The mosquitoes used for the trials were the main nuisance species found in rice field areas of Thessaloniki, which were primarily Aedes caspius, followed by Culex modestus and Anopheles sacharovi. Overall mean mortality of caged mosquitoes was 69.2% and 64.8% for deltamethrin and d-phenothrin, respectively. Mean population decrease in wild mosquito populations within the treatment areas was 76.5% and 78% for deltamethrin and d-phenothrin, respectively. The AgDISP dispersal model, coupled with GPS navigation and real-time weather recording, enabled accurate placement of the spray cloud such that the majority of the treatment area received sufficiently high droplet densities to result in uniform caged-mosquito mortality across all sampling sites. JF - Journal of the American Mosquito Control Association AU - Chaskopoulou, Alexandra AU - Latham, Mark D AU - Pereira, Roberto M AU - Connelly, Roxanne AU - Bonds, Jane AS AU - Koehler, Philip G AD - USDA-ARS European Biological Control Laboratory, Tsimiski 43, 54623 Thessaloniki, Greece Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 414 EP - 422 PB - American Mosquito Control Association, P.O. Box 586 Milltown, NJ 08850-0586 United States VL - 27 IS - 4 SN - 8756-971X, 8756-971X KW - ASFA 3: Aquatic Pollution & Environmental Quality; Entomology Abstracts; ASFA 1: Biological Sciences & Living Resources KW - Aerial adulticiding KW - mosquitoes KW - deltamethrin KW - d-phenothrin KW - Positioning systems KW - Greece KW - Deltamethrin KW - Greece, Kentriki Makedonia, Former Yugoslav Republic, Thessaloniki KW - Models KW - Culex modestus KW - Rice fields KW - Greece, Kentriki Macedonia, Thessaloniki, Former Yugoslav Republic KW - Sampling KW - Pyrethroids KW - Aquatic insects KW - Weather KW - Mortality KW - Oryza sativa KW - Pest control KW - Clouds KW - Aedes caspius KW - Spray KW - Dispersal KW - Anopheles sacharovi KW - Mortality causes KW - Helicopters KW - Z 05340:Ecology and Behavior KW - Q1 08485:Species interactions: pests and control KW - Q5 08524:Public health, medicines, dangerous organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954665089?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+the+American+Mosquito+Control+Association&rft.atitle=Efficacy+of+Aerial+Ultra-Low+Volume+Applications+of+Two+Novel+Water-Based+Formulations+of+Unsynergized+Pyrethroids+Against+Riceland+Mosquitoes+In+Greece&rft.au=Chaskopoulou%2C+Alexandra%3BLatham%2C+Mark+D%3BPereira%2C+Roberto+M%3BConnelly%2C+Roxanne%3BBonds%2C+Jane+AS%3BKoehler%2C+Philip+G&rft.aulast=Chaskopoulou&rft.aufirst=Alexandra&rft.date=2011-12-01&rft.volume=27&rft.issue=4&rft.spage=414&rft.isbn=&rft.btitle=&rft.title=Journal+of+the+American+Mosquito+Control+Association&rft.issn=8756971X&rft_id=info:doi/10.2987%2F11-6177.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 35 N1 - Last updated - 2014-11-12 N1 - SubjectsTermNotLitGenreText - Clouds; Positioning systems; Rice fields; Spray; Pest control; Aquatic insects; Helicopters; Mortality causes; Mortality; Weather; Sampling; Dispersal; Pyrethroids; Deltamethrin; Models; Culex modestus; Aedes caspius; Oryza sativa; Anopheles sacharovi; Greece; Greece, Kentriki Macedonia, Thessaloniki, Former Yugoslav Republic; Greece, Kentriki Makedonia, Former Yugoslav Republic, Thessaloniki DO - http://dx.doi.org/10.2987/11-6177.1 ER - TY - JOUR T1 - Lesser Peachtree Borer (Lepidoptera: Sesiidae) Oviposition on Prunus Germplasm AN - 954660503; 16387986 AB - The lesser peachtree borer, Synanthedon pictipes (Grote and Robinson) (Lepidoptera: Sesiidae), is a serious pest of peach, Prunus persica (L.) Batsch, across the southeastern United States. We examined oviposition by S. pictipes on field-grown Prunus scion and rootstock cultivars and two endemic Prunus spp. when sawn limbs, not roots, were assayed in the laboratory. A choice test compared oviposition on the peach scion 'Harvester', peach rootstock 'Guardian', plum peach hybrid rootstock 'MP-29', and the plum hybrid rootstock 'Sharpe'. A significantly lower percentage of eggs occurred on limbs of Sharpe rootstock than other choices. A choice test using two endemic hosts, black cherry (P. serotina Ehrh.) and Chickasaw plum (P. angustifolia Marsh.), along with Sharpe rootstock, found a lower percentage of eggs on limbs of Sharpe than either endemic host. However, when only limbs of Sharpe and a decoy were used, almost all eggs were laid on Sharpe. Interestingly, when Harvester and Sharpe limbs were paired side by side, a higher percentage of eggs were recovered from the Harvester limb than from the Sharpe limb. An analysis of volatiles from Sharpe may identify why fewer eggs were laid on it. Because S. pictipes attacks host trees above ground and Sharpe rootstock on grafted trees grows below ground, this rootstock might be a management option against the congeneric, root-attacking peachtree borer, S. exitiosa (Say). Our results suggest that high budding a peach scion onto Sharpe rootstock, thus allowing the rootstock to serve as the trunk, warrants further investigation against S. exitiosa under orchard conditions. JF - Environmental Entomology AU - Cottrell, TE AU - Beckman, T G AU - Horton, D L AD - USDA, Agricultural Research Service, Southeastern Fruit and Tree Nut Research Laboratory, 21 Dunbar Rd., Byron, GA 31008., ted.cottrell@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1465 EP - 1470 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 6 SN - 0046-225X, 0046-225X KW - Animal Behavior Abstracts; Entomology Abstracts; Ecology Abstracts KW - Borers KW - Budding KW - Eggs KW - Germplasm KW - Hybrids KW - Limbs KW - Marshes KW - Orchards KW - Oviposition KW - Pests KW - Roots KW - Rootstocks KW - Scions KW - Trees KW - Volatiles KW - cultivars KW - harvesting KW - hybrids KW - orchards KW - pests KW - Sesiidae KW - USA, Southeast KW - Lepidoptera KW - Prunus KW - Prunus persica KW - Y 25150:General/Miscellaneous KW - D 04040:Ecosystem and Ecology Studies KW - Z 05330:Reproduction and Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954660503?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Lesser+Peachtree+Borer+%28Lepidoptera%3A+Sesiidae%29+Oviposition+on+Prunus+Germplasm&rft.au=Cottrell%2C+TE%3BBeckman%2C+T+G%3BHorton%2C+D+L&rft.aulast=Cottrell&rft.aufirst=TE&rft.date=2011-12-01&rft.volume=40&rft.issue=6&rft.spage=1465&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN11056 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 19 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Scions; Trees; Rootstocks; Roots; Marshes; Orchards; Eggs; Limbs; Volatiles; Hybrids; Germplasm; Pests; Oviposition; Borers; Budding; pests; orchards; hybrids; harvesting; cultivars; Sesiidae; Prunus persica; Prunus; Lepidoptera; USA, Southeast DO - http://dx.doi.org/10.1603/EN11056 ER - TY - JOUR T1 - Effects of Liberibacter-Infective Bactericera cockerelli (Hemiptera: Triozidae) Density on Zebra Chip Potato Disease Incidence, Potato Yield, and Tuber Processing Quality AN - 954660111; 16387902 AB - In plant pathosystems involving insect vectors, disease spread, incidence, and severity often depend on the density of the vector population and its rate of infectivity with the disease pathogen. The potato psyllid, Bactericera cockerelli (Sulc), has recently been associated with zebra chip (ZC), an emerging and economically important disease of potato in the United States, Mexico, Central America, and New Zealand. "Candidatus Liberibacter solanacearum," a previously undescribed species of liberibacter has been linked to the disease and is transmitted to potato by B. cockerelli. Experiments were conducted under laboratory and field conditions to determine the impact of B. cockerelli density on ZC incidence, potato yield, and tuber processing quality. Insect densities ranging from one to 25 liberibacter-infective psyllids per plant were used during the experiments. Results showed that a single adult potato psyllid was capable of inoculating liberibacter to potato and causing ZC disease after a 72-h inoculation access period and was as damaging as 25 psyllids per plant. In addition, ZC-diseased plants showed a sharp reduction in tuber yield but the disease response was independent of the density of psyllids. Furthermore, both glucose and sucrose were found to have highly elevated concentrations in ZC-diseased potato tubers compared with noninfected ones and psyllid density did not vary the response. The high reducing sugar concentrations found in ZC-infected potato tubers are believed to be responsible for browning and reduced quality in processed ZC-infected tubers. This information could help ZC-affected potato producers in making effective management decisions for this serious disease. JF - Journal of Economic Entomology AU - Buchman, Jeremy L AU - Heilman, Blaine E AU - Munyaneza, Joseph E AD - USDA-ARS, Yakima Agricultural Research Laboratory, 5230 Konnowac Pass Road, Wapato, WA 98951., joseph.munyaneza@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1783 EP - 1792 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 104 IS - 6 SN - 0022-0493, 0022-0493 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Entomology Abstracts KW - Decision making KW - Disease spread KW - Glucose KW - Infectivity KW - Inoculation KW - Pathogens KW - Plant diseases KW - Sucrose KW - Sugar KW - Tubers KW - Vectors KW - Bacteria KW - Hemiptera KW - Solanum tuberosum KW - Triozidae KW - A 01360:Plant Diseases KW - Z 05350:Medical, Veterinary, and Agricultural Entomology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954660111?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Economic+Entomology&rft.atitle=Effects+of+Liberibacter-Infective+Bactericera+cockerelli+%28Hemiptera%3A+Triozidae%29+Density+on+Zebra+Chip+Potato+Disease+Incidence%2C+Potato+Yield%2C+and+Tuber+Processing+Quality&rft.au=Buchman%2C+Jeremy+L%3BHeilman%2C+Blaine+E%3BMunyaneza%2C+Joseph+E&rft.aulast=Buchman&rft.aufirst=Jeremy&rft.date=2011-12-01&rft.volume=104&rft.issue=6&rft.spage=1783&rft.isbn=&rft.btitle=&rft.title=Journal+of+Economic+Entomology&rft.issn=00220493&rft_id=info:doi/10.1603%2FEC11146 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 37 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Sugar; Decision making; Infectivity; Disease spread; Plant diseases; Sucrose; Inoculation; Glucose; Vectors; Tubers; Pathogens; Bacteria; Solanum tuberosum; Triozidae; Hemiptera DO - http://dx.doi.org/10.1603/EC11146 ER - TY - JOUR T1 - Limited Field Establishment of a Weed Biocontrol Agent, Floracarus perrepae (Acariformes: Eriophyidae), Against Old World Climbing Fern in Florida - A Possible Role of Mite Resistant Plant Genotypes AN - 954659758; 16387975 AB - The leaflet galling mite Floracarus perrepae Knihinicki & Boczek was released on Lygodium microphyllum (Cav.) in 63 plots in Florida from 2008 to 2009. Mites transferred onto field plants in 34 plots, but failed to establish populations in the majority of plots. Leaflet galls were observed in only six plots, and in only two plots did mite populations persist for >12 mo. Bates of mite transfer onto field plants were similar for methods using direct transfer of galls versus approaches using passive transfer of mites from infested plants. Often leaflets on some L. microphyllum plants were heavily galled by F. perrepae, whereas leaflets on intertwined stems of other L. microphyllum plants were ungalled but exhibited a characteristic browning and scorching of the leaflet tips. Living mites were consistently present on the undersurface of scorched leaflet tips on ungalled plants, suggesting that this damage might be caused by mite feeding on L. microphyllum genotypes that did not support induction of leaflet galls. Plant nutritional status did not account for differences in galling response, because there were no differences in leaflet nitrogen between galled and ungalled stems. We review those factors known to affect the colonization of biological control agents, and discuss how they may have contributed to the lower than expected rate of F. perrepae establishment. JF - Environmental Entomology AU - Boughton, Anthony J AU - Pemberton, Robert W AD - USDA-Agricultural Research Service, Invasive Plant Research Laboratory, 3225 College Avenue, Fort Lauderdale, FL 33314, anthony.boughton@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1448 EP - 1457 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 6 SN - 0046-225X, 0046-225X KW - Entomology Abstracts; Ecology Abstracts KW - Biological control KW - Climbing KW - Colonization KW - Feeding KW - Galls KW - Genotypes KW - Mites KW - Nitrogen KW - Nutritional status KW - Reviews KW - Stems KW - Weeds KW - colonization KW - feeding KW - ferns KW - weeds KW - USA, Florida KW - Eriophyidae KW - Lygodium microphyllum KW - Z 05360:Genetics and Evolution KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954659758?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Limited+Field+Establishment+of+a+Weed+Biocontrol+Agent%2C+Floracarus+perrepae+%28Acariformes%3A+Eriophyidae%29%2C+Against+Old+World+Climbing+Fern+in+Florida+-+A+Possible+Role+of+Mite+Resistant+Plant+Genotypes&rft.au=Boughton%2C+Anthony+J%3BPemberton%2C+Robert+W&rft.aulast=Boughton&rft.aufirst=Anthony&rft.date=2011-12-01&rft.volume=40&rft.issue=6&rft.spage=1448&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN11030 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 59 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Nutritional status; Biological control; Weeds; Feeding; Colonization; Climbing; Reviews; Genotypes; Stems; Nitrogen; Galls; feeding; Mites; weeds; ferns; colonization; Eriophyidae; Lygodium microphyllum; USA, Florida DO - http://dx.doi.org/10.1603/EN11030 ER - TY - JOUR T1 - Microbiological Evaluation of Water Quality from Urban Watersheds for Domestic Water Supply Improvement AN - 954648386; 16435111 AB - Agricultural and urban runoffs may be major sources of pollution of water bodies and major sources of bacteria affecting the quality of drinking water. Of the different pathways by which bacterial pathogens can enter drinking water, this one has received little attention to date; that is, because soils are often considered to be near perfect filters for the transport of bacterial pathogens through the subsoil to groundwater. The goals of this study were to determine the distribution, diversity, and antimicrobial resistance of pathogenic Escherichia coli isolates from low flowing river water and sediment with inputs from different sources before water is discharged into ground water and to compare microbial contamination in water and sediment at different sampling sites. Water and sediment samples were collected from 19 locations throughout the watershed for the isolation of pathogenic E. coli. Heterotrophic plate counts and E. coli were also determined after running tertiary treated water through two tanks containing aquifer sand material. Presumptive pathogenic E. coli isolates were obtained and characterized for virulent factors and antimicrobial resistance. None of the isolates was confirmed as Shiga toxin E. coli (STEC), but as others, such as enterotoxigenic E. coli (ETEC). Pulsed field gel electrophoresis (PFGE) was used to show the diversity E. coli populations from different sources throughout the watershed. Seventy six percent of the isolates from urban sources exhibited resistance to more than one antimicrobial agent. A subsequent filtration experiment after water has gone through filtration tanks containing aquifer sand material showed that there was a 1 to 2 log reduction in E. coli in aquifer sand tank. Our data showed multiple strains of E. coli without virulence attributes, but with high distribution of resistant phenotypes. Therefore, the occurrence of E. coli with multiple resistances in the environment is a matter of great concern due to possible transfer of resistant genes from nonpathogenic to pathogenic strains that may result in increased duration and severity of morbidity. JF - International Journal of Environmental Research and Public Health AU - Ibekwe, A M AU - Murinda, SE AU - Graves, A K AD - U.S. Salinity Laboratory, USDA-ARS, 450 West Big Springs Road, Riverside, CA 92507, USA Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 4460 EP - 4476 VL - 8 IS - 12 SN - 1660-4601, 1660-4601 KW - Sustainability Science Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Aqualine Abstracts; Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts; Health & Safety Science Abstracts; Pollution Abstracts KW - Aquifers KW - Aquifer KW - Environmental research KW - Microbial contamination KW - Water quality KW - Watersheds KW - Tertiary treatment KW - Drinking Water KW - Resistance KW - Sand KW - Escherichia coli KW - Sediment Contamination KW - Biological pollutants KW - Bacteria (Enterobacteriaceae) (Escherichia) KW - Bacteria KW - Sediment pollution KW - Pathogenic bacteria KW - Pathogens KW - Filtration KW - Species diversity KW - Groundwater pollution KW - Drinking water KW - Groundwater KW - AQ 00001:Water Resources and Supplies KW - M3 1010:Issues in Sustainable Development KW - P 2000:FRESHWATER POLLUTION KW - M2 556.18:Water Management (556.18) KW - H 2000:Transportation KW - Q5 08504:Effects on organisms KW - SW 3060:Water treatment and distribution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954648386?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Journal+of+Environmental+Research+and+Public+Health&rft.atitle=Microbiological+Evaluation+of+Water+Quality+from+Urban+Watersheds+for+Domestic+Water+Supply+Improvement&rft.au=Ibekwe%2C+A+M%3BMurinda%2C+SE%3BGraves%2C+A+K&rft.aulast=Ibekwe&rft.aufirst=A&rft.date=2011-12-01&rft.volume=8&rft.issue=12&rft.spage=4460&rft.isbn=&rft.btitle=&rft.title=International+Journal+of+Environmental+Research+and+Public+Health&rft.issn=16604601&rft_id=info:doi/10.3390%2Fijerph8124460 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Sediment pollution; Aquifer; Filtration; Drinking Water; Pathogenic bacteria; Species diversity; Biological pollutants; Microbial contamination; Watersheds; Aquifers; Environmental research; Water quality; Sand; Groundwater pollution; Pathogens; Groundwater; Drinking water; Tertiary treatment; Bacteria (Enterobacteriaceae) (Escherichia); Bacteria; Resistance; Escherichia coli; Sediment Contamination DO - http://dx.doi.org/10.3390/ijerph8124460 ER - TY - JOUR T1 - Differences in Body Size and Egg Loads of Rhagoletis indifferens (Diptera: Tephritidae) from Introduced and Native Cherries AN - 954646516; 16388014 AB - The western cherry fruit fly, Rhagoletis indifferens Curran, infests introduced, domesticated sweet [Prunus avium (L.) L. ], and tart cherries (Prunus cerasus L.) as well as native bitter cherry, Prunus emarginata (Douglas) Eaton. Bitter cherries are smaller than sweet and tart cherries and this could affect various life history traits of flies. The objectives of the current study were to determine 1) if body size and egg loads of flies infesting sweet, tart, and bitter cherries differ from one another; and 2) if any observed body size differences are genetically based or caused by the host fruit environment. Pupae and adults of both sexes reared from larval-infested sweet and tart cherries collected in Washington and Montana were larger than those reared from bitter cherries. In addition, flies of both sexes caught on traps in sweet and tart cherry trees were larger than those caught in bitter cherry trees and females trapped from sweet and tart cherry trees had 54.0-98.8% more eggs. The progeny of flies from naturally-infested sweet and bitter cherries reared for one generation in the laboratory on sweet cherry did not differ in size. The same also was true for progeny of sweet and bitter cherry flies reared in the field on bitter cherry. The results suggest that the larger body sizes of flies from sweet and tart cherries than bitter cherries in the field are caused by host fruit and not genetic factors. JF - Environmental Entomology AU - Yee, Wee L AU - Goughnour, Robert B AU - Feder, Jeffrey L AD - USDA-ARS, Yakima Agricultural Research Laboratory, 5230 Konnowac Pass Rd., Wapato, WA 98951., wee.yee@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1353 EP - 1362 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 6 SN - 0046-225X, 0046-225X KW - Entomology Abstracts; Ecology Abstracts KW - Bitter taste KW - Body size KW - Eggs KW - Fruits KW - Genetic factors KW - Life history KW - Progeny KW - Sex KW - Sweet taste KW - Traps KW - Trees KW - body size KW - fruits KW - life history KW - Rhagoletis indifferens KW - USA, Washington KW - Prunus emarginata KW - USA, Montana KW - Prunus avium KW - Tephritidae KW - Prunus cerasus KW - Diptera KW - Z 05340:Ecology and Behavior KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954646516?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Differences+in+Body+Size+and+Egg+Loads+of+Rhagoletis+indifferens+%28Diptera%3A+Tephritidae%29+from+Introduced+and+Native+Cherries&rft.au=Yee%2C+Wee+L%3BGoughnour%2C+Robert+B%3BFeder%2C+Jeffrey+L&rft.aulast=Yee&rft.aufirst=Wee&rft.date=2011-12-01&rft.volume=40&rft.issue=6&rft.spage=1353&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN11128 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 40 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Fruits; Genetic factors; Sweet taste; Life history; Trees; Bitter taste; Body size; Traps; Progeny; Eggs; Sex; fruits; life history; body size; Prunus cerasus; Rhagoletis indifferens; Prunus avium; Prunus emarginata; Diptera; Tephritidae; USA, Washington; USA, Montana DO - http://dx.doi.org/10.1603/EN11128 ER - TY - JOUR T1 - Artificial Nest Cavity Used Successfully By Native Species and Avoided by European Starlings AN - 954645309; 16387225 AB - We describe a weather-durable cavity design used successfully by cavity-nesting species native to the eastern USA and, although accessible, avoided by European Starlings (Sturnus vulgaris). The artificial nest cavity was constructed using 9.5-cm inside diameter polyvinyl chloride tubes cut to 27.5-cm lengths. The tubes were mounted horizontally with 5.1-cm entry holes drilled through one of the capped ends. Eastern Bluebirds (Sialia sialis), House Wrens (Troglodytes aedon), and Tree Swallows (Tachycineta bicolor) nested in 49 of 100, newly mounted tubes on utility poles in north-central Ohio, USA from April through June 2009. These species nested in 85%% of the tubes during the same period in 2010 and fledged young from 94.1%% of nests. We added 10 nest tubes (27.5-cm long 17-cm inside diam) at sites similar to the smaller tubes in 2010. Two of the larger tubes were used by nesting starlings and six by native species. Cavity vertical depth has been shown to be an important feature in starling nest site selection, but our data from the larger tubes indicate that other factors are likely important. The smaller design could offer nesting opportunities for a range of native cavity-nesting species while limiting use by starlings. JF - Wilson Journal of Ornithology AU - Tyson, Laura A AU - Blackwell, Bradley F AU - Seamans, Thomas W AD - U.S. Department of Agriculture, Animal and Plant Health Inspection Service, Wildlife Services, National Wildlife Research Center, Ohio Field Station, 6100 Columbus Ave., Sandusky, OH 44870, USA, laura.a.tyson@@aphis.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 827 EP - 830 PB - Wilson Ornithological Society, Wilson Ornithological Society, Museum of Zoology Ann Arbor MI 48109-1079 United States VL - 123 IS - 4 SN - 1559-4491, 1559-4491 KW - Animal Behavior Abstracts; Ecology Abstracts KW - Cavities KW - Data processing KW - Houses KW - Indigenous species KW - Nests KW - Site selection KW - polyvinyl chloride KW - Sialia sialis KW - Sturnus vulgaris KW - Troglodytes aedon KW - Tachycineta bicolor KW - Y 25020:Territory, Reproduction and Sociality KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954645309?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Wilson+Journal+of+Ornithology&rft.atitle=Artificial+Nest+Cavity+Used+Successfully+By+Native+Species+and+Avoided+by+European+Starlings&rft.au=Tyson%2C+Laura+A%3BBlackwell%2C+Bradley+F%3BSeamans%2C+Thomas+W&rft.aulast=Tyson&rft.aufirst=Laura&rft.date=2011-12-01&rft.volume=123&rft.issue=4&rft.spage=827&rft.isbn=&rft.btitle=&rft.title=Wilson+Journal+of+Ornithology&rft.issn=15594491&rft_id=info:doi/10.1676%2F11-003.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 22 N1 - Last updated - 2013-02-08 N1 - SubjectsTermNotLitGenreText - Site selection; Indigenous species; Cavities; Houses; Data processing; polyvinyl chloride; Nests; Sialia sialis; Sturnus vulgaris; Troglodytes aedon; Tachycineta bicolor DO - http://dx.doi.org/10.1676/11-003.1 ER - TY - JOUR T1 - Salivary Gland Hypertrophy Virus of House Flies in Denmark: Prevalence, Host Range, and Comparison with a Florida Isolate AN - 954642964; 16388170 AB - House flies (Musca domestica) infected with Musca domestica salivary gland hypertrophy virus (MdSGHV) were found in fly populations collected from 12 out of 18 Danish livestock farms that were surveyed in 2007 and 2008. Infection rates ranged from 0.5% to 5% and averaged 1.2%. None of the stable flies (Stomoxys calcitrans), rat-tail maggot flies (Eristalis tenax) or yellow dung flies (Scathophaga stercoraria) collected from MdSGHV-positive farms displayed characteristic salivary gland hypertrophy (SGH). In laboratory transmission tests, SGH symptoms were not observed in stable flies, flesh flies (Sarcophaga bullata), black dump flies (Hydrotaea aenescens), or face flies (Musca autumnalis) that were injected with MdSGHV from Danish house flies. However, in two species (stable fly and black dump fly), virus injection resulted in suppression of ovarian development similar to that observed in infected house flies, and injection of house flies with homogenates prepared from the salivary glands or ovaries of these species resulted in MdSGHV infection of the challenged house flies. Mortality of virus-injected stable flies was the highest among the five species tested. Virulence of Danish and Florida isolates of MdSGHV was similar with three virus delivery protocols, as a liquid food bait (in sucrose, milk, or blood), sprayed onto the flies in a Potter spray tower, or by immersiion in a crude homogenate of infected house flies. The most effective delivery system was immersion in a homogenate of ten infected flies/ml of water, resulting in 56.2% and 49.6% infection of the house flies challenged with the Danish and Florida strains, respectively. JF - Journal of Vector Ecology AU - Geden, C J AU - Steenberg, T AU - Lietze, V-U AU - Boucias, D G AD - USDA, ARS, Center for Medical, Agricultural and Veterinary Entomology, 1600 SW 23 Dr., Gainesville, FL 32608, U.S.A., chris.geden@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 231 EP - 238 PB - Society for Vector Ecology VL - 36 IS - 2 SN - 1081-1710, 1081-1710 KW - Entomology Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology; Virology & AIDS Abstracts; Ecology Abstracts KW - Blood KW - Disease transmission KW - Dung KW - Farms KW - Food KW - Host range KW - Hypertrophy KW - Immersion KW - Infection KW - Livestock KW - Milk KW - Mortality KW - Ovaries KW - Salivary gland KW - Sucrose KW - Vectors KW - Virulence KW - Eristalis tenax KW - Musca domestica KW - Stomoxys calcitrans KW - Musca autumnalis KW - Sarcophaga bullata KW - Hydrotaea aenescens KW - Scathophaga stercoraria KW - A 01380:Plant Protection, Fungicides & Seed Treatments KW - Z 05340:Ecology and Behavior KW - V 22300:Methods KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954642964?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Vector+Ecology&rft.atitle=Salivary+Gland+Hypertrophy+Virus+of+House+Flies+in+Denmark%3A+Prevalence%2C+Host+Range%2C+and+Comparison+with+a+Florida+Isolate&rft.au=Geden%2C+C+J%3BSteenberg%2C+T%3BLietze%2C+V-U%3BBoucias%2C+D+G&rft.aulast=Geden&rft.aufirst=C&rft.date=2011-12-01&rft.volume=36&rft.issue=2&rft.spage=231&rft.isbn=&rft.btitle=&rft.title=Journal+of+Vector+Ecology&rft.issn=10811710&rft_id=info:doi/10.1111%2Fj.1948-7134.2011.00163.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 21 N1 - Last updated - 2012-10-19 N1 - SubjectsTermNotLitGenreText - Mortality; Farms; Host range; Milk; Food; Vectors; Salivary gland; Infection; Disease transmission; Livestock; Virulence; Blood; Hypertrophy; Sucrose; Dung; Immersion; Ovaries; Eristalis tenax; Musca domestica; Stomoxys calcitrans; Hydrotaea aenescens; Musca autumnalis; Scathophaga stercoraria; Sarcophaga bullata DO - http://dx.doi.org/10.1111/j.1948-7134.2011.00163.x ER - TY - JOUR T1 - Differences in aquatic communities between wetlands created by an agricultural water recycling system AN - 926903844; 16356353 AB - Establishment of an agricultural water recycling system known as the wetland reservoir subirrigation system (WRSIS) results in the creation of two different types of wetlands adjacent to agricultural fields. Each WRSIS consists of one treatment wetland designed to process agricultural contaminants (WRSIS wetlands) and one storage wetland for holding subirrigation water (WRSIS reservoirs). Previous WRSIS related research has focused on the filtration ability and development of aquatic plants within WRSIS wetlands. The fauna of the WRSIS reservoirs and how its aquatic community structure compares with WRSIS wetlands is unknown. We compared fish, amphibian, and reptile community structure between WRSIS wetlands and reservoirs in northwestern Ohio. Fishes, amphibians, and reptiles were sampled by seining, hoop netting, and gee minnow trapping in three WRSIS wetlands and three WRSIS reservoirs in June of 2006, 2007, and 2008. No difference in species richness, abundance, percent fish, percent reptiles, fish abundance, or reptile abundance occurred between the smaller shallower WRSIS wetlands and the deeper larger WRSIS reservoirs. Percent amphibians and amphibian abundance was greater in WRSIS wetlands than reservoirs. Jaccard's index scores ranged from 0 to 0.5 and indicated species composition differed between WRSIS wetlands and reservoirs. Our results assisted with the development of design and management criteria incorporating wetland size, hydrology, and upland habitat intended to enable WRSIS wetlands to function primarily as amphibian habitat and the reservoirs to function as fish habitat. JF - Wetlands Ecology and Management AU - Smiley, Peter C AU - Allred, Barry J AD - USDA-ARS Soil Drainage Research Unit, 590 Woody Hayes Drive, Columbus, OH, 43210, USA, rocky.smiley@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 495 EP - 505 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 19 IS - 6 SN - 0923-4861, 0923-4861 KW - Sustainability Science Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Water Resources Abstracts; Aqualine Abstracts; Ecology Abstracts; ASFA 1: Biological Sciences & Living Resources KW - Reservoir KW - Ecosystems KW - Amphibiotic species KW - Abundance KW - Freshwater KW - Freshwater fish KW - Aquatic communities KW - Hydrology KW - Wetlands KW - Seining KW - Reservoirs KW - Species richness KW - Biological development KW - Amphibians KW - Aquatic plants KW - Habitat KW - amphibians KW - Trapping KW - Community composition KW - Community structure KW - Fish KW - Fish Populations KW - Contaminants KW - abundance KW - Recycling KW - Habitats KW - Species composition KW - Water reuse KW - reptiles KW - Filtration KW - USA, Ohio KW - AQ 00001:Water Resources and Supplies KW - Q5 08503:Characteristics, behavior and fate KW - SW 3050:Ultimate disposal of wastes KW - Q1 08463:Habitat community studies KW - M3 1010:Issues in Sustainable Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926903844?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Wetlands+Ecology+and+Management&rft.atitle=Differences+in+aquatic+communities+between+wetlands+created+by+an+agricultural+water+recycling+system&rft.au=Smiley%2C+Peter+C%3BAllred%2C+Barry+J&rft.aulast=Smiley&rft.aufirst=Peter&rft.date=2011-12-01&rft.volume=19&rft.issue=6&rft.spage=495&rft.isbn=&rft.btitle=&rft.title=Wetlands+Ecology+and+Management&rft.issn=09234861&rft_id=info:doi/10.1007%2Fs11273-011-9231-5 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Reservoir; Community composition; Biological development; Aquatic communities; Amphibiotic species; Aquatic plants; Wetlands; Seining; Freshwater fish; Abundance; Habitat; Recycling; Trapping; Filtration; Community structure; Hydrology; Species composition; Contaminants; Species richness; reptiles; Fish; Water reuse; amphibians; Reservoirs; abundance; Habitats; Ecosystems; Amphibians; Fish Populations; USA, Ohio; Freshwater DO - http://dx.doi.org/10.1007/s11273-011-9231-5 ER - TY - JOUR T1 - Engineering Saccharomyces cerevisiae to produce feruloyl esterase for the release of ferulic acid from switchgrass AN - 926903374; 16355090 AB - The Aspergillus niger feruloyl esterase gene (faeA) was cloned into Saccharomyces cerevisiae via a yeast expression vector, resulting in efficient expression and secretion of the enzyme in the medium with a yield of ~2 mg/l. The recombinant enzyme was purified to homogeneity by anion-exchange and hydrophobic interaction chromatography. The specific activity was determined to be 8,200 U/ mu g (pH 6.5, 20 degree C, 3.5 mM 4-nitrophenyl ferulate). The protein had a correct N-terminal sequence of ASTQGISEDLY, indicating that the signal peptide was properly processed. The FAE exhibited an optimum pH of 6-7 and operated optimally at 50 degree C using ground switchgrass as the substrate. The yeast clone was demonstrated to catalyze the release of ferulic acid continuously from switchgrass in YNB medium at 30 degree C. This work represents the first report on engineering yeast for the breakdown of ferulic acid crosslink to facilitate consolidated bioprocessing. JF - Journal of Industrial Microbiology & Biotechnology AU - Wong, Dominic WS AU - Chan, Victor J AU - Batt, Sarah B AU - Sarath, Gautam AU - Liao, Hans AD - Western Regional Research Center, USDA-ARS, Albany, CA, USA, Dominic.Wong@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1961 EP - 1967 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 38 IS - 12 SN - 1367-5435, 1367-5435 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Biotechnology and Bioengineering Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Expression vectors KW - Chromatography KW - esterase KW - Secretion KW - Signal peptides KW - Enzymes KW - Hydrophobicity KW - Ferulic acid KW - pH effects KW - Aspergillus niger KW - Saccharomyces cerevisiae KW - W 30905:Medical Applications KW - A 01360:Plant Diseases KW - K 03330:Biochemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926903374?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Industrial+Microbiology+%26+Biotechnology&rft.atitle=Engineering+Saccharomyces+cerevisiae+to+produce+feruloyl+esterase+for+the+release+of+ferulic+acid+from+switchgrass&rft.au=Wong%2C+Dominic+WS%3BChan%2C+Victor+J%3BBatt%2C+Sarah+B%3BSarath%2C+Gautam%3BLiao%2C+Hans&rft.aulast=Wong&rft.aufirst=Dominic&rft.date=2011-12-01&rft.volume=38&rft.issue=12&rft.spage=1961&rft.isbn=&rft.btitle=&rft.title=Journal+of+Industrial+Microbiology+%26+Biotechnology&rft.issn=13675435&rft_id=info:doi/10.1007%2Fs10295-011-0985-9 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Expression vectors; Chromatography; Secretion; esterase; Signal peptides; Enzymes; Hydrophobicity; Ferulic acid; pH effects; Aspergillus niger; Saccharomyces cerevisiae DO - http://dx.doi.org/10.1007/s10295-011-0985-9 ER - TY - JOUR T1 - Effects of temperature during soybean seed development on defense-related gene expression and fungal pathogen accumulation AN - 926891226; 16353571 AB - Soybean [Glycine max (L.) Merr] plants were exposed to three temperature regimens during seed development to investigate the effect of temperature on the expression of eight defense-related genes and the accumulation of two fungal pathogens in inoculated seeds. In seeds prior to inoculation, either a day/night warm (34/26 degree C) or a cool temperature (22/18 degree C) relative to normal (26/22 degree C) resulted in altered patterns of gene expression including substantially lower expression of PR1, PR3 and PR10. After seed inoculation with Cercospora kikuchii, pathogen accumulation was lowest in seeds produced at 22/18 degree C in which of all defense genes, MMP2 was uniquely most highly induced. For seeds inoculated with Diaporthe phaseolorum, pathogen accumulation was lowest in seeds produced at 34/26 degree C in which of all defense genes, PR10 was uniquely most highly induced. Our detached seed assays clearly demonstrated that the temperature regimens we applied during seed development produced significant changes in seed defense-related gene expression both pre- and post inoculation and our findings support the hypothesis that global climate change may alter plant-pathogen interactions and thereby potentially crop productivity. JF - Biotechnology Letters AU - Upchurch, Robert G AU - Ramirez, Martha E AD - USDA-ARS Soybean & Nitrogen Fixation Unit, Department of Plant Pathology, NC State University, Raleigh, NC, 27695-7616, USA, greg.upchurch@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2397 EP - 2404 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 33 IS - 12 SN - 0141-5492, 0141-5492 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Biotechnology and Bioengineering Abstracts KW - Temperature effects KW - Seeds KW - Climatic changes KW - Pathogens KW - Diaporthe phaseolorum KW - Glycine max KW - Crops KW - Soybeans KW - Gene expression KW - Cercospora KW - Inoculation KW - Gelatinase A KW - W 30930:Agricultural Applications KW - K 03310:Genetics & Taxonomy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926891226?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biotechnology+Letters&rft.atitle=Effects+of+temperature+during+soybean+seed+development+on+defense-related+gene+expression+and+fungal+pathogen+accumulation&rft.au=Upchurch%2C+Robert+G%3BRamirez%2C+Martha+E&rft.aulast=Upchurch&rft.aufirst=Robert&rft.date=2011-12-01&rft.volume=33&rft.issue=12&rft.spage=2397&rft.isbn=&rft.btitle=&rft.title=Biotechnology+Letters&rft.issn=01415492&rft_id=info:doi/10.1007%2Fs10529-011-0722-5 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Gene expression; Temperature effects; Seeds; Climatic changes; Inoculation; Gelatinase A; Pathogens; Crops; Soybeans; Cercospora; Diaporthe phaseolorum; Glycine max DO - http://dx.doi.org/10.1007/s10529-011-0722-5 ER - TY - JOUR T1 - Effects of Cyanogenic Plants on Fitness in Two Host Strains of the Fall Armyworm (Spodoptera frugiperda) AN - 926887314; 16358390 AB - The generalist moth, Spodoptera frugiperda (J. E. Smith) consists of two genetic subgroups (host strains) that differ in their distribution among host plant species. The corn strain prefers crop plants such as corn, sorghum, and cotton, while the rice strain is found in small grasses such as Cynodon spp. and rice. Little is known about the physiological factors that drive this host preference. Here, we report a feeding study with natural host plants and an artificial diet containing cyanide. We found that corn, two Cynodon spp. (bermudagrass C. dactylon (L.) Persoon, 'NuMex Sahara', and stargrass C. nlemfuensis var. nlemfuensis Vanderyst, 'Florona'), and a hybrid between bermudagrass and stargrass, 'Tifton 85', exhibited differences in the concentration of the cyanogenic precursors or cyanogenic potential (HCNp) and the release of hydrogen cyanide per unit time or cyanogenic capacity (HCNc). Corn plants released low levels of hydrogen cyanide, while stargrass had greater HCNp/HCNc than bermudagrass and 'Tifton 85'. Feeding studies showed that corn strain larvae experienced higher mortality than the rice strain when fed stargrass or artificial diet supplemented with cyanide. Also, corn strain larvae excreted higher levels of cyanogenic compounds than the rice strain when fed Cynodon spp. These differences in excretion suggest potential disparities in cyanide metabolism between the two strains. We hypothesize that differences in the susceptibility to cyanide levels in various host plants could play a role in driving strain divergence and what appears to be the incipient speciation of this moth. JF - Journal of Chemical Ecology AU - Hay-Roe, Mirian M AU - Meagher, Robert L AU - Nagoshi, Rodney N AD - Behavior and Biocontrol Unit, USDA, ARS, CMAVE, 1700 SW 23rd Dr., Gainesville, FL, 32608, USA, mmhr@ufl.edu Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1314 EP - 1322 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 37 IS - 12 SN - 0098-0331, 0098-0331 KW - Chemoreception Abstracts; Entomology Abstracts; Ecology Abstracts KW - Artificial diets KW - Cyanide KW - Cynodon KW - R 18050:Chemoreception correlates of behavior KW - Z 05300:General KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926887314?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Chemical+Ecology&rft.atitle=Effects+of+Cyanogenic+Plants+on+Fitness+in+Two+Host+Strains+of+the+Fall+Armyworm+%28Spodoptera+frugiperda%29&rft.au=Hay-Roe%2C+Mirian+M%3BMeagher%2C+Robert+L%3BNagoshi%2C+Rodney+N&rft.aulast=Hay-Roe&rft.aufirst=Mirian&rft.date=2011-12-01&rft.volume=37&rft.issue=12&rft.spage=1314&rft.isbn=&rft.btitle=&rft.title=Journal+of+Chemical+Ecology&rft.issn=00980331&rft_id=info:doi/10.1007%2Fs10886-011-0049-7 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2014-02-11 N1 - SubjectsTermNotLitGenreText - Cyanide; Cynodon DO - http://dx.doi.org/10.1007/s10886-011-0049-7 ER - TY - JOUR T1 - Linear-motion tattoo machine and prefabricated needle sets for the delivery of plant viruses by vascular puncture inoculation AN - 926885211; 16332223 AB - Vascular puncture inoculation (VPI) of plant viruses previously has been conducted either manually or by use of a commercial engraving tool and laboratory-fabricated needle arrays. In an effort to improve this technique, a linear-motion tattoo machine driving industry-standard needle arrays was tested as a means of delivering plant viruses into maize and small grain seed embryos. The new method was applied in the successful transmission of maize rayado fino virus (MRFV), the type member of the genus Marafivirus, from an archived sample to maize. Subsequent transfer of MRFV from the sap of an infected plant using the method produced an average infection rate in maize of 70% (range 39-93%). Maize, oat, and triticale were successfully infected with oat blue dwarf virus (OBDV) using the method; similar infection rates were observed between maize seeds inoculated with the tattoo machine and those inoculated with the engraving machine when using prefabricated needle arrays. No infection was obtained in repeated tests with barley yellow dwarf virus (BYDV-PAV) or cereal yellow dwarf virus (CYDV-RPV) using either sap or RNA from infectious cloned cDNA. Replacement of the original engraving-tool with a linear-motion tattoo machine in VPI provides greater flexibility and convenience in a quiet, readily-available instrument, while improving reproducibility through the use of prefabricated needle arrays. JF - European Journal of Plant Pathology AU - Weiland, John J AU - Edwards, Michael C AD - USDA, Agricultural Research Service, Cereal Crops Research Unit, 1605 Albrecht Blvd. N., Fargo, ND, 58102-2765, USA, michael.edwards@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 553 EP - 558 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 131 IS - 4 SN - 0929-1873, 0929-1873 KW - Virology & AIDS Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Cereals KW - Embryos KW - Grain KW - Infection KW - Inoculation KW - Plant viruses KW - RNA KW - SAP protein KW - Seeds KW - Tattoos KW - Marafivirus KW - Oat blue dwarf virus KW - Maize rayado fino virus KW - Barley yellow dwarf virus KW - Zea mays KW - A 01360:Plant Diseases KW - V 22300:Methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926885211?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=European+Journal+of+Plant+Pathology&rft.atitle=Linear-motion+tattoo+machine+and+prefabricated+needle+sets+for+the+delivery+of+plant+viruses+by+vascular+puncture+inoculation&rft.au=Weiland%2C+John+J%3BEdwards%2C+Michael+C&rft.aulast=Weiland&rft.aufirst=John&rft.date=2011-12-01&rft.volume=131&rft.issue=4&rft.spage=553&rft.isbn=&rft.btitle=&rft.title=European+Journal+of+Plant+Pathology&rft.issn=09291873&rft_id=info:doi/10.1007%2Fs10658-011-9830-2 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2013-02-08 N1 - SubjectsTermNotLitGenreText - Seeds; RNA; Cereals; Grain; Inoculation; SAP protein; Embryos; Plant viruses; Infection; Tattoos; Marafivirus; Zea mays; Oat blue dwarf virus; Maize rayado fino virus; Barley yellow dwarf virus DO - http://dx.doi.org/10.1007/s10658-011-9830-2 ER - TY - JOUR T1 - Managing agricultural phosphorus for water quality protection: principles for progress AN - 926881749; 16356666 AB - Background: The eutrophication of aquatic systems due to diffuse pollution of agricultural phosphorus (P) is a local, even regional, water quality problem that can be found world-wide. Scope: Sustainable management of P requires prudent tempering of agronomic practices, recognizing that additional steps are often required to reduce the downstream impacts of most production systems. Conclusions: Strategies to mitigate diffuse losses of P must consider chronic (edaphic) and acute, temporary (fertilizer, manure, vegetation) sources. Even then, hydrology can readily convert modest sources into significant loads, including via subsurface pathways. Systemic drivers, particularly P surpluses that result in long-term over-application of P to soils, are the most recalcitrant causes of diffuse P loss. Even in systems where P application is in balance with withdrawal, diffuse pollution can be exacerbated by management systems that promote accumulation of P within the effective layer of effective interaction between soils and runoff water. Indeed, conventional conservation practices aimed at controlling soil erosion must be evaluated in light of their ability to exacerbate dissolved P pollution. Understanding the opportunities and limitations of P management strategies is essential to ensure that water quality expectations are realistic and that our beneficial management practices are both efficient and effective. JF - Plant and Soil AU - Kleinman, Peter JA AU - Sharpley, Andrew N AU - McDowell, Richard W AU - Flaten, Don N AU - Buda, Anthony R AU - Tao, Liang AU - Bergstrom, Lars AU - Zhu, Qing AD - USDA-ARS, Pasture Systems and Watershed Management Research Unit, University Park, PA, USA, peter.kleinman@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 169 EP - 182 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 349 IS - 1-2 SN - 0032-079X, 0032-079X KW - Ecology Abstracts; Pollution Abstracts; Environment Abstracts KW - Animal wastes KW - Aquatic environment KW - Conservation KW - Eutrophication KW - Fertilizers KW - Hydrology KW - Manure KW - Phosphorus KW - Plants KW - Pollution KW - Pollution effects KW - Runoff KW - Soil KW - Soil erosion KW - Vegetation KW - Water quality KW - downstream KW - water quality KW - ENA 06:Food & Drugs KW - D 04070:Pollution KW - P 2000:FRESHWATER POLLUTION UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926881749?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+and+Soil&rft.atitle=Managing+agricultural+phosphorus+for+water+quality+protection%3A+principles+for+progress&rft.au=Kleinman%2C+Peter+JA%3BSharpley%2C+Andrew+N%3BMcDowell%2C+Richard+W%3BFlaten%2C+Don+N%3BBuda%2C+Anthony+R%3BTao%2C+Liang%3BBergstrom%2C+Lars%3BZhu%2C+Qing&rft.aulast=Kleinman&rft.aufirst=Peter&rft.date=2011-12-01&rft.volume=349&rft.issue=1-2&rft.spage=169&rft.isbn=&rft.btitle=&rft.title=Plant+and+Soil&rft.issn=0032079X&rft_id=info:doi/10.1007%2Fs11104-011-0832-9 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2012-12-03 N1 - SubjectsTermNotLitGenreText - Fertilizers; Manure; Eutrophication; Phosphorus; Hydrology; Vegetation; Conservation; Soil erosion; Water quality; Runoff; Pollution; Soil; water quality; Animal wastes; downstream; Plants; Pollution effects; Aquatic environment DO - http://dx.doi.org/10.1007/s11104-011-0832-9 ER - TY - JOUR T1 - Kinetic mechanism of an aldehyde reductase of Saccharomyces cerevisiae that relieves toxicity of furfural and 5-hydroxymethylfurfural AN - 926879897; 16048970 AB - An effective means of relieving the toxicity of furan aldehydes, furfural (FFA) and 5-hydroxymethylfurfural (HMF), on fermenting organisms is essential for achieving efficient fermentation of lignocellulosic biomass to ethanol and other products. Ari1p, an aldehyde reductase from Saccharomyces cerevisiae, has been shown to mitigate the toxicity of FFA and HMF by catalyzing the NADPH-dependent conversion to corresponding alcohols, furfuryl alcohol (FFOH) and 5-hydroxymethylfurfuryl alcohol (HMFOH). At pH 7.0 and 25 degree C, purified Ari1p catalyzes the NADPH-dependent reduction of substrates with the following values (k sub(cat (s) super(-) 1), k sub(cat/K) sub(m) (s super(- 1 mM) super(-) 1), K sub(m (mM)): FFA (23.3, 1.82, 12.8), HMF (4.08, 0.173, 23.6), and dl-glyceraldehyde (2.40, 0.0650, 37.0). When acting on HMF and dl-glyceraldehyde, the enzyme operates through an equilibrium ordered kinetic mechanism. In the physiological direction of the reaction, NADPH binds first and NADP) super(+) dissociates from the enzyme last, demonstrated by k sub(cat of HMF and dl-glyceraldehyde that are independent of [NADPH] and (K) sub(i)a super(NADPH/k) sub(c)at) that extrapolate to zero at saturating HMF or dl-glyceraldehyde concentration. Microscopic kinetic parameters were determined for the HMF reaction (HMF + NADPH HMFOH + NADP super(+), by applying steady-state, presteady-state, kinetic isotope effects, and dynamic modeling methods. Release of products, HMFOH and NADP) super(+), is 84% rate limiting to k sub(cat in the forward direction. Equilibrium constants, [NADP) super(+)][FFOH] / [NADPH][FFA][H super(+] = 5600 x 10) super(7) M super(- 1 and [NADP) super(+)][HMFOH] / [NADPH][HMF][H super(+] = 4200 x 10) super(7) M super(- 1, favor the physiological direction mirrored by the slowness of hydride transfer in the non-physiological direction, NADP) super(+)-dependent oxidation of alcohols (k sub(cat (s) super(-) 1), k sub(cat/K) sub(m) (s super(- 1 mM) super(-) 1), K sub(m (mM)): FFOH (0.221, 0.00158, 140) and HMFOH (0.0105, 0.000104, 101).) JF - Biochimica et Biophysica Acta: Proteins and Proteomics AU - Jordan, Douglas B AU - Braker, Jay D AU - Bowman, Michael J AU - Vermillion, Karl E AU - Moon, Jaewoong AU - Liu, ZLewis AD - U.S. Department of Agriculture, Agricultural Research Service, National Center for Agricultural Utilization Research, 1815 N. University St., Peoria, IL 61604, USA, douglas.jordan@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1686 EP - 1694 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 1814 IS - 12 SN - 1570-9639, 1570-9639 KW - Toxicology Abstracts; Microbiology Abstracts C: Algology, Mycology & Protozoology KW - Isotopes KW - Fermentation KW - Enzymes KW - Toxicity KW - Furans KW - Biomass KW - Saccharomyces cerevisiae KW - NADP KW - Kinetics KW - Oxidation KW - Aldehyde reductase KW - proteomics KW - Aldehydes KW - pH effects KW - Furfural KW - Ethanol KW - X 24380:Social Poisons & Drug Abuse KW - K 03330:Biochemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926879897?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biochimica+et+Biophysica+Acta%3A+Proteins+and+Proteomics&rft.atitle=Kinetic+mechanism+of+an+aldehyde+reductase+of+Saccharomyces+cerevisiae+that+relieves+toxicity+of+furfural+and+5-hydroxymethylfurfural&rft.au=Jordan%2C+Douglas+B%3BBraker%2C+Jay+D%3BBowman%2C+Michael+J%3BVermillion%2C+Karl+E%3BMoon%2C+Jaewoong%3BLiu%2C+ZLewis&rft.aulast=Jordan&rft.aufirst=Douglas&rft.date=2011-12-01&rft.volume=1814&rft.issue=12&rft.spage=1686&rft.isbn=&rft.btitle=&rft.title=Biochimica+et+Biophysica+Acta%3A+Proteins+and+Proteomics&rft.issn=15709639&rft_id=info:doi/10.1016%2Fj.bbapap.2011.08.011 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2013-06-14 N1 - SubjectsTermNotLitGenreText - Isotopes; Fermentation; Enzymes; Toxicity; Biomass; Furans; NADP; Kinetics; Oxidation; Aldehyde reductase; proteomics; Aldehydes; pH effects; Ethanol; Furfural; Saccharomyces cerevisiae DO - http://dx.doi.org/10.1016/j.bbapap.2011.08.011 ER - TY - JOUR T1 - Climate change predicted to shift wolverine distributions, connectivity, and dispersal corridors AN - 920810916; 16292259 AB - Boreal species sensitive to the timing and duration of snow cover are particularly vulnerable to global climate change. Recent work has shown a link between wolverine (Gulo gulo) habitat and persistent spring snow cover through 15 May, the approximate end of the wolverine's reproductive denning period. We modeled the distribution of snow cover within the Columbia, Upper Missouri, and Upper Colorado River Basins using a downscaled ensemble climate model. The ensemble model was based on the arithmetic mean of 10 global climate models (GCMs) that best fit historical climate trends and patterns within these three basins. Snow cover was estimated from resulting downscaled temperature and precipitation patterns using a hydrologic model. We bracketed our ensemble model predictions by analyzing warm (miroc 3.2) and cool (pcml) downscaled GCMs. Because Moderate-Resolution Imaging Spectroradiometer (MODIS)-based snow cover relationships were analyzed at much finer grain than downscaled GCM output, we conducted a second analysis based on MODIS-based snow cover that persisted through 29 May, simulating the onset of spring two weeks earlier in the year. Based on the downscaled ensemble model, 67% of predicted spring snow cover will persist within the study area through 2030-2059, and 37% through 2070-2099. Estimated snow cover for the ensemble model during the period 2070-2099 was similar to persistent MODIS snow cover through 29 May. Losses in snow cover were greatest at the southern periphery of the study area (Oregon, Utah, and New Mexico, USA) and least in British Columbia, Canada. Contiguous areas of spring snow cover become smaller and more isolated over time, but large (>1000 km super(2)) contiguous areas of wolverine habitat are predicted to persist within the study area throughout the 21st century for all projections. Areas that retain snow cover throughout the 21st century are British Columbia, north-central Washington, northwestern Montana, and the Greater Yellowstone Area. By the late 21st century, dispersal modeling indicates that habitat isolation at or above levels associated with genetic isolation of wolverine populations becomes widespread. Overall, we expect wolverine habitat to persist throughout the species range at least for the first half of the 21st century, but populations will likely become smaller and more isolated. JF - Ecological Applications AU - McKelvey, K S AU - Copeland, J P AU - Schwartz, M K AU - Littell, J S AU - Aubry, K B AU - Squires, J R AU - Parks, SA AU - Elsner, M M AU - Mauger, G S AD - USDA Forest Service, Rocky Mountain Research Station, 800 East Beckwith, Missoula, Montana 59801 USA, kmckelvey@fs.fed.us A2 - Hobbs, NT (ed) Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 2882 EP - 2897 PB - Ecological Society of America, 1707 H Street, N.W., Suite 400 Washington DC 20006 United States VL - 21 IS - 8 SN - 1051-0761, 1051-0761 KW - Animal Behavior Abstracts; Meteorological & Geoastrophysical Abstracts; Ecology Abstracts; Sustainability Science Abstracts KW - Historical account KW - Rainfall KW - Climate change KW - Climatic changes KW - Basins KW - dispersal KW - Mathematics KW - Models KW - USA, Washington KW - MODIS (Moderate Resolution Imaging Spectrometer) KW - USA, Oregon KW - USA, Montana KW - Canada, British Columbia KW - USA, Utah KW - Temperature effects KW - USA, New Mexico KW - Climate models KW - USA, Missouri, Columbia KW - Snow KW - USA, Arizona, Colorado R. basin KW - Genetic isolation KW - Climatic trends KW - River basins KW - Precipitation KW - Snow cover KW - Habitat KW - imaging KW - General circulation models KW - Gulo gulo KW - Grain KW - Global warming KW - vulnerability KW - Dispersal KW - Precipitation patterns KW - Y 25150:General/Miscellaneous KW - M2 556:General (556) KW - M3 1010:Issues in Sustainable Development KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/920810916?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Ecological+Applications&rft.atitle=Climate+change+predicted+to+shift+wolverine+distributions%2C+connectivity%2C+and+dispersal+corridors&rft.au=McKelvey%2C+K+S%3BCopeland%2C+J+P%3BSchwartz%2C+M+K%3BLittell%2C+J+S%3BAubry%2C+K+B%3BSquires%2C+J+R%3BParks%2C+SA%3BElsner%2C+M+M%3BMauger%2C+G+S&rft.aulast=McKelvey&rft.aufirst=K&rft.date=2011-12-01&rft.volume=21&rft.issue=8&rft.spage=2882&rft.isbn=&rft.btitle=&rft.title=Ecological+Applications&rft.issn=10510761&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-02-01 N1 - Last updated - 2016-07-07 N1 - SubjectsTermNotLitGenreText - Temperature effects; Snow; Climatic changes; Genetic isolation; Basins; River basins; Precipitation; Habitat; imaging; Models; Mathematics; Grain; Dispersal; Climate models; General circulation models; Climate change; Climatic trends; Global warming; MODIS (Moderate Resolution Imaging Spectrometer); Snow cover; Precipitation patterns; Historical account; Rainfall; vulnerability; dispersal; Gulo gulo; USA, Utah; Canada, British Columbia; USA, Washington; USA, New Mexico; USA, Missouri, Columbia; USA, Arizona, Colorado R. basin; USA, Oregon; USA, Montana ER - TY - JOUR T1 - Effects of nitrogen deposition and empirical nitrogen critical loads for ecoregions of the United States AN - 920807888; 16292271 AB - Human activity in the last century has led to a significant increase in nitrogen (N) emissions and atmospheric deposition. This N deposition has reached a level that has caused or is likely to cause alterations to the structure and function of many ecosystems across the United States. One approach for quantifying the deposition of pollution that would be harmful to ecosystems is the determination of critical loads. A critical load is defined as the input of a pollutant below which no detrimental ecological effects occur over the long-term according to present knowledge. The objectives of this project were to synthesize current research relating atmospheric N deposition to effects on terrestrial and freshwater ecosystems in the United States, and to estimate associated empirical N critical loads. The receptors considered included freshwater diatoms, mycorrhizal fungi, lichens, bryophytes, herbaceous plants, shrubs, and trees. Ecosystem impacts included: (1) biogeochemical responses and (2) individual species, population, and community responses. Biogeochemical responses included increased N mineralization and nitrification (and N availability for plant and microbial uptake), increased gaseous N losses (ammonia volatilization, nitric and nitrous oxide from nitrification and denitrification), and increased N leaching. Individual species, population, and community responses included increased tissue N, physiological and nutrient imbalances, increased growth, altered root: shoot ratios, increased susceptibility to secondary stresses, altered fire regime, shifts in competitive interactions and community composition, changes in species richness and other measures of biodiversity, and increases in invasive species. The range of critical loads for nutrient N reported for U.S. ecoregions, inland surface waters, and freshwater wetlands is 1-39 kg N times ha super(-1) times yr super(-1), spanning the range of N deposition observed over most of the country. The empirical critical loads for N tend to increase in the following sequence for different life forms: diatoms, lichens and bryophytes, mycorrhizal fungi, herbaceous plants and shrubs, and trees. The critical load approach is an ecosystem assessment tool with great potential to simplify complex scientific information and communicate effectively with the policy community and the public. This synthesis represents the first comprehensive assessment of empirical critical loads of N for major ecoregions across the United States. JF - Ecological Applications AU - Pardo, L H AU - Fenn, ME AU - Goodale, CL AU - Geiser, L H AU - Driscoll, C T AU - Allen, E B AU - Baron, J S AU - Bobbink, R AU - Bowman, W D AU - Clark, C M AU - Emmett, B AU - Gilliam, F S AU - Greaver, T L AU - Hall, S J AD - USDA Forest Service, Northern Research Station, 705 Spear Street, South Burlington, Vermont 05403 USA, lpardo@fs.fed.us A2 - Zak, DR (ed) Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 3049 EP - 3082 PB - Ecological Society of America, 1707 H Street, N.W., Suite 400 Washington DC 20006 United States VL - 21 IS - 8 SN - 1051-0761, 1051-0761 KW - Pollution Abstracts; ASFA 1: Biological Sciences & Living Resources; Microbiology Abstracts C: Algology, Mycology & Protozoology; Sustainability Science Abstracts; Ecology Abstracts KW - Ecosystems KW - Trees KW - Bacillariophyceae KW - Phytoplankton KW - Nutrients KW - Mineralization KW - shrubs KW - Nitrous oxide KW - Structure-function relationships KW - Wetlands KW - Species richness KW - Policies KW - Freshwater environments KW - Biogeochemistry KW - Ammonia KW - Fungi KW - Volatilization KW - Stress KW - Community composition KW - Lichens KW - Nitrification KW - Nitrogen KW - Surface water KW - Roots KW - Biodiversity KW - Diatoms KW - Growth KW - Pollutants KW - Denitrification KW - Pollution KW - Shrubs KW - Fires KW - Leaching KW - Shoots KW - USA KW - Freshwater ecosystems KW - Introduced species KW - D 04070:Pollution KW - P 0000:AIR POLLUTION KW - M3 1010:Issues in Sustainable Development KW - Q1 08485:Species interactions: pests and control KW - K 03450:Ecology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/920807888?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Ecological+Applications&rft.atitle=Effects+of+nitrogen+deposition+and+empirical+nitrogen+critical+loads+for+ecoregions+of+the+United+States&rft.au=Pardo%2C+L+H%3BFenn%2C+ME%3BGoodale%2C+CL%3BGeiser%2C+L+H%3BDriscoll%2C+C+T%3BAllen%2C+E+B%3BBaron%2C+J+S%3BBobbink%2C+R%3BBowman%2C+W+D%3BClark%2C+C+M%3BEmmett%2C+B%3BGilliam%2C+F+S%3BGreaver%2C+T+L%3BHall%2C+S+J&rft.aulast=Pardo&rft.aufirst=L&rft.date=2011-12-01&rft.volume=21&rft.issue=8&rft.spage=3049&rft.isbn=&rft.btitle=&rft.title=Ecological+Applications&rft.issn=10510761&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-02-01 N1 - Last updated - 2014-12-11 N1 - SubjectsTermNotLitGenreText - Policies; Growth; Community composition; Nitrification; Biogeochemistry; Fungi; Phytoplankton; Wetlands; Nitrogen; Surface water; Trees; Diatoms; Biodiversity; Roots; Nutrients; Mineralization; Pollutants; Nitrous oxide; Structure-function relationships; Denitrification; Species richness; Pollution; Shrubs; Fires; Leaching; Freshwater environments; Ammonia; Stress; Volatilization; Shoots; Lichens; Freshwater ecosystems; Introduced species; Ecosystems; shrubs; Bacillariophyceae; USA ER - TY - JOUR T1 - Identification and cloning of two immunogenic Clostridium perfringens proteins, elongation factor Tu (EF-Tu) and pyruvate:ferredoxin oxidoreductase (PFO) of C. perfringens AN - 918048695; 16047302 AB - Clostridium-related poultry diseases such as necrotic enteritis (NE) and gangrenous dermatitis (GD) cause substantial economic losses on a global scale. Two antigenic Clostridium perfringens proteins, elongation factor Tu (EF-Tu) and pyruvate:ferredoxin oxidoreductase (PFO), were identified by reaction with immune sera from commercial meat-type chickens with clinical outbreak of Clostridium infections. In addition to the genes encoding EF-Tu and PFO, C. perfringens alpha-toxin and necrotic enteritis B-like (NetB) toxin were also expressed in Escherichia coli and their corresponding recombinant proteins were purified. Using the four recombinant proteins as target antigens in ELISA immunoassays, high serum antibody titers were observed not only in chickens with clinical signs of Clostridium infections, but also in apparently healthy animals from the same disease-endemic farm. By contrast, no antibodies against any of the proteins were present in the serum of a specific pathogen-free bird. In ELISA using recombinant proteins of C. perfringens, the levels of anti-bacterial protein antibodies were also higher in chickens which were experimentally induced to show NE clinical signs after co-infection with C. perfringens and Eimeria maxima compared with uninfected controls. These results show that two antigenic C. perfringens proteins, EF-Tu and PFO can be useful detection antigens for C. perfringens-afflicted infections in commercial poultry. JF - Research in Veterinary Science AU - Lee, Kyungwoo AU - Lillehoj, Hyun S AU - Li, Guangxing AU - Park, Myeong-Seon AU - Jang, Seung I AU - Jeong, Wooseog AU - Jeoung, Hye-Young AU - An, Dong-Jun AU - Lillehoj, Erik P AD - Animal Parasitic Diseases Laboratory, Animal and Natural Resources Institute, Agricultural Research Service, USDA, Beltsville, MD 20705, USA, Hyun.Lillehoj@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - e80 EP - e86 PB - W.B. Saunders Co., 32 Jamestown Rd London NW1 7BY United Kingdom VL - 91 IS - 3 SN - 0034-5288, 0034-5288 KW - Immunology Abstracts; Microbiology Abstracts B: Bacteriology KW - Necrotic enteritis KW - Gangrenous dermatitis KW - Clostridium perfringens KW - Clostridium KW - Poultry KW - Enzyme-linked immunosorbent assay KW - Farms KW - Enteritis KW - Elongation factor EF-Tu KW - Eimeria maxima KW - Infection KW - Toxins KW - Antibodies KW - Immunogenicity KW - Economics KW - Escherichia coli KW - oxidoreductase KW - Immunoassays KW - Dermatitis KW - F 06910:Microorganisms & Parasites KW - J 02340:Antibiotics & Antimicrobials UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/918048695?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Research+in+Veterinary+Science&rft.atitle=Identification+and+cloning+of+two+immunogenic+Clostridium+perfringens+proteins%2C+elongation+factor+Tu+%28EF-Tu%29+and+pyruvate%3Aferredoxin+oxidoreductase+%28PFO%29+of+C.+perfringens&rft.au=Lee%2C+Kyungwoo%3BLillehoj%2C+Hyun+S%3BLi%2C+Guangxing%3BPark%2C+Myeong-Seon%3BJang%2C+Seung+I%3BJeong%2C+Wooseog%3BJeoung%2C+Hye-Young%3BAn%2C+Dong-Jun%3BLillehoj%2C+Erik+P&rft.aulast=Lee&rft.aufirst=Kyungwoo&rft.date=2011-12-01&rft.volume=91&rft.issue=3&rft.spage=e80&rft.isbn=&rft.btitle=&rft.title=Research+in+Veterinary+Science&rft.issn=00345288&rft_id=info:doi/10.1016%2Fj.rvsc.2011.01.017 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Last updated - 2014-09-05 N1 - SubjectsTermNotLitGenreText - Enzyme-linked immunosorbent assay; Poultry; Farms; Enteritis; Elongation factor EF-Tu; Infection; Toxins; Antibodies; Immunogenicity; Economics; oxidoreductase; Immunoassays; Dermatitis; Clostridium; Clostridium perfringens; Escherichia coli; Eimeria maxima DO - http://dx.doi.org/10.1016/j.rvsc.2011.01.017 ER - TY - JOUR T1 - Association of single nucleotide polymorphisms in the ANKRA2 and CD180 genes with bovine respiratory disease and presence of Mycobacterium avium subsp. paratuberculosis AN - 915488646; 16111069 AB - The objective was to determine whether single nucleotide polymorphisms (SNPs) in the ANKRA2 and CD180 genes are associated with incidence of bovine respiratory disease (BRD) and presence of Mycobacterium avium subsp. paratuberculosis (MAP) in cattle. Two independent populations were used. The first population (BRD-affected; N=90) was composed of 31 half-sib progeny, from a BrahmanAngus sire, that were treated for BRD. Untreated offspring from the sire were selected to serve as controls. The second population (MAP-infected) of 330 animals of unknown parentage was evaluated for the presence of MAP in ileocecal lymph node and classified as positive or negative. Markers in both genes were assessed for association in these two populations. In the BRD-affected population, five SNPs in the ANKRA2 gene were significantly associated (P<0.05), and two SNPs were highly associated (P<0.01) with incidence of BRD. In addition, two SNPs in the CD180 gene were found to be associated with this trait. In the MAP-infected population, one SNP in the ANKRA2 gene was significantly associated (P<0.05) with the presence or absence of MAP, and a SNP in the CD180 gene was highly associated (P<0.01) with the trait. Haplotypes, using significant markers, showed a positive association with both incidence of BRD (P=0.0001) and with the presence of MAP (P=0.0032). Markers in the ANKRA2 and CD180 genes are associated with the ability of the animal to cope with pathogens. JF - Animal Genetics AU - Casas, E AU - Garcia, MD AU - Wells, JE AU - Smith, TPL AD - USDA-ARS, US Meat Animal Research Center, Clay Center, P.O. Box 166 NE, USA Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 571 EP - 577 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 42 IS - 6 SN - 0268-9146, 0268-9146 KW - Biochemistry Abstracts 2: Nucleic Acids; Microbiology Abstracts B: Bacteriology; Genetics Abstracts KW - Mycobacterium avium KW - Haplotypes KW - Single-nucleotide polymorphism KW - Paratuberculosis KW - Progeny KW - Pathogens KW - CD18 antigen KW - Lymph nodes KW - J 02410:Animal Diseases KW - N 14845:Miscellaneous KW - G 07770:Bacteria UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/915488646?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Animal+Genetics&rft.atitle=Association+of+single+nucleotide+polymorphisms+in+the+ANKRA2+and+CD180+genes+with+bovine+respiratory+disease+and+presence+of+Mycobacterium+avium+subsp.+paratuberculosis&rft.au=Casas%2C+E%3BGarcia%2C+MD%3BWells%2C+JE%3BSmith%2C+TPL&rft.aulast=Casas&rft.aufirst=E&rft.date=2011-12-01&rft.volume=42&rft.issue=6&rft.spage=571&rft.isbn=&rft.btitle=&rft.title=Animal+Genetics&rft.issn=02689146&rft_id=info:doi/10.1111%2Fj.1365-2052.2011.02189.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Document feature - figure 0 N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Haplotypes; Single-nucleotide polymorphism; Paratuberculosis; Progeny; Pathogens; CD18 antigen; Lymph nodes; Mycobacterium avium DO - http://dx.doi.org/10.1111/j.1365-2052.2011.02189.x ER - TY - JOUR T1 - Multiple activities of insect repellents on odorant receptors in mosquitoes AN - 915487461; 16098637 AB - Several lines of evidence suggest that insect repellent molecules reduce mosquito-host contacts by interacting with odorants and odorant receptors (ORs), thereby ultimately affecting olfactory-driven behaviours. We describe the molecular effects of 10 insect repellents and a pyrethroid insecticide with known repellent activity on two highly specific Aedes aegypti (Diptera: Culicidae) ORs, AaOR2 + AaOR7 and AaOR8 + AaOR7, exquisitely sensitive to key mosquito attractants indole and (R)-(-)-1-octen-3-ol, expressed in oocytes of Xenopus (Anura: Pipidae). Our study demonstrates that insect repellents can both inhibit odorant-evoked currents mediated by ORs and independently elicit currents in the absence of odorants. All of the repellents had effects on one or both ORs; most of these compounds were selective inhibitors and showed a high degree of specificity in their capacity to activate the two ORs. These results show that a range of insect repellents belonging to structurally diverse chemical classes modulate the function of mosquito ORs through multiple molecular mechanisms. JF - Medical and Veterinary Entomology AU - Bohbot, J D AU - Fu, L AU - Le, T C AU - Chauhan, K R AU - Cantrell, CL AU - Dickens, J C AD - Invasive Insect Biocontrol and Behavior Laboratory, Plant Sciences Institute, U.S. Department of Agriculture-Agricultural Research Service (USDA-ARS), Henry A. Wallace Beltsville Agricultural Research Center, Beltsville, MD, U.S.A. 1 Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 436 EP - 444 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 25 IS - 4 SN - 0269-283X, 0269-283X KW - Entomology Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources KW - Molecular modelling KW - Aedes aegypti KW - Amphibiotic species KW - Specificity KW - Attractants KW - Insecticides KW - Repellents KW - Xenopus KW - Oocytes KW - Inhibitors KW - Pipidae KW - Pyrethroids KW - Aquatic insects KW - Anura KW - Receptors KW - Culicidae KW - Pest control KW - Odorant receptors KW - Indole KW - Diptera KW - Odour KW - Odorants KW - Z 05320:Physiology, Anatomy, and Biochemistry KW - Q1 08485:Species interactions: pests and control KW - Q5 08524:Public health, medicines, dangerous organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/915487461?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Medical+and+Veterinary+Entomology&rft.atitle=Multiple+activities+of+insect+repellents+on+odorant+receptors+in+mosquitoes&rft.au=Bohbot%2C+J+D%3BFu%2C+L%3BLe%2C+T+C%3BChauhan%2C+K+R%3BCantrell%2C+CL%3BDickens%2C+J+C&rft.aulast=Bohbot&rft.aufirst=J&rft.date=2011-12-01&rft.volume=25&rft.issue=4&rft.spage=436&rft.isbn=&rft.btitle=&rft.title=Medical+and+Veterinary+Entomology&rft.issn=0269283X&rft_id=info:doi/10.1111%2Fj.1365-2915.2011.00949.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Document feature - figure 4 N1 - Last updated - 2014-11-12 N1 - SubjectsTermNotLitGenreText - Insecticides; Specificity; Amphibiotic species; Repellents; Receptors; Inhibitors; Pest control; Odour; Aquatic insects; Molecular modelling; Odorant receptors; Indole; Oocytes; Attractants; Pyrethroids; Odorants; Aedes aegypti; Anura; Xenopus; Culicidae; Pipidae; Diptera DO - http://dx.doi.org/10.1111/j.1365-2915.2011.00949.x ER - TY - JOUR T1 - Evaluation of an in vitro cell assay to select attenuated bacterial mutants of Aeromonas hydrophila and Edwardsiella tarda to channel catfish AN - 915485726; 16097590 AB - Aims: To evaluate the feasibility of using an in vitro cell assay to select attenuated bacterial mutants. Methods and Results: Using catfish gill cells G1B, the feasibility of using an in vitro assay instead of in vivo virulence assay using live fish to select attenuated bacterial mutants was evaluated in this study. Pearson correlation analysis between in vitro virulence to G1B cells and in vivo virulence of Aeromonas hydrophila and Edwardsiella tarda revealed that there was a significant correlation between the two (r=-0.768, P value=3.710-16). Conclusions:The in vitro cell assay might be initially used to screen large quantities of bacteria to select attenuated mutants of catfish pathogens. Significance and Impact of the Study: The in vitro cell assay using catfish gill cells to identify attenuated mutants of catfish pathogens will reduce cost involved in the in vivo virulence assay that requires many fish and aquariums. JF - Journal of Applied Microbiology AU - Pridgeon, J W AU - Klesius, PH AU - Mu, X AD - Aquatic Animal Health Research Unit, USDA-ARS, Auburn, AL, USA Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 1310 EP - 1318 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 111 IS - 6 SN - 1364-5072, 1364-5072 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts B: Bacteriology; ASFA 1: Biological Sciences & Living Resources KW - Bacteria KW - Edwardsiella tarda KW - Aeromonas hydrophila KW - Pathogens KW - Correlation analysis KW - Freshwater KW - Freshwater fish KW - Ictalurus punctatus KW - Virulence KW - Microbiology KW - Gills KW - J 02410:Animal Diseases KW - Q1 08484:Species interactions: parasites and diseases KW - A 01300:Methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/915485726?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Applied+Microbiology&rft.atitle=Evaluation+of+an+in+vitro+cell+assay+to+select+attenuated+bacterial+mutants+of+Aeromonas+hydrophila+and+Edwardsiella+tarda+to+channel+catfish&rft.au=Pridgeon%2C+J+W%3BKlesius%2C+PH%3BMu%2C+X&rft.aulast=Pridgeon&rft.aufirst=J&rft.date=2011-12-01&rft.volume=111&rft.issue=6&rft.spage=1310&rft.isbn=&rft.btitle=&rft.title=Journal+of+Applied+Microbiology&rft.issn=13645072&rft_id=info:doi/10.1111%2Fj.1365-2672.2011.05146.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Document feature - figure 7 N1 - Last updated - 2016-03-30 N1 - SubjectsTermNotLitGenreText - Virulence; Microbiology; Correlation analysis; Pathogens; Freshwater fish; Gills; Bacteria; Edwardsiella tarda; Aeromonas hydrophila; Ictalurus punctatus; Freshwater DO - http://dx.doi.org/10.1111/j.1365-2672.2011.05146.x ER - TY - JOUR T1 - Improving cotton (Gossypium hirsutum L.) plant resistance to reniform nematodes by pyramiding Ren1 and Ren2 AN - 915482371; 16112774 AB - Reniform nematode (Rotylenchulus reniformis) has become a major pest of cotton in the mid-south area of the United States. Resistance genes, Ren1 and Ren2 from Gossypium longicalyx and Gossypium aridum, respectively, have been identified and introduced into Upland cotton (Gossypium hirsutum). We developed an F2 population of 184 progeny plants by crossing Ren2 -containing plants with a LONREN-2 plant that had the resistance gene Ren1. The F2 plants were evaluated for their resistance to reniform nematodes in a growth chamber. Microsatellite markers BNL2662 and BNL3279 were analysed to assist the selection of proper parental plants and F1 progeny and to study the segregation of the resistance genes in the F2 population. Our results suggested that Ren1 and Ren2 were duplicate genes with Ren1 residing on chromosome 11 (A subgenome) and Ren2 on chromosome 21 (D subgenome). F2 plants containing either Ren1 or Ren2 had significantly fewer nematodes than the susceptible Upland cotton genotype. No significant difference in nematode resistance was found between plants containing Ren1 and those having Ren2, indicating that these two genes may have similar resistance mechanisms. Plants containing both Ren1 and Ren2 appeared to have higher resistance than those with just one of the genes, and pyramiding these two genes may be a valuable tool to cotton breeders when managing this pest.Original Abstract: With 4 tables JF - Plant Breeding/Zeitschrift fuer Pflanzenzuchtung AU - Fang, David D AU - Stetina, Salliana R AD - Cotton Fiber Bioscience Research Unit, USDA-ARS-SRRC, 1100 Robert E. Lee Blvd, New Orleans, LA 70124, USA, E-mail: david.fangrs.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 673 EP - 678 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 130 IS - 6 SN - 0179-9541, 0179-9541 KW - Biotechnology and Bioengineering Abstracts KW - Genetic crosses KW - Genetic markers KW - Genotypes KW - Microsatellites KW - Pests KW - Plant breeding KW - chromosome 11 KW - chromosome 21 KW - gene duplication KW - Gossypium KW - Gossypium hirsutum KW - Rotylenchulus KW - Nematoda KW - W 30930:Agricultural Applications UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/915482371?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Breeding%2FZeitschrift+fuer+Pflanzenzuchtung&rft.atitle=Improving+cotton+%28Gossypium+hirsutum+L.%29+plant+resistance+to+reniform+nematodes+by+pyramiding+Ren1+and+Ren2&rft.au=Fang%2C+David+D%3BStetina%2C+Salliana+R&rft.aulast=Fang&rft.aufirst=David&rft.date=2011-12-01&rft.volume=130&rft.issue=6&rft.spage=673&rft.isbn=&rft.btitle=&rft.title=Plant+Breeding%2FZeitschrift+fuer+Pflanzenzuchtung&rft.issn=01799541&rft_id=info:doi/10.1111%2Fj.1439-0523.2011.01889.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Document feature - figure 0 N1 - Last updated - 2012-06-18 N1 - SubjectsTermNotLitGenreText - chromosome 11; Genetic markers; Microsatellites; Plant breeding; Genotypes; Pests; chromosome 21; Genetic crosses; gene duplication; Rotylenchulus; Nematoda; Gossypium; Gossypium hirsutum DO - http://dx.doi.org/10.1111/j.1439-0523.2011.01889.x ER - TY - JOUR T1 - Essential oils of Cupressus funebris, Juniperus communis, and J. chinensis (Cupressaceae) as repellents against ticks (Acari: Ixodidae) and mosquitoes (Diptera: Culicidae) and as toxicants against mosquitoes. AN - 915379068; 22129397 AB - Juniperus communis leaf oil, J. chinensis wood oil, and Cupressus funebris wood oil (Cupressaceae) from China were analyzed by gas chromatography and gas chromatography-mass spectrometry. We identified 104 compounds, representing 66.8-95.5% of the oils. The major components were: α-pinene (27.0%), α-terpinene (14.0%), and linalool (10.9%) for J. communis; cuparene (11.3%) and δ-cadinene (7.8%) for J. chinensis; and α-cedrene (16.9%), cedrol (7.6%), and β-cedrene (5.7%) for C. funebris. The essential oils of C. funebris, J. chinensis, and J. communis were evaluated for repellency against adult yellow fever mosquitoes, Aedes aegypti (L.), host-seeking nymphs of the lone star tick, Amblyomma americanum (L.), and the blacklegged tick, Ixodes scapularis Say, and for toxicity against Ae. aegypti larvae and adults, all in laboratory bioassays. All the oils were repellent to both species of ticks. The EC(95) values of C. funebris, J. communis, and J. chinensis against A. americanum were 0.426, 0.508, and 0.917 mg oil/cm(2) filter paper, respectively, compared to 0.683 mg deet/cm(2) filter paper. All I. scapularis nymphs were repelled by 0.103 mg oil/cm(2) filter paper of C. funebris oil. At 4 h after application, 0.827 mg oil/cm(2) filter paper, C. funebris and J. chinensis oils repelled ≥80% of A. americanum nymphs. The oils of C. funebris and J. chinensis did not prevent female Ae. aegypti from biting at the highest dosage tested (1.500 mg/cm(2) ). However, the oil of J. communis had a Minimum Effective Dosage (estimate of ED(99) ) for repellency of 0.029 ± 0.018 mg/cm(2) ; this oil was nearly as potent as deet. The oil of J. chinensis showed a mild ability to kill Ae. aegypti larvae, at 80 and 100% at 125 and 250 ppm, respectively. © 2011 The Society for Vector Ecology. JF - Journal of vector ecology : journal of the Society for Vector Ecology AU - Carroll, John F AU - Tabanca, Nurhayat AU - Kramer, Matthew AU - Elejalde, Natasha M AU - Wedge, David E AU - Bernier, Ulrich R AU - Coy, Monique AU - Becnel, James J AU - Demirci, Betul AU - Başer, Kemal Husnu Can AU - Zhang, Jian AU - Zhang, Sui AD - USDA, ARS, Invasive Insect Biocontrol and Behavior Laboratory, Beltsville Agricultural Research Center, Beltsville, MD 20705, USA. john.carroll@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 258 EP - 268 VL - 36 IS - 2 KW - Insect Repellents KW - 0 KW - Oils, Volatile KW - Index Medicus KW - Mosquito Control -- methods KW - Animals KW - Tick Control -- methods KW - Toxicity Tests KW - Gas Chromatography-Mass Spectrometry KW - Nymph -- drug effects KW - Cupressaceae -- chemistry KW - Larva -- drug effects KW - Female KW - China KW - Juniperus -- chemistry KW - Aedes -- drug effects KW - Oils, Volatile -- pharmacology KW - Cupressus -- chemistry KW - Insect Repellents -- chemistry KW - Ixodes -- drug effects KW - Insect Repellents -- pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/915379068?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+vector+ecology+%3A+journal+of+the+Society+for+Vector+Ecology&rft.atitle=Essential+oils+of+Cupressus+funebris%2C+Juniperus+communis%2C+and+J.+chinensis+%28Cupressaceae%29+as+repellents+against+ticks+%28Acari%3A+Ixodidae%29+and+mosquitoes+%28Diptera%3A+Culicidae%29+and+as+toxicants+against+mosquitoes.&rft.au=Carroll%2C+John+F%3BTabanca%2C+Nurhayat%3BKramer%2C+Matthew%3BElejalde%2C+Natasha+M%3BWedge%2C+David+E%3BBernier%2C+Ulrich+R%3BCoy%2C+Monique%3BBecnel%2C+James+J%3BDemirci%2C+Betul%3BBa%C5%9Fer%2C+Kemal+Husnu+Can%3BZhang%2C+Jian%3BZhang%2C+Sui&rft.aulast=Carroll&rft.aufirst=John&rft.date=2011-12-01&rft.volume=36&rft.issue=2&rft.spage=258&rft.isbn=&rft.btitle=&rft.title=Journal+of+vector+ecology+%3A+journal+of+the+Society+for+Vector+Ecology&rft.issn=1948-7134&rft_id=info:doi/10.1111%2Fj.1948-7134.2011.00166.x LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2012-08-20 N1 - Date created - 2011-12-01 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1111/j.1948-7134.2011.00166.x ER - TY - JOUR T1 - Improved indexes for targeting placement of buffers of Hortonian runoff AN - 912920367; 16125234 AB - Targeting specific locations within agricultural watersheds for installing vegetative buffers has been advocated as a way to enhance the impact of buffers and buffer programs on stream water quality. Existing models for targeting buffers of Hortonian, or infiltration-excess, runoff are not well developed. The objective was to improve on an existing soil survey-based approach that would provide finer scale resolution, account for variable size of runoff source area to different locations, and compare locations directly on the basis of pollutant load that could be retained by a buffer. The method couples the Soil Survey Geographic database with topographic information provided by a grid digital elevation model in a geographic information system. Simple empirical equations were developed from soil and topographic variables to generate two indexes, one for deposition of sediment and one for infiltration of dissolved pollutants, and the equations were calibrated to the load of sediment and water, respectively, retained by a buffer under reference conditions using the process-basedVegetative Filter Strip Model. The resulting index equations and analytical procedures were demonstrated on a 67 km super(2) (25.9 mi super(2)) agricultural watershed in northwestern Missouri, where overland runoff contributes to degraded stream water quality. For both indexes, mapped results clearly mimic spatial patterns of water flow convergence into subdrainages, substantiating the importance of size of source area to a given location on capability to intercept pollutants from surface runoff. A method is described for estimating a range of index values that is appropriate for targeting vegetative buffers. The index for sediment retention is robust. However, the index for water (and dissolved pollutant) retention is much less robust because infiltration is very small, compared to inflow volumes, and is relatively insensitive to the magnitude of inflow from source areas. Consequently, an index of inflow volume may be more useful for planning alternative practices for reducing dissolved pollutant loads to streams. The improved indexes provide a better method than previous indexes for targeting vegetative buffers in watersheds where Hortonian runoff causes significant nonpoint pollution. JF - Journal of Soil and Water Conservation AU - Dosskey, M G AU - Qiu, Z AU - Helmers, MJ AU - Eisenhauer, DE AD - USDA Forest Service, Southern Research Station, National Agroforestry Center in Lincoln, Nebraska, USA Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 362 EP - 372 VL - 66 IS - 6 SN - 0022-4561, 0022-4561 KW - Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Sustainability Science Abstracts; Environment Abstracts; Pollution Abstracts; Meteorological & Geoastrophysical Abstracts; Water Resources Abstracts KW - water quality KW - buffers KW - Water conservation KW - Topographic effects KW - Watersheds KW - Water quality KW - Streams KW - Soil KW - Pollutants KW - Convergence KW - USA, Missouri KW - inflow KW - Surface runoff KW - Stream Pollution KW - Sedimentation KW - Agricultural runoff KW - Sediment pollution KW - Mathematical models KW - Nonpoint Pollution Sources KW - Pollution Load KW - Nonpoint pollution KW - Water pollution KW - Model Studies KW - Stream KW - Infiltration KW - Deposition KW - Soil conservation KW - Rainfall-runoff modeling KW - Runoff KW - AQ 00001:Water Resources and Supplies KW - ENA 06:Food & Drugs KW - SW 3050:Ultimate disposal of wastes KW - Q2 09123:Conservation KW - P 2000:FRESHWATER POLLUTION KW - M3 1010:Issues in Sustainable Development KW - M2 551.579.1:Water supply from precipitation (551.579.1) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/912920367?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soil+and+Water+Conservation&rft.atitle=Improved+indexes+for+targeting+placement+of+buffers+of+Hortonian+runoff&rft.au=Dosskey%2C+M+G%3BQiu%2C+Z%3BHelmers%2C+MJ%3BEisenhauer%2C+DE&rft.aulast=Dosskey&rft.aufirst=M&rft.date=2011-12-01&rft.volume=66&rft.issue=6&rft.spage=362&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soil+and+Water+Conservation&rft.issn=00224561&rft_id=info:doi/10.2489%2Fjswc.66.6.362 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Sediment pollution; Mathematical models; Stream; Topographic effects; Water quality; Sedimentation; Watersheds; Agricultural runoff; Water pollution; Convergence; Water conservation; Infiltration; Surface runoff; Rainfall-runoff modeling; Soil; water quality; buffers; Soil conservation; inflow; Nonpoint pollution; Streams; Pollutants; Nonpoint Pollution Sources; Deposition; Pollution Load; Stream Pollution; Runoff; Model Studies; USA, Missouri DO - http://dx.doi.org/10.2489/jswc.66.6.362 ER - TY - JOUR T1 - Capture of plateau runoff by global positioning system-guided seed drill operation AN - 912920365; 16125233 AB - Contour seeding has long been recommended as a means of detaining water on hillslopes, increasing infiltration, and reducing runoff and soil erosion. Highly undulated landscapes with complex slopes, such as those found in the inland Pacific Northwest, have stymied application of this practice. This study investigated the potential usefulness of using digital elevation models (DEMs) and global positioning system-based guidance systems to efficiently and effectively conduct terrain contouring seeding on a small portion of a field to intercept concentrated runoff. The objectives were to (1) assess the potential for contour planting to capture water that collects on plateaus that otherwise would run off and form severe rills and (2) to determine the resolution and accuracy of terrain representation by DEMs for deriving routing information for planting on elevation contours. A preliminary infiltration and runoff study was conducted in a cultivated field, in a Ritzville silt loam (coarse-silty, mixed, super-active, mesic Calcidic Haploxerolls) with 0% to 20% slopes. Planting was performed with a deep-furrow drill, creating furrows 20 cm (7.9 in) deep. Measurements of the amount of precisely contoured area needed to capture water introduced through furrows perpendicular to the contour furrows show this technique has the potential to increase detention storage, infiltration, and consequently, to influence overland flow and erosion processes. A DEM was developed from data representing global positioning system collection at three different implement widths: 3, 6, and 9 m (9.8, 20, and 29.5 ft). Digital elevation data were collected with a real-time kinematic global positioning system and were processed using four software interpolation methods to develop surface models. The ability of each interpolation method to accurately create contour paths for equipment to follow was compared to points established on the ground with a laser-level. Our results demonstrated that a strip of deep-furrow seeding precisely contoured on the upper shoulder slope should provide sufficient detention storage to capture and hold the runoff from a 100 y, 24 h storm if the contour strip area was approximately 2% of the runoff collection area. Using DEM-derived contour lines, precisely tracked by farm equipment and applied to areas above steep slopes, contour planting of small, select areas of a field will improve soil and water conservation in tillage systems. The method can be implemented using commercially available mapping software and autosteering equipment designed for tractors and drills. JF - Journal of Soil and Water Conservation AU - Williams, J D AU - Long, D S AU - Wuest, S B AD - Columbia Plateau Conservation Research Center, USDA Agricultural Research Service, Pendleton, Oregon, USA Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 355 EP - 361 VL - 66 IS - 6 SN - 0022-4561, 0022-4561 KW - ASFA Aquaculture Abstracts; Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Sustainability Science Abstracts; Environment Abstracts; Meteorological & Geoastrophysical Abstracts; Water Resources Abstracts KW - Positioning systems KW - Storm Runoff KW - Infiltration and runoff KW - Water conservation KW - Drills KW - Contours KW - Soil erosion KW - Storms KW - INE, USA, Pacific Northwest KW - Computer programs KW - Soils KW - Slopes KW - Agricultural runoff KW - Topography KW - Seed (aquaculture) KW - Furrows KW - Seeding (aquaculture) KW - planting KW - silt KW - Water Conservation KW - Overland flow KW - Model Studies KW - Erosion processes KW - Storage KW - plateaus KW - seeding KW - Erosion KW - Interpolation methods KW - Elevation KW - Infiltration KW - Soil conservation KW - Rainfall-runoff modeling KW - Runoff KW - AQ 00001:Water Resources and Supplies KW - Q2 09123:Conservation KW - Q3 08581:Aquaculture: General KW - SW 0835:Streamflow and runoff KW - M3 1010:Issues in Sustainable Development KW - M2 551.579.1:Water supply from precipitation (551.579.1) KW - ENA 15:Renewable Resources-Terrestrial UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/912920365?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soil+and+Water+Conservation&rft.atitle=Capture+of+plateau+runoff+by+global+positioning+system-guided+seed+drill+operation&rft.au=Williams%2C+J+D%3BLong%2C+D+S%3BWuest%2C+S+B&rft.aulast=Williams&rft.aufirst=J&rft.date=2011-12-01&rft.volume=66&rft.issue=6&rft.spage=355&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soil+and+Water+Conservation&rft.issn=00224561&rft_id=info:doi/10.2489%2Fjswc.66.6.355 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Seed (aquaculture); Positioning systems; Water conservation; Soils; Seeding (aquaculture); Drills; Soil erosion; Agricultural runoff; Runoff; Infiltration and runoff; Interpolation methods; Infiltration; Rainfall-runoff modeling; Overland flow; Storms; Erosion processes; Topography; Storage; Computer programs; plateaus; Erosion; seeding; Soil conservation; planting; silt; Storm Runoff; Elevation; Furrows; Contours; Water Conservation; Slopes; Model Studies; INE, USA, Pacific Northwest DO - http://dx.doi.org/10.2489/jswc.66.6.355 ER - TY - JOUR T1 - Recent advances in precision (target) conservation AN - 912920351; 16125229 AB - Achieving food security and sustainability in the 21st century is expected to become increasingly challenging due to greater soil degradation resulting from climate change, population growth, and depletion of water resources (Delgado et al. 2011). New scientific research is critical for developing innovative soil and water conservation practices and programs that will maintain or even increase agricultural productivity. This special issue about recent advances in landscape-targeting precision conservation presents studies that investigate the impacts of precision conservation management on agricultural systems and the environment. JF - Journal of Soil and Water Conservation AU - Delgado, JA AU - Khosla, R AU - Mueller, T AD - USDA Agricultural Research Service Soil Plant Nutrient Research Unit, Fort Collins, Colorado, USA Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 167A EP - 170A VL - 66 IS - 6 SN - 0022-4561, 0022-4561 KW - Aqualine Abstracts; Sustainability Science Abstracts; Environment Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Resource management KW - Population Dynamics KW - Agricultural production KW - Water conservation KW - Climate change KW - Water resources KW - food security KW - Population dynamics KW - population growth KW - sustainability KW - Depletion KW - Water Conservation KW - Foods KW - Precision KW - Conservation KW - Soil conservation KW - innovations KW - Productivity KW - Environment management KW - Water Resources KW - AQ 00001:Water Resources and Supplies KW - ENA 06:Food & Drugs KW - SW 0845:Water in soils KW - Q2 09123:Conservation KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/912920351?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soil+and+Water+Conservation&rft.atitle=Recent+advances+in+precision+%28target%29+conservation&rft.au=Delgado%2C+JA%3BKhosla%2C+R%3BMueller%2C+T&rft.aulast=Delgado&rft.aufirst=JA&rft.date=2011-12-01&rft.volume=66&rft.issue=6&rft.spage=167A&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soil+and+Water+Conservation&rft.issn=00224561&rft_id=info:doi/10.2489%2Fjswc.66.6.167A LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2016-07-07 N1 - SubjectsTermNotLitGenreText - Resource management; Water conservation; Climate change; Water resources; Population dynamics; population growth; Agricultural production; Soil conservation; Conservation; sustainability; food security; innovations; Environment management; Foods; Depletion; Population Dynamics; Precision; Water Conservation; Productivity; Water Resources DO - http://dx.doi.org/10.2489/jswc.66.6.167A ER - TY - JOUR T1 - Variable Expression of the Stagonospora nodorum Effector SnToxA Among Isolates Is Correlated with Levels of Disease in Wheat AN - 911164826; 16110851 AB - Most research on host-pathogen interactions is focused on mechanisms of resistance, but less is known regarding mechanisms of susceptibility. The wheat-Stagonospom nodorum pathosystcm involves pathogen-produced effectors, also known as host-selective toxins, that interact with corresponding dominant host genes to cause disease. Recognition of the S. nodorum effectors SnToxA and SnTox2 is mediated by the wheat genes Tsn1 and Snn2, respectively. Here, we inoculated a population of wheat recombinant inbred lines that segregates for Tsn1 and Snn2 with conidia from two S. nodorum isolates, Sn4 and Sn5, which both produce SnToxA and SnTox2 to compare the effects of compatible Tsn1-SnToxA and Snn2-SnTox2 interactions between the two isolates. Genetic analysis revealed that the two interactions contribute equally to disease caused by isolate Sn4 but the Tsn1-SnToxA interaction contributed substantially more to disease conferred by Sn5 than did the Snn2-SnTox2 interaction. Sequence analysis of the SnToxA locus from Sn4 and Sn5 indicated that they were 99.5% identical, with no polymorphisms in the coding region or the predicted promoters. Analysis of transcription levels showed that expression levels of SnToxA peaked at 26 h postinoculation for both isolates but SnToxA expression in Sn5 was more than twice that of Sn4. This work demonstrates that necrotrophic effectors of different isolates can be expressed at different levels in planta, and that higher levels of expression lead to increased levels of disease in the wheat-S. nodorum pathosystem. JF - Molecular Plant-Microbe Interactions AU - Faris, J D AU - Zhang, Z AU - Rasmussen, J B AU - Friesen, T L AD - United States Department of Agriculture-Agricultural Research Service Cereal Crops Unit, 1307 18th Street North, Fargo, ND 58102-2765, USA, justin.faris@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1419 EP - 1426 VL - 24 IS - 12 SN - 0894-0282, 0894-0282 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Triticum aestivum KW - Promoters KW - Plant diseases KW - Stagonospora nodorum KW - Host-pathogen interactions KW - Genetic analysis KW - Transcription KW - Conidia KW - Inbreeding KW - Toxins KW - A 01360:Plant Diseases KW - K 03310:Genetics & Taxonomy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911164826?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Molecular+Plant-Microbe+Interactions&rft.atitle=Variable+Expression+of+the+Stagonospora+nodorum+Effector+SnToxA+Among+Isolates+Is+Correlated+with+Levels+of+Disease+in+Wheat&rft.au=Faris%2C+J+D%3BZhang%2C+Z%3BRasmussen%2C+J+B%3BFriesen%2C+T+L&rft.aulast=Faris&rft.aufirst=J&rft.date=2011-12-01&rft.volume=24&rft.issue=12&rft.spage=1419&rft.isbn=&rft.btitle=&rft.title=Molecular+Plant-Microbe+Interactions&rft.issn=08940282&rft_id=info:doi/10.1094%2FMPMI-04-11-0094 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2012-03-29 N1 - SubjectsTermNotLitGenreText - Promoters; Plant diseases; Host-pathogen interactions; Genetic analysis; Transcription; Inbreeding; Conidia; Toxins; Triticum aestivum; Stagonospora nodorum DO - http://dx.doi.org/10.1094/MPMI-04-11-0094 ER - TY - JOUR T1 - A Test System to Quantify Inoculum in Runoff from Phytophthora ramorum-Infected Plant Roots AN - 911163662; 16110918 AB - Foliar hosts of Phytophthora ramorum are often susceptible to root infection but the epidemiological significance of such infections is unknown. A standardized test system was developed to quantify inoculum in runoff from root-infected Viburnum tinus 'Spring Bouquet' or Rhododendron 'Cunningham's White' cuttings. Cuttings of both species gave off a maximum amount of inoculum 1 to 3 weeks after inoculation. The greatest amount of inoculum was recovered from Viburnum roots that were 48 to 70 days old at the time of inoculation, or roots incubated at 15 to 20 degree C rather than 25 degree C. Inoculum in runoff from inoculated Viburnum roots was similar for four different isolates of P. ramorum representing both the NA1 and EU1 lineages. When Rhododendron cuttings were inoculated with P. ramorum, P. citricola, or P. cactorum, inoculum of all three pathogens was recovered from runoff, with the highest amount recovered from plants inoculated with P. citricola, followed by the other two. Compared with the other two pathogens, P. ramorum colonized root tissue to a smaller extent. The epidemiology of root infection by P. ramorum is important in itself but the assay might lend itself for use in risk analysis for root infection of other plant species and evaluation of control measures, and also shed light on other root-infecting Phytophthora spp. JF - Phytopathology AU - Shishkoff, N AD - Agricultural Research Service FDWSRU, Fort Detrick, Frederick, MD 21702, USA, nina.shishkoff@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1457 EP - 1464 VL - 101 IS - 12 SN - 0031-949X, 0031-949X KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Epidemiology KW - Infection KW - Inoculation KW - Inoculum KW - Pathogens KW - Roots KW - Runoff KW - Rhododendron KW - Viburnum KW - Viburnum tinus KW - Phytophthora KW - A 01360:Plant Diseases KW - K 03400:Human Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911163662?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Phytopathology&rft.atitle=A+Test+System+to+Quantify+Inoculum+in+Runoff+from+Phytophthora+ramorum-Infected+Plant+Roots&rft.au=Shishkoff%2C+N&rft.aulast=Shishkoff&rft.aufirst=N&rft.date=2011-12-01&rft.volume=101&rft.issue=12&rft.spage=1457&rft.isbn=&rft.btitle=&rft.title=Phytopathology&rft.issn=0031949X&rft_id=info:doi/10.1094%2FPHYTO-09-10-0260 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2012-12-03 N1 - SubjectsTermNotLitGenreText - Epidemiology; Inoculation; Inoculum; Roots; Pathogens; Infection; Runoff; Viburnum tinus; Rhododendron; Viburnum; Phytophthora DO - http://dx.doi.org/10.1094/PHYTO-09-10-0260 ER - TY - JOUR T1 - Genetics of Resistance to Race TTKSK of Puccinia graminis f. sp. tritici in Triticum monococcum AN - 911163634; 16110914 AB - Race TTKSK (or Ug99) of Puccinia graminis f. sp. tritici possesses virulence to several stem rust resistance genes commonly present in wheat cultivars grown worldwide. New variants detected in the race TTKSK lineage further broadened the virulence spectrum. The identification of sources of genetic resistance to race TTKSK and its relatives is necessary to enable the development and deployment of resistant varieties. Accessions of Triticum monococcum, an A-genome diploid wild and cultivated wheat, have previously been characterized as resistant to stem rust. Three resistance genes were identified and introgressed into hexaploid wheat: Sr21, Sr22, and Sr35. The objective of this study was to determine the genetic control and allelic relationships of resistance to race TTKSK in T. monococcum accessions identified through evaluations at the seedling stage. Generation F sub(2) progeny of 8 crosses between resistant and susceptible accessions and 13 crosses between resistant accessions of T. monococcum were evaluated with race TTKSK and often with North American races, including races QFCSC, TTTTF, and MCCFC. For a selected population segregating for three genes conferring resistance to race TTKSK, F sub(2:3) progeny were evaluated with races TTKSK, QFCSC, and TTTTF. In that population, we detected two genes conferring resistance to race TTKSK that are different from Sr21, Sr22, and Sr35. One of the new genes was effective to all races tested. The identification of these genes will facilitate the development of varieties with new resistance to race TTKSK. JF - Phytopathology AU - Rouse, M N AU - Jin, Y AD - United States Department of Agriculture-Agricultural Research Service Cereal Disease Laboratory, University of Minnesota, St. Paul 55108, USA, Yue.Jin@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1418 EP - 1423 VL - 101 IS - 12 SN - 0031-949X, 0031-949X KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Genetics Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Virulence KW - Triticum aestivum KW - Triticum monococcum KW - Stem rust KW - Diploids KW - Seedlings KW - Genetic control KW - Genetic crosses KW - Puccinia graminis KW - Races KW - A 01360:Plant Diseases KW - G 07800:Plants and Algae KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911163634?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Phytopathology&rft.atitle=Genetics+of+Resistance+to+Race+TTKSK+of+Puccinia+graminis+f.+sp.+tritici+in+Triticum+monococcum&rft.au=Rouse%2C+M+N%3BJin%2C+Y&rft.aulast=Rouse&rft.aufirst=M&rft.date=2011-12-01&rft.volume=101&rft.issue=12&rft.spage=1418&rft.isbn=&rft.btitle=&rft.title=Phytopathology&rft.issn=0031949X&rft_id=info:doi/10.1094%2FPHYTO-05-11-0133 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2012-03-29 N1 - SubjectsTermNotLitGenreText - Virulence; Diploids; Stem rust; Genetic control; Seedlings; Genetic crosses; Races; Triticum aestivum; Triticum monococcum; Puccinia graminis DO - http://dx.doi.org/10.1094/PHYTO-05-11-0133 ER - TY - JOUR T1 - Over-expression, purification and immune responses to Aeromonas hydrophila AL09-73 flagellar proteins AN - 911161423; 16075768 AB - Aeromonas hydrophila is ubiquitous in aquatic environments worldwide and causes many diseases in fish as well as human. Recent outbreaks of aeromonad diseases in channel catfish prompted us to investigate catfish immune responses during infection of A. hydrophila. In this communication, we report to amplify, over-express, purify and characterize 19 A. hydrophila flagellar proteins. All recombinant proteins were confirmed by nucleotide sequencing of expression plasmids, SDS-PAGE analysis and His tag Western blot of induced proteins. Our preliminary result also showed that the purified recombinant FlgK protein reacted strongly to sera from experimentally infected catfish, suggesting that this protein has potential for a novel target for vaccine development. It is also anticipated that these recombinant proteins will provide us with very useful tools to investigate host immune response to this microorganism. JF - Fish & Shellfish Immunology AU - Yeh, Hung-Yueh AU - Klesius, Phillip H AD - United States Department of Agriculture, Agricultural Research Service, Aquatic Animal Health Research Unit, 990 Wire Road, Auburn, AL 36832-4352, USA, hungyueh.yeh@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1278 EP - 1283 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 31 IS - 6 SN - 1050-4648, 1050-4648 KW - Microbiology Abstracts B: Bacteriology; ASFA 1: Biological Sciences & Living Resources; Immunology Abstracts KW - Flagella KW - Channel catfish KW - Ictalurus punctatus KW - Aeromonas hydrophila KW - Nucleotide sequence KW - protein purification KW - Hosts KW - Freshwater KW - Infection KW - Freshwater fish KW - Defence mechanisms KW - Public health KW - Western blotting KW - Plasmids KW - Aquatic environment KW - Nucleotides KW - Recombinants KW - Overexpression KW - Microorganisms KW - Immune response KW - Vaccines KW - J 02350:Immunology KW - Q1 08485:Species interactions: pests and control KW - F 06940:Fish Immunity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911161423?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Fish+%26+Shellfish+Immunology&rft.atitle=Over-expression%2C+purification+and+immune+responses+to+Aeromonas+hydrophila+AL09-73+flagellar+proteins&rft.au=Yeh%2C+Hung-Yueh%3BKlesius%2C+Phillip+H&rft.aulast=Yeh&rft.aufirst=Hung-Yueh&rft.date=2011-12-01&rft.volume=31&rft.issue=6&rft.spage=1278&rft.isbn=&rft.btitle=&rft.title=Fish+%26+Shellfish+Immunology&rft.issn=10504648&rft_id=info:doi/10.1016%2Fj.fsi.2011.09.016 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2014-09-18 N1 - SubjectsTermNotLitGenreText - Recombinants; Microorganisms; Hosts; Vaccines; Plasmids; Defence mechanisms; Freshwater fish; Nucleotides; Public health; Western blotting; Nucleotide sequence; Overexpression; protein purification; Immune response; Infection; Aquatic environment; Flagella; Aeromonas hydrophila; Ictalurus punctatus; Freshwater DO - http://dx.doi.org/10.1016/j.fsi.2011.09.016 ER - TY - JOUR T1 - Modeling connectivity of black bears in a desert sky island archipelago AN - 911159688; 16085956 AB - Landscape features such as rivers, mountains, desert basins, roads, and impermeable man-made structures may influence dispersal and gene flow among populations, thereby creating spatial structure across the landscape. In the US-Mexico borderland, urbanization and construction of the border fence have the potential to increase genetic subdivision and vulnerability to isolation in large mammal populations by bisecting movement corridors that have enabled dispersal between adjacent Sky Island mountain ranges. We examined genetic variation in black bears (Ursus americanus) from three regions in central and southern Arizona, US, to assess genetic and landscape connectivity in the US-Mexico border Sky Islands. We found that the three regions grouped into two subpopulations: the east-central subpopulation comprised of individuals sampled in the central highland and high desert regions, and the border subpopulation comprised of individuals sampled in the southern Sky Islands. Occupancy for the border subpopulation of black bears was influenced by cover type and distance to water, and occupancy-based corridor models identified 14 potential corridors connecting border Sky Island habitat cores with the east-central subpopulation. Biological quality of corridors, defined as length:width ratio and proportions of suitable habitat within corridors, declined with Sky Island dispersion. Our results show that black bears in the border subpopulation are moderately isolated from the east-central subpopulation, the main population segment of black bears in Arizona, and that connectivity for border bears may be vulnerable to anthropogenic activities, such as those associated with urbanization and trans-border security. JF - Biological Conservation AU - Atwood, Todd C AU - Young, Julie K AU - Beckmann, Jon P AU - Breck, Stewart W AU - Fike, Jennifer AU - Rhodes, Olin E AU - Bristow, Kirby D AD - Arizona Game and Fish Department, Phoenix, AZ 85086, USA, todd.c.atwood@aphis.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2851 EP - 2862 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 144 IS - 12 SN - 0006-3207, 0006-3207 KW - Sustainability Science Abstracts; Ecology Abstracts KW - Border fence KW - Corridor KW - Genetic connectivity KW - Landscape connectivity KW - Ursus americanus KW - Urbanization KW - Basins KW - Genetic diversity KW - dispersal KW - Models KW - Mountains KW - Islands KW - Gene flow KW - Rivers KW - Subpopulations KW - Landscape KW - Habitat KW - subpopulations KW - Deserts KW - bears KW - USA, Arizona KW - Conservation KW - Dispersal KW - M3 1010:Issues in Sustainable Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911159688?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biological+Conservation&rft.atitle=Modeling+connectivity+of+black+bears+in+a+desert+sky+island+archipelago&rft.au=Atwood%2C+Todd+C%3BYoung%2C+Julie+K%3BBeckmann%2C+Jon+P%3BBreck%2C+Stewart+W%3BFike%2C+Jennifer%3BRhodes%2C+Olin+E%3BBristow%2C+Kirby+D&rft.aulast=Atwood&rft.aufirst=Todd&rft.date=2011-12-01&rft.volume=144&rft.issue=12&rft.spage=2851&rft.isbn=&rft.btitle=&rft.title=Biological+Conservation&rft.issn=00063207&rft_id=info:doi/10.1016%2Fj.biocon.2011.08.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Rivers; Urbanization; Subpopulations; Landscape; Genetic diversity; Basins; Habitat; Models; Mountains; Islands; Deserts; Gene flow; Conservation; Dispersal; subpopulations; bears; dispersal; Ursus americanus; USA, Arizona DO - http://dx.doi.org/10.1016/j.biocon.2011.08.002 ER - TY - JOUR T1 - Outbreak of Cucurbit Powdery Mildew on Watermelon Fruit Caused by Podosphaera xanthii in Southwest Florida AN - 911158949; 16110948 AB - Cucurbit powdery mildew caused by the obligate parasite Podosphaera xanthii occurs commonly on foliage, petioles, and stems of most cucurbit crops grown in the United States. (3). However, in the field, fruit infection on cucurbits including watermelon (Citrullus lanatus), is rarely, if ever, observed (2). Consequently, it was atypical when severe powdery mildew-like symptoms were observed on seedless and seeded watermelon fruit on several commercial farms in southwestern Florida during November and December 2010. Severe powdery mildew was also observed on 'Tri-X 313' and 'Mickey Lee' fruit grown at SWFREC, Immokalee, FL. Infected fruit developed poorly and were not marketable. Powdery mildew symptoms were mainly observed on young immature fruit, but not on mature older fruit. Abundant powdery mildew conidia occurred on fruit surface, but not on the leaves. Conidia were produced in chains and averaged 35 x 21 mu m. Observation of conidia in 3% KOH indicated the presence of fibrosin bodies commonly found in the cucurbit powdery mildew genus Podosphaera (3). Orange-to-dark brown chasmothecia (formerly cleisthothecia) containing a single ascus were detected on the surface of some fruit samples. Conidial DNA was subjected to PCR using specific primers designed to amplify the internal transcribed spacer (ITS) region of Podosphaera (4). The resulting amplicons were sequenced and found to be 100% identical to the ITS sequences of P. xanthii in the NCBI database (D84387, EU367960, AY450961, AB040322, AB040315). Sequences from the watermelon fruit isolate were also identical to several P. fusca (synonym P. xanthii), P. phaseoli (GQ927253), and P. balsaminae (AB462803) sequences. On the basis of morphological characteristics and ITS sequence analysis, the pathogen infecting watermelon fruit can be considered as P. xanthii (1, 3, 4). The powdery mildew isolate from watermelon fruit was maintained on cotyledons of squash (Cucurbita pepo, 'Early Prolific Straight Neck'). Cotyledons and leaves of five plants each of various cucurbits and beans were inoculated with 10 mu l of a conidial suspension (10 super(5) conidia/ml) in water (0.02% Tween 20). Two weeks after inoculation, abundant conidia were observed on cucumber (Cucumis sativus, 'SMR-58') and melon (Cucumis meld) powdery mildew race differentials 'Iran H' and 'Vedrantais'. However, no growth was observed on melon differentials 'PI 414723', 'Edisto 47', 'PMR 5', 'PMR 45', 'MR 1', and 'WMR 29' (2, 3). The powdery mildew isolate from watermelon fruit behaved as melon race 1 (3). Mycelium and conidia were also observed on fruit surface of watermelon 'Sugar Baby' and a susceptible U.S. plant introduction (PI 538888) 3 weeks after inoculation. However, the disease was not as severe as what was observed in the fields in fall 2010. The pathogen did not grow on plants of Impatiens balsamina or on select bean (Phaseolus vulgaris) cultivars ('Red Kidney', 'Kentucky Blue', and 'Derby Bush'), but did grow and produce abundant conidia on 'Pinto bush bean'. Powdery mildew on watermelon fruit in production fields can be considered as a potentially new and serious threat requiring further studies to develop management strategies. JF - Plant Disease AU - Kousik, C S AU - Donahoo, R S AU - Webster, C G AU - Turechek, W W AU - Adkins, ST AU - Roberts, P D AD - USDA, ARS, USVL, Charleston, SC 29414, USA Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1586 EP - 1587 VL - 95 IS - 12 SN - 0191-2917, 0191-2917 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Fruits KW - Foliage KW - Parasites KW - Farms KW - Infection KW - Crops KW - Cucurbita pepo KW - Cucumis KW - Bushes KW - Polymerase chain reaction KW - Podosphaera xanthii KW - Sugar KW - Plant diseases KW - Leaves KW - Spacer KW - Conidia KW - Pathogens KW - Stems KW - Powdery mildew KW - Neck KW - Beans KW - Cotyledons KW - Databases KW - Cucumis sativus KW - Impatiens balsamina KW - Inoculation KW - Kidney KW - Citrullus lanatus KW - Phaseolus vulgaris KW - Primers KW - A 01360:Plant Diseases KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911158949?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=Outbreak+of+Cucurbit+Powdery+Mildew+on+Watermelon+Fruit+Caused+by+Podosphaera+xanthii+in+Southwest+Florida&rft.au=Kousik%2C+C+S%3BDonahoo%2C+R+S%3BWebster%2C+C+G%3BTurechek%2C+W+W%3BAdkins%2C+ST%3BRoberts%2C+P+D&rft.aulast=Kousik&rft.aufirst=C&rft.date=2011-12-01&rft.volume=95&rft.issue=12&rft.spage=1586&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-06-11-0521 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Parasites; Foliage; Fruits; Sugar; Plant diseases; Farms; Leaves; Conidia; Spacer; Pathogens; Stems; Infection; Neck; Powdery mildew; Crops; Beans; Cotyledons; Databases; Kidney; Inoculation; Bushes; Polymerase chain reaction; Primers; Cucumis sativus; Impatiens balsamina; Cucumis; Phaseolus vulgaris; Citrullus lanatus; Podosphaera xanthii; Cucurbita pepo DO - http://dx.doi.org/10.1094/PDIS-06-11-0521 ER - TY - JOUR T1 - Leaf Anthracnose, a New Disease of Swallow-Worts Caused by Colletotrichum lineola from Russia AN - 911158925; 16110947 AB - Black swallow-wort, Vincetoxicum nigrum (L.) Moench (= Cynanchum louiseae Kartesz & Gandhi), and pale swallow-wort, V. rossicum (Kleopow) Borhidi (= Cynanchum rossicum (Kleopow) Borhidi), are invasive plants belonging to the family Apocynaceae and are the targets of biological control efforts to control their spread in the United States. In 2010, a disease on a related species, V. scandens Sommier & Levier, was observed in the Krasnodar area of Russia. Disease symptoms were many small, dark red-to-purple leaf spots, approximately 2 to 5 mm in diameter, with white centers. Leaf spots were found on the upper leaf surface. Leaf tips and margins of leaves bearing many of these spots were necrotic. Symptomatic leaves were collected and sent to the BSL-3 containment facility at the Foreign Disease-Weed Science Research Unit (FDWSRU) of the USDA, ARS in Frederick MD. Surface-disinfested symptomatic leaves were incubated at 20 to 25 degree C in sterile moist chambers. After several days, acervuli and brown setae were observed inside the leaf spots. Pure cultures, designated FDWSRU 10-002, were obtained by transferring spore masses with sterile glass needles onto 20% V8 juice agar. Seeds of V. scandens, collected in Russia, were placed in a freezer at -20 degree C for 6 weeks and then germinated in sterile petri plates on moist filter paper. The seedlings were then transplanted and grown in a 20 degree C greenhouse under 12 h of light. Koch's postulates were fulfilled as follows: 2-month-old plants each of V. scandens, V. nigrum, and V. rossicum were inoculated with spores from 2-week-old cultures of isolate 10-002. Plants were inoculated by spraying an aqueous suspension of 10 super(6) spores per ml onto each plant until all leaves were wet. Plants were placed in 20 to 24 degree C dew chambers for 18 h and then placed in a 20 degree C greenhouse. Two weeks later, diseased leaves with the same symptoms observed in the field were harvested from each species, and the fungus was reisolated from seven of seven inoculated V. scandens plants, one of two V. nigrum plants, and four of four V. rossicum plants. Measurements of fungus fruiting structures were taken from cultures grown on synthetic nutrient-poor agar (SNA) (1). Conidiophores were brown, septate, and branched. Conidia were one-celled, hyaline, smooth walled, ovoid to oblong, falcate, and 20.1 to 26.2 x 1.7 to 3.6 mu m (mean plus or minus s.d. = 23.5 plus or minus 1.3 x 2.6 plus or minus 0.4 mu m). Lengths of the conidia conformed to the description of Colletotrichum lineola Corda (1), but the conidia were slightly narrower than described. To induce appressoria formation, approximately 10 super(4) conidia were placed on sterile dialysis membranes on top of SNA in petri dishes that were wrapped in foil and incubated at 24 degree C for 24 h. After this time, appressoria were observed with a microscope at x400 magnification. The appressoria were dark brown, smooth walled, ellipsoidal, and 5.5 to 25.5 x 3.6 to 12.1 mu m (mean plus or minus s.d. = 13.4 plus or minus 4.0 x 7.3 plus or minus 2.1 mu m), which conformed to the description of appressoria of C. lineola Corda (1). DNA sequences of ITS1, 5.8S, and ITS2 were submitted to GenBank (No. HQ731491), and after BLAST analysis, aligned 100% to 15 previously identified isolates of C. lineola in GenBank. Voucher specimens of the fungus have been deposited in the U.S. National Fungus Collection and were designated as BPI 881105 and BPI 881106. Host range and efficacy tests are planned to determine the suitability of C. lineola for biological control of swallow-worts in the United States. JF - Plant Disease AU - Berner, D AU - Cavin, C AU - Mukhina, Z AU - Kassanelly, D AD - USDA, ARS, Foreign Disease-Weed Science Research Unit, 1301 Ditto Avenue, Ft Detrick, MD 21702, USA Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1586 VL - 95 IS - 12 SN - 0191-2917, 0191-2917 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Pure culture KW - Biological control KW - Agar KW - Fruits KW - Host range KW - Nucleotide sequence KW - Juices KW - Spraying KW - Dew KW - Anthracnose KW - Apocynaceae KW - Colletotrichum KW - Setae KW - Appressoria KW - Plant diseases KW - Dialysis KW - Seeds KW - Microscopes KW - Leaves KW - Conidia KW - Light effects KW - Greenhouses KW - Leafspot KW - Filter paper KW - Seedlings KW - Spores KW - A 01370:Biological Control KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911158925?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=Leaf+Anthracnose%2C+a+New+Disease+of+Swallow-Worts+Caused+by+Colletotrichum+lineola+from+Russia&rft.au=Berner%2C+D%3BCavin%2C+C%3BMukhina%2C+Z%3BKassanelly%2C+D&rft.aulast=Berner&rft.aufirst=D&rft.date=2011-12-01&rft.volume=95&rft.issue=12&rft.spage=1586&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-04-11-0318 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Biological control; Pure culture; Fruits; Agar; Seeds; Dialysis; Plant diseases; Host range; Microscopes; Nucleotide sequence; Juices; Leaves; Conidia; Spraying; Anthracnose; Dew; Greenhouses; Light effects; Setae; Leafspot; Filter paper; Seedlings; Appressoria; Spores; Apocynaceae; Colletotrichum DO - http://dx.doi.org/10.1094/PDIS-04-11-0318 ER - TY - JOUR T1 - Transcriptional profiles of multiple genes in the anterior kidney of channel catfish vaccinated with an attenuated Aeromonas hydrophila AN - 911157895; 16075784 AB - A total of 22 uniquely expressed sequence tags (ESTs) were identified from channel catfish anterior kidney subtractive cDNA library at 12 h post vaccination with an attenuated Aeromonas hydrophila (AL09-71 N+R). Of the 22 ESTs, six were confirmed to be significantly (P < 0.05) induced by the vaccination. Of 88 channel catfish genes selected from literature, 14 were found to be significantly (P < 0.05) upregulated by the vaccination. The transcriptional levels of the total 20 genes induced by the vaccination were then compared to that induced by the virulent parent A. hydrophila (AL09-71) at different time points. At 3 h post vaccination (hpv) or infection (hpi), Na+/K+ ATPase alpha subunit was upregulated the most. At 6 and 12 hpv or hpi, hepcidin and interleukin-1 beta were induced the highest. At 24 hpv or hpi, hepcidin was upregulated the most, followed by lysozyme c. At 48 hpi, lysozyme c and hepcidin were significantly induced. When vaccinated fish were challenged by AL09-71, relative percent of survival of vaccinated fish were 100% at 14 days post vaccination (dpv). Transcriptional levels of toll-like receptor 5 and hepcidin were significantly upregulated in vaccinated fish at 14 dpv. Taken together, our results suggest that vaccination with attenuated A. hydrophila mimics infection by live bacteria, inducing multiple immune genes in channel catfish. JF - Fish & Shellfish Immunology AU - Mu, Xingjiang AU - Pridgeon, Julia W AU - Klesius, Phillip H AD - Aquatic Animal Health Research Unit, USDA-ARS, 990 Wire Road, Auburn, AL 36832, United States, Julia.Pridgeon@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1162 EP - 1172 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 31 IS - 6 SN - 1050-4648, 1050-4648 KW - Microbiology Abstracts B: Bacteriology; ASFA Aquaculture Abstracts; ASFA 1: Biological Sciences & Living Resources; Immunology Abstracts KW - Lysozyme KW - Adenosinetriphosphatase KW - Immunology KW - Interleukin 1 KW - Receptors KW - Aeromonas hydrophila KW - Potassium KW - Survival KW - Transcription KW - Kidneys KW - Freshwater KW - Infection KW - Freshwater fish KW - expressed sequence tags KW - Vaccination KW - Ictalurus punctatus KW - Genes KW - Kidney KW - Na super(+)/K super(+)-exchanging ATPase KW - Hepcidin KW - Toll-like receptors KW - Q1 08587:Diseases of Cultured Organisms KW - J 02350:Immunology KW - F 06940:Fish Immunity KW - Q3 08587:Diseases of Cultured Organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911157895?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Fish+%26+Shellfish+Immunology&rft.atitle=Transcriptional+profiles+of+multiple+genes+in+the+anterior+kidney+of+channel+catfish+vaccinated+with+an+attenuated+Aeromonas+hydrophila&rft.au=Mu%2C+Xingjiang%3BPridgeon%2C+Julia+W%3BKlesius%2C+Phillip+H&rft.aulast=Mu&rft.aufirst=Xingjiang&rft.date=2011-12-01&rft.volume=31&rft.issue=6&rft.spage=1162&rft.isbn=&rft.btitle=&rft.title=Fish+%26+Shellfish+Immunology&rft.issn=10504648&rft_id=info:doi/10.1016%2Fj.fsi.2011.10.011 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Genes; Immunology; Receptors; Kidneys; Freshwater fish; Vaccination; Lysozyme; Adenosinetriphosphatase; Interleukin 1; Transcription; Survival; Potassium; Infection; expressed sequence tags; Kidney; Na super(+)/K super(+)-exchanging ATPase; Hepcidin; Toll-like receptors; Aeromonas hydrophila; Ictalurus punctatus; Freshwater DO - http://dx.doi.org/10.1016/j.fsi.2011.10.011 ER - TY - JOUR T1 - Molecular Analysis of Turfgrass Rusts Reveals the Widespread Distribution of Puccinia coronata as a Pathogen of Kentucky Bluegrass in the United States AN - 911156890; 16110930 AB - Over the past 10 years, rust diseases have become increasingly prevalent on certain cultivars of Kentucky bluegrass. This pattern suggests that new races or new species of rust fungi may have emerged. To test this hypothesis, 66 samples of turfgrass rust fungi collected from across the United States were evaluated based on sequences of the internal transcribed spacer (ITS)-5.8S rDNA region. Phylogenetic analysis revealed three species: Puccinia coronata, P. graminis, and P. striiformis, comprising 67, 28, and 5% of the samples, respectively. P. coronata was frequently found in association with Kentucky bluegrass, a host-pathogen relationship that has not been previously reported. Comparison of molecular analyses with the use of standard field identification techniques--host association and pustule pigmentation-- showed that 58% of the Kentucky bluegrass samples would have been incorrectly diagnosed using nonmolecular criteria. To avoid such mis-identifications, a real-time polymerase chain reaction diagnostic protocol was developed for turfgrass-associated P. graminis, P. coronata, and P. striiformis using ITS sequences. Accurate, reproducible, species-specific identifications were made using as few as 50 to 150 urediniospores, even in mixed infections. This study represents the first DNA-based evaluation of turfgrass rust fungi and provides a quick and reliable sequence-based protocol as an alternative to less reliable field-based identification techniques. JF - Plant Disease AU - Beirn, LA AU - Moy, M AU - Meyer, WA AU - Clarke, B B AU - Crouch, JA AD - United States Department of Agriculture-Agricultural Research Service, Systematic Mycology and Microbiology Laboratory, Beltsville, MD 20705, USA, joanne.crouch@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1547 EP - 1557 VL - 95 IS - 12 SN - 0191-2917, 0191-2917 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Phylogeny KW - Plant diseases KW - Fungi KW - Urediniospores KW - Polymerase chain reaction KW - Spacer KW - Pathogens KW - Puccinia coronata KW - Rust KW - Mixed infection KW - New species KW - A 01360:Plant Diseases KW - K 03310:Genetics & Taxonomy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911156890?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=Molecular+Analysis+of+Turfgrass+Rusts+Reveals+the+Widespread+Distribution+of+Puccinia+coronata+as+a+Pathogen+of+Kentucky+Bluegrass+in+the+United+States&rft.au=Beirn%2C+LA%3BMoy%2C+M%3BMeyer%2C+WA%3BClarke%2C+B+B%3BCrouch%2C+JA&rft.aulast=Beirn&rft.aufirst=LA&rft.date=2011-12-01&rft.volume=95&rft.issue=12&rft.spage=1547&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-01-11-0073 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Phylogeny; Plant diseases; Fungi; Urediniospores; Polymerase chain reaction; Spacer; Pathogens; Rust; New species; Mixed infection; Puccinia coronata DO - http://dx.doi.org/10.1094/PDIS-01-11-0073 ER - TY - JOUR T1 - Virulence in Oat Crown Rust (Puccinia coronata f. sp. avenae) in the United States from 2006 through 2009 AN - 911155799; 16110927 AB - The use of race-specific seedling genes for resistance is the primary means of controlling crown rust of oat (Puccinia coronata f. sp. avenae) in the United States. To better utilize those resistance genes, knowledge of the occurrence and frequency of corresponding virulence in the population of P. coronata f. sp. avenae in the United States is essential. In total, 571 single-pustule isolates of oat crown rust were collected from cultivated and wild oat (Avena sativa and A. fatua, respectively) in the major oat production areas of the United States from 2006 through 2009. They were tested for virulence on seedlings of 31 differential oat lines in the greenhouse. In all, 201 races were found among the 357 isolates from the spring oat region of the north-central United States, and 140 races were found among 214 isolates from the southern winter oat region. The crown rust populations from the winter and spring oat regions were clearly differentiated from one another, differing in the frequency of virulence for 24 of the 31 differentials. Some virulence associations previously reported in the U.S. oat crown rust population were also found in both regions in this survey, even when the dataset was clone corrected. Associations between virulence to the Pc genes were predominately positive in both regions but both positive and negative associations occurred more frequently in the winter oat region, where sexual reproduction does not occur. Some of the virulence diversity in the oat crown rust population in the United States can be related to the deployment of resistance genes in commercial oat cultivars and virulence associations existing in the oat crown rust population. When data from a previous report covering 2001 through 2005 is combined with data reported in this article, the mean virulence of the U.S. populations of crown rust continued to increase from 2001 to 2009. Virulence to Pc38, Pc39, Pc45, Pc48, Pc52, Pc55, Pc56, Pc57, Pc59, Pc62, Pc63, Pc64, Pc68, and Pc96 significantly increased in one or both regions during this time period. No significant declines in virulence frequency were found in either region. Genes for crown rust resistance derived from A. sterilis appear to be as rapidly defeated as has happened to Pc genes from A. sativa. There is an urgent need to find additional sources of effective resistance to P. coronata f. sp. avenae and introgress it into adapted oat cultivars. JF - Plant Disease AU - Carson, M L AD - United States Department of Agriculture-Agricultural Research Service Cereal Disease Laboratory, St. Paul, MN 55108, USA, mcarson@umn.edu Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1528 EP - 1534 VL - 95 IS - 12 SN - 0191-2917, 0191-2917 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Virulence KW - Plant diseases KW - Data processing KW - Avena sativa KW - Crown rust KW - Sexual reproduction KW - Seedlings KW - Puccinia coronata KW - Greenhouses KW - A 01360:Plant Diseases KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911155799?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=Virulence+in+Oat+Crown+Rust+%28Puccinia+coronata+f.+sp.+avenae%29+in+the+United+States+from+2006+through+2009&rft.au=Carson%2C+M+L&rft.aulast=Carson&rft.aufirst=M&rft.date=2011-12-01&rft.volume=95&rft.issue=12&rft.spage=1528&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-09-10-0639 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Virulence; Plant diseases; Data processing; Crown rust; Sexual reproduction; Seedlings; Greenhouses; Avena sativa; Puccinia coronata DO - http://dx.doi.org/10.1094/PDIS-09-10-0639 ER - TY - JOUR T1 - Triticum mosaic virus Isolates in the Southern Great Plains AN - 911155790; 16110925 AB - In 2006, a previously unknown wheat (Triticum aestivum) virus was discovered in Western Kansas and given the name Triticum mosaic virus (TriMV). TriMV has since been found in wheat samples isolated all across the Great Plains. Even though it can infect singularly, TriMV is mostly found with Wheat streak mosaic virus (WSMV) as a co-infection. The potential for TriMV to cause economic loss is significant, but very little is known about the virus. The objective of this study was to survey the TriMV population for genetic variation by nucleotide sequencing of isolates across a geographical region. A secondary objective was to characterize the WSMV isolates that are being co-transmitted with TriMV. Fourteen different TriMV isolations were taken from locations in Texas, Oklahoma, and Kansas, and the coat protein cDNA was sequenced. Thirteen nucleotide differences were found in the TriMV isolates, of which three induce amino acid changes. WSMV isolates had 65 nucleotide changes when compared to WSMV Sydney81. Our results indicate the TriMV virus population has minimal amounts of sequence variation and no singular WSMV genotype is specifically associated with TriMV co-infection. Based on the isolates analyzed, it appears that the field population of TriMV is very homogeneous. JF - Plant Disease AU - Fuentes-Bueno, I AU - Price, JA AU - Rush, C M AU - Seifers, D L AU - Fellers, J P AD - USDA-ARS, Hard Winter Wheat Genetics Research Unit, 4008 Throckmorton Hall, Manhattan, KS 66506, USA, john.fellers@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1516 EP - 1519 VL - 95 IS - 12 SN - 0191-2917, 0191-2917 KW - Virology & AIDS Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Plant diseases KW - Triticum KW - Wheat streak mosaic virus KW - Nucleotide sequence KW - Genetic diversity KW - Streak KW - Genotypes KW - Nucleotides KW - Triticum aestivum KW - Population genetics KW - Economics KW - Coat protein KW - Amino acid sequence KW - A 01310:Products of Microorganisms KW - V 22310:Genetics, Taxonomy & Structure UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911155790?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=Triticum+mosaic+virus+Isolates+in+the+Southern+Great+Plains&rft.au=Fuentes-Bueno%2C+I%3BPrice%2C+JA%3BRush%2C+C+M%3BSeifers%2C+D+L%3BFellers%2C+J+P&rft.aulast=Fuentes-Bueno&rft.aufirst=I&rft.date=2011-12-01&rft.volume=95&rft.issue=12&rft.spage=1516&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-04-11-0281 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Population genetics; Plant diseases; Nucleotide sequence; Economics; Genetic diversity; Coat protein; Genotypes; Streak; Nucleotides; Amino acid sequence; Triticum aestivum; Triticum; Wheat streak mosaic virus DO - http://dx.doi.org/10.1094/PDIS-04-11-0281 ER - TY - JOUR T1 - Clostridium difficile in poultry and poultry meat. AN - 908004913; 21877928 AB - The incidence and severity of disease associated with toxigenic Clostridium difficile have increased in hospitals in North America from the emergence of newer, more virulent strains. Toxigenic C. difficile has been isolated from food animals and retail meat with potential implications of transfer to human beings. The objective of the present study was to determine the prevalence of toxigenic C. difficile in chickens and retail poultry meat in Texas. Seven C. difficile isolates were detected in fecal samples of 300 (2.3%) broiler chickens. Three cultivation procedures were evaluated for isolation of C. difficile from poultry meat and detected 1/32 (3.1%), 2/32 (6.2%), and 4/32 (12.5%) for the three procedures, respectively. Chicken and poultry meat isolates were characterized as toxinotype V and pulsed-field gel electrophoresis gel type-NAP7 or NAP7-variant. Susceptibilities to 11 antimicrobial agents in the current study suggested somewhat reduced resistance than reported for other meat or animal toxinotype V isolates. JF - Foodborne pathogens and disease AU - Harvey, Roger B AU - Norman, Keri N AU - Andrews, Kathleen AU - Hume, Michael E AU - Scanlan, Charles M AU - Callaway, Todd R AU - Anderson, Robin C AU - Nisbet, David J AD - Food and Feed Safety Research Unit, SPARC, Agricultural Research Service, U.S. Department of Agriculture, College Station, Texas 77845, USA. roger.harvey@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 1321 EP - 1323 VL - 8 IS - 12 KW - Anti-Infective Agents KW - 0 KW - Bacterial Proteins KW - Bacterial Toxins KW - Enterotoxins KW - tcdA protein, Clostridium difficile KW - toxB protein, Clostridium difficile KW - Index Medicus KW - Genotype KW - Feces -- microbiology KW - Polymerase Chain Reaction KW - Animals KW - Chickens KW - Food Microbiology KW - Texas -- epidemiology KW - Humans KW - Electrophoresis, Gel, Pulsed-Field KW - Microbial Sensitivity Tests KW - Prevalence KW - Bacterial Toxins -- genetics KW - Bacterial Proteins -- genetics KW - Clostridium difficile -- isolation & purification KW - Poultry Diseases -- epidemiology KW - Poultry Diseases -- microbiology KW - Enterotoxins -- genetics KW - Meat -- microbiology KW - Clostridium difficile -- genetics KW - Anti-Infective Agents -- pharmacology KW - Clostridium difficile -- drug effects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/908004913?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Foodborne+pathogens+and+disease&rft.atitle=Clostridium+difficile+in+poultry+and+poultry+meat.&rft.au=Harvey%2C+Roger+B%3BNorman%2C+Keri+N%3BAndrews%2C+Kathleen%3BHume%2C+Michael+E%3BScanlan%2C+Charles+M%3BCallaway%2C+Todd+R%3BAnderson%2C+Robin+C%3BNisbet%2C+David+J&rft.aulast=Harvey&rft.aufirst=Roger&rft.date=2011-12-01&rft.volume=8&rft.issue=12&rft.spage=1321&rft.isbn=&rft.btitle=&rft.title=Foodborne+pathogens+and+disease&rft.issn=1556-7125&rft_id=info:doi/10.1089%2Ffpd.2011.0936 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2013-06-19 N1 - Date created - 2011-12-01 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1089/fpd.2011.0936 ER - TY - JOUR T1 - Bacillus subtilis-based direct-fed microbials augment macrophage function in broiler chickens AN - 907176046; 16047303 AB - The present study was conducted to evaluate the function of Bacillus subtilis-based direct-fed microbials (DFMs) on macrophage functions, i.e., nitric oxide (NO) production and phagocytosis in broiler chickens. DFMs used in this study were eight single strains designated as Bs2084, LSSAO1, 3AP4, Bs18, 15AP4, 22CP1, Bs27, and Bs278, and one multiple strain DFM product (Avicorr[TM]) containing equal amount of Bs2084, LSSAO1 and 15AP4. NO concentrations were monitored in plasma and in the supernatants from the peripheral blood-derived monocytic cells (PBMC)-derived macrophages stimulated by either chicken recombinant interferon gamma (IFNI super(3)) or lipopolysaccharide (LPS) from Escherichia coli or Salmonella typhi. In addition, phagocytosis of fluorescent beads and green fluorescent protein (GFP)-labeled Salmonella by PBMC-derived macrophage was assayed. Plasma NO levels were significantly higher in groups given 3AP4 or Bs27 diets compared with the control group at days 7 and 14. NO production by PBMC-derived macrophages stimulated with IFNI super(3) or LPS was apparent, although the effect was strain-dependent. Phagocytosis of fluorescent beads or GFP-labeled Salmonella by macrophages was augmented in groups on DFM-supplemented diets compared with those fed the control diet. This study describes the immunomodulatory effects of Bacillus-based DFMs on innate immunity in broiler chickens. JF - Research in Veterinary Science AU - Lee, Kyung-Woo AU - Li, Guangxing AU - Lillehoj, Hyun S AU - Lee, Sung-Hyen AU - Jang, Seung I AU - Babu, Uma S AU - Lillehoj, Erik P AU - Neumann, Anthony P AU - Siragusa, Gregory R AD - Animal Parasitic Diseases Laboratory, Animal and Natural Resources Institute, Agricultural Research Service, USDA, Beltsville, MD 20705, USA, Hyun.Lillehoj@ARS.USDA.GOV Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - e87 EP - e91 PB - W.B. Saunders Co., 32 Jamestown Rd London NW1 7BY United Kingdom VL - 91 IS - 3 SN - 0034-5288, 0034-5288 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts B: Bacteriology KW - Direct-fed microbials KW - Innate immunity KW - Macrophage KW - Nitric oxide KW - Phagocytosis KW - Macrophages KW - Diets KW - gamma -Interferon KW - Poultry KW - Salmonella typhi KW - Green fluorescent protein KW - Immunity KW - Immunomodulation KW - Blood KW - Escherichia coli KW - Lipopolysaccharides KW - Monocytes KW - Bacillus KW - A 01330:Food Microbiology KW - J 02350:Immunology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907176046?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Research+in+Veterinary+Science&rft.atitle=Bacillus+subtilis-based+direct-fed+microbials+augment+macrophage+function+in+broiler+chickens&rft.au=Lee%2C+Kyung-Woo%3BLi%2C+Guangxing%3BLillehoj%2C+Hyun+S%3BLee%2C+Sung-Hyen%3BJang%2C+Seung+I%3BBabu%2C+Uma+S%3BLillehoj%2C+Erik+P%3BNeumann%2C+Anthony+P%3BSiragusa%2C+Gregory+R&rft.aulast=Lee&rft.aufirst=Kyung-Woo&rft.date=2011-12-01&rft.volume=91&rft.issue=3&rft.spage=e87&rft.isbn=&rft.btitle=&rft.title=Research+in+Veterinary+Science&rft.issn=00345288&rft_id=info:doi/10.1016%2Fj.rvsc.2011.01.018 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-09-05 N1 - SubjectsTermNotLitGenreText - Diets; Macrophages; Blood; gamma -Interferon; Poultry; Green fluorescent protein; Lipopolysaccharides; Nitric oxide; Immunity; Monocytes; Phagocytosis; Immunomodulation; Salmonella typhi; Escherichia coli; Bacillus DO - http://dx.doi.org/10.1016/j.rvsc.2011.01.018 ER - TY - JOUR T1 - Ethanol production from wheat straw by recombinant Escherichia coli strain FBR5 at high solid loading AN - 904479682; 15950532 AB - Ethanol production by a recombinant bacterium from wheat straw (WS) at high solid loading by separate hydrolysis and fermentation (SHF) and simultaneous saccharification and fermentation (SSF) was studied. The yield of total sugars from dilute acid pretreated WS (150 g/L) after enzymatic saccharification was 86.3 +/- 1.5 g/L. The pretreated WS was bio-abated by growing a fungal strain aerobically in the liquid portion for 16 h. The recombinant Escherichia coli strain FBR5 produced 41.1 +/- 1.1 g ethanol/L from non-abated WS hydrolyzate (total sugars, 86.6 +/- 0.3 g/L) in 168 h at pH 7.0 and 35 degree C. The bacterium produced 41.8 +/- 0.0 g ethanol/L in 120 h from the bioabated WS by SHF. It produced 41.6 +/- 0.7 g ethanol/L in 120 h from bioabated WS by fed-batch SSF. This is the first report of the production of above 4% ethanol from a lignocellulosic hydrolyzate by the recombinant bacterium. JF - Bioresource Technology AU - Saha, Badal C AU - Nichols, Nancy N AU - Cotta, Michael A AD - Bioenergy Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, US Department of Agriculture, Peoria, IL 61604, USA, Badal.Saha@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 10892 EP - 10897 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 102 IS - 23 SN - 0960-8524, 0960-8524 KW - Microbiology Abstracts B: Bacteriology; Biotechnology and Bioengineering Abstracts KW - Ethanol KW - Recombinant ethanologenic Escherichia coli KW - Separate hydrolysis and fermentation KW - Simultaneous saccharification and fermentation KW - Wheat straw hydrolyzate KW - wheat KW - Sugar KW - Fermentation KW - Hydrolysis KW - Batch culture KW - Triticum aestivum KW - Escherichia coli KW - Straw KW - pH effects KW - pH KW - J 02420:Plant Diseases KW - W 30945:Fermentation & Cell Culture UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/904479682?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Bioresource+Technology&rft.atitle=Ethanol+production+from+wheat+straw+by+recombinant+Escherichia+coli+strain+FBR5+at+high+solid+loading&rft.au=Saha%2C+Badal+C%3BNichols%2C+Nancy+N%3BCotta%2C+Michael+A&rft.aulast=Saha&rft.aufirst=Badal&rft.date=2011-12-01&rft.volume=102&rft.issue=23&rft.spage=10892&rft.isbn=&rft.btitle=&rft.title=Bioresource+Technology&rft.issn=09608524&rft_id=info:doi/10.1016%2Fj.biortech.2011.09.041 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Sugar; Fermentation; Straw; Hydrolysis; pH effects; Batch culture; Ethanol; wheat; pH; Triticum aestivum; Escherichia coli DO - http://dx.doi.org/10.1016/j.biortech.2011.09.041 ER - TY - JOUR T1 - Cuticular hydrocarbons from the bed bug Cimex lectularius L. AN - 904477529; 15938440 JF - Biochemical Systematics and Ecology AU - Feldlaufer, Mark F AU - Blomquist, Gary J AD - USDA-ARS, Invasive Insect Biocontrol &; Behavior Laboratory, 10300 Baltimore Avenue, Beltsville MD 20705, USA, mark.feldlaufer@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 283 EP - 285 PB - Elsevier B.V., P.O. Box 800 Kidlington Oxford OX5 1DX United Kingdom VL - 39 IS - 4-6 SN - 0305-1978, 0305-1978 KW - Ecology Abstracts KW - Bed bug KW - Cimex lectularius KW - Hydrocarbons KW - n-Alkanes KW - Methylalkanes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/904477529?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biochemical+Systematics+and+Ecology&rft.atitle=Cuticular+hydrocarbons+from+the+bed+bug+Cimex+lectularius+L.&rft.au=Feldlaufer%2C+Mark+F%3BBlomquist%2C+Gary+J&rft.aulast=Feldlaufer&rft.aufirst=Mark&rft.date=2011-12-01&rft.volume=39&rft.issue=4-6&rft.spage=283&rft.isbn=&rft.btitle=&rft.title=Biochemical+Systematics+and+Ecology&rft.issn=03051978&rft_id=info:doi/10.1016%2Fj.bse.2011.08.017 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2016-02-29 DO - http://dx.doi.org/10.1016/j.bse.2011.08.017 ER - TY - JOUR T1 - Identification of specific sites in the third intracellular loop and carboxyl terminus of the Bombyx mori pheromone biosynthesis activating neuropeptide receptor crucial for ligand-induced internalization. AN - 902330652; 21955122 AB - Sex pheromone production in most moths is mediated by the pheromone biosynthesis activating neuropeptide receptor (PBANR). Using fluorescent Bombyx mori PBANR (BmPBANR) chimeras to study PBANR regulation, we previously showed that BmPBANR undergoes rapid ligand-induced internalization, that the endocytotic motif resides between residues 358-367 of the BmPBANR C terminus, and that the internalization pathway is clathrin-dependent. Here, we sought to expand our understanding of the molecular mechanisms underlying BmPBANR function and regulation by transiently expressing a series of fluorescent BmPBANR chimeric constructs in cultured Spodoptera frugiperda (Sf9) cells and assaying for internalization of a fluorescently labelled ligand. Pharmacological inhibition of phospholipase C significantly reduced internalization, suggesting that BmPBANR regulation proceeds via a conventional G-protein-dependent pathway. This was further supported by impaired internalization following site-directed mutagenesis of R263 and R264, two basic residues at the transmembrane 6 intracellular junction that are thought to stabilize G-protein coupling via electrostatic interactions. Ala substitution of S333 and S366, two consensus protein kinase C sites in the C terminus, likewise impaired internalization, as did RNA interference-mediated knockdown of Sf9 protein kinase C. N-terminal truncations of BmPBANR indicate that the first 27 residues are not necessary for cell surface trafficking or receptor functionality. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society. JF - Insect molecular biology AU - Hull, J J AU - Lee, J M AU - Matsumoto, S AD - Molecular Entomology Laboratory, RIKEN Advanced Science Institute, Wako, Saitama, Japan. joe.hull@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 801 EP - 811 VL - 20 IS - 6 KW - Insect Proteins KW - 0 KW - Ligands KW - Pheromones KW - Receptors, Neuropeptide KW - Type C Phospholipases KW - EC 3.1.4.- KW - Index Medicus KW - Mutagenesis, Site-Directed KW - Microscopy, Confocal KW - Animals KW - Type C Phospholipases -- antagonists & inhibitors KW - DNA Mutational Analysis KW - Molecular Sequence Data KW - Amino Acid Sequence KW - Glycosylation KW - RNA Interference KW - Amino Acid Substitution KW - Protein Conformation KW - Pheromones -- biosynthesis KW - Receptors, Neuropeptide -- genetics KW - Insect Proteins -- genetics KW - Bombyx -- genetics KW - Receptors, Neuropeptide -- metabolism KW - Insect Proteins -- metabolism KW - Bombyx -- metabolism UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902330652?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Insect+molecular+biology&rft.atitle=Identification+of+specific+sites+in+the+third+intracellular+loop+and+carboxyl+terminus+of+the+Bombyx+mori+pheromone+biosynthesis+activating+neuropeptide+receptor+crucial+for+ligand-induced+internalization.&rft.au=Hull%2C+J+J%3BLee%2C+J+M%3BMatsumoto%2C+S&rft.aulast=Hull&rft.aufirst=J&rft.date=2011-12-01&rft.volume=20&rft.issue=6&rft.spage=801&rft.isbn=&rft.btitle=&rft.title=Insect+molecular+biology&rft.issn=1365-2583&rft_id=info:doi/10.1111%2Fj.1365-2583.2011.01110.x LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2012-02-10 N1 - Date created - 2011-11-04 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1111/j.1365-2583.2011.01110.x ER - TY - JOUR T1 - Heterologous production of pediocin for the control of Listeria monocytogenes in dairy foods AN - 899145898; 15324910 AB - Pediocin is an antimicrobial peptide naturally produced by Pediococci with the potential to serve as a food-grade preservative for controlling Listeria contamination. The use of Pediococci in dairy products is limited due to their inability to ferment lactose, thus lactic acid bacteria (LAB) have been considered as potential hosts for the heterologous production of pediocin. In this study the four gene operon (papA-D) required for pediocin production was cloned on the nisin-inducible expression vector pMSP3535H3. The resulting vector, pRSNPed2, was electrotransformed into Streptococcus thermophilus, Lactococcus lactis ssp. lactis and Lactobacillus casei. Transformants containing the properly constructed vector were identified by PCR analysis and shown to inhibit the growth of Listeria monocytogenes Scott A. S. thermophilus transformants were all shown to constitutively express pediocin; however, in L. lactis and L. casei both constitutive and inducer-dependent expression was observed. In all cases nisin-induction resulted in optimal pediocin production. Transformants from each LAB host were also shown to inhibit the growth of L. monocytogenes NR30, a nisin-resistant variant of L. monocytogenes Scott A. These results suggest pediocin has the potential to serve as a hurdle component along with nisin for prevention of Listeria contamination of foods. JF - Food Control AU - Renye, JA AU - Somkuti, G A AU - Garabal, JI AU - Du, L AD - Dairy and Functional Foods Research Unit, Eastern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, ERRC-ARS-USDA, 600 East Mermaid Lane, Wyndmoor, PA 19038, USA, john.renye@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 1887 EP - 1892 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 22 IS - 12 SN - 0956-7135, 0956-7135 KW - Microbiology Abstracts B: Bacteriology KW - Antimicrobial peptides KW - Lactobacillus casei KW - pediocin KW - J:02320 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/899145898?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Food+Control&rft.atitle=Heterologous+production+of+pediocin+for+the+control+of+Listeria+monocytogenes+in+dairy+foods&rft.au=Renye%2C+JA%3BSomkuti%2C+G+A%3BGarabal%2C+JI%3BDu%2C+L&rft.aulast=Renye&rft.aufirst=JA&rft.date=2011-12-01&rft.volume=22&rft.issue=12&rft.spage=1887&rft.isbn=&rft.btitle=&rft.title=Food+Control&rft.issn=09567135&rft_id=info:doi/10.1016%2Fj.foodcont.2011.04.031 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - pediocin; Lactobacillus casei DO - http://dx.doi.org/10.1016/j.foodcont.2011.04.031 ER - TY - JOUR T1 - Opposing influences by subsite &; minus; 1 and subsite + 1 residues on relative xylopyranosidase/arabinofuranosidase activities of bifunctional I super(2)-D-xylosidase/I+/--L-arabin ofuranosidase AN - 1823946516; 16048969 AB - Conformational inversion occurs 7-8 kcal/mol more readily in furanoses than pyranoses. This difference is exploited here to probe for active-site residues involved in distorting pyranosyl substrate toward reactivity. Spontaneous glycoside hydrolysis rates are ordered 4-nitrophenyl-I+/--l-arabinofuranoside (4NPA) > 4-nitrophenyl-I super(2)-d-xylopyranoside (4NPX) > xylobiose (X2). The bifunctional I super(2)-d-xylosidase/I+/--l-arabinofuranosidase exhibits the opposite order of reactivity, illustrating that the enzyme is well equipped in using pyranosyl groups of natural substrate X2 in facilitating glycoside hydrolysis. Probing the roles of all 17 active-site residues by single-site mutation to alanine and by changing both moieties of substrate demonstrates that the mutations of subsite - 1 residues decrease the ratio k sub(cat) super(4)NPX/4NPA, suggesting that the native residues support pyranosyl substrate distortion, whereas the mutations of subsite + 1 and the subsite - 1/+1 interface residues increase the ratio k sub(cat) super(4)NPX/4NPA, suggesting that the native residues support other factors, such as C1 migration and protonation of the leaving group. Alanine mutations of subsite - 1 residues raise k sub(cat) super(X)2/4NPX and alanine mutations of subsite + 1 and interface residues lower k sub(cat) super(X)2/4NPX. We propose that pyranosyl substrate distortion is supported entirely by native residues of subsite - 1. Other factors leading to the transition state are supported entirely by native residues of subsite + 1 and interface residues. JF - Biochimica et Biophysica Acta: Proteins and Proteomics AU - Jordan, Douglas B AU - Braker, Jay D AD - Bioenergy Research, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 N. University Street, Peoria, IL 61604, United States, douglas.jordan@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 1648 EP - 1657 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 1814 IS - 12 SN - 1570-9639, 1570-9639 KW - Biotechnology and Bioengineering Abstracts KW - Site-directed mutagenesis KW - Pyranosyl substrate distortion KW - Glycoside hydrolase KW - Plant cell wall deconstruction KW - Biomass saccharification KW - Alanine KW - Inversion KW - glycosides KW - Probes KW - Enzymes KW - Arabinofuranosidase KW - proteomics KW - Mutation KW - Hydrolysis KW - Migration KW - W 30960:Bioinformatics & Computer Applications UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1823946516?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biochimica+et+Biophysica+Acta%3A+Proteins+and+Proteomics&rft.atitle=Opposing+influences+by+subsite+%26amp%3B%3B+minus%3B+1+and+subsite+%2B+1+residues+on+relative+xylopyranosidase%2Farabinofuranosidase+activities+of+bifunctional+I+super%282%29-D-xylosidase%2FI%2B%2F--L-arabin+ofuranosidase&rft.au=Jordan%2C+Douglas+B%3BBraker%2C+Jay+D&rft.aulast=Jordan&rft.aufirst=Douglas&rft.date=2011-12-01&rft.volume=1814&rft.issue=12&rft.spage=1648&rft.isbn=&rft.btitle=&rft.title=Biochimica+et+Biophysica+Acta%3A+Proteins+and+Proteomics&rft.issn=15709639&rft_id=info:doi/10.1016%2Fj.bbapap.2011.08.010 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2016-09-01 N1 - Last updated - 2016-10-12 N1 - SubjectsTermNotLitGenreText - Alanine; Inversion; glycosides; Probes; Enzymes; Arabinofuranosidase; proteomics; Migration; Hydrolysis; Mutation DO - http://dx.doi.org/10.1016/j.bbapap.2011.08.010 ER - TY - JOUR T1 - Production and Analysis of Fast Pyrolysis Oils from Proteinaceous Biomass AN - 1671358059; 16357153 AB - Fast pyrolysis of lignocellulosic biomass is a facile method for producing high yields of liquid fuel intermediates. However, because most fast pyrolysis oils are highly oxygenated, acidic, and unstable, identification of feedstocks that produce higher quality pyrolysis liquids is desirable. Therefore, the effect of feedstock protein content was studied by performing fast pyrolysis experiments on biomass with varying protein content. The feedstocks ranged from low-protein content, 5% up to feedstocks with >40 wt.% protein content. Protein content was not a major factor in the yield of pyrolysis oil or the distribution of biomass carbon into the pyrolysis products. However, elevated levels of protein did cause a deoxygenation effect in the pyrolysis process with more of the oxygen rejected from the biomass as water. The deoxygenation caused the pyrolysis oil from the higher protein containing biomass to have higher energy content. Furthermore, the concentration of basic nitrogen groups caused the pyrolysis oil from the higher protein biomass to shift to a more neutral pH and lower total acid number than has been measured typically for lignocelluloic biomass pyrolysis oils. Some of the pyrolysis oils, particularly those from the mustard seed family presscakes exhibited better thermal stability than low-protein pyrolysis oils. JF - BioEnergy Research AU - Mullen, Charles A AU - Boateng, Akwasi A AD - Eastern Regional Research Center, Agricultural Research Service, US Department of Agriculture, 600 E. Mermaid Lane, Wyndmoor, PA, 19038, USA Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 303 EP - 311 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 4 IS - 4 SN - 1939-1234, 1939-1234 KW - Mechanical & Transportation Engineering Abstracts (MT); Environmental Engineering Abstracts (EN); Electronics and Communications Abstracts (EA) KW - Pyrolysis KW - Deoxygenation KW - Carbon KW - Proteins KW - Feedstock KW - Biomass KW - pH KW - Liquids UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1671358059?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvironmentalengabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=BioEnergy+Research&rft.atitle=Production+and+Analysis+of+Fast+Pyrolysis+Oils+from+Proteinaceous+Biomass&rft.au=Mullen%2C+Charles+A%3BBoateng%2C+Akwasi+A&rft.aulast=Mullen&rft.aufirst=Charles&rft.date=2011-12-01&rft.volume=4&rft.issue=4&rft.spage=303&rft.isbn=&rft.btitle=&rft.title=BioEnergy+Research&rft.issn=19391234&rft_id=info:doi/10.1007%2Fs12155-011-9130-x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-06-01 N1 - Last updated - 2015-04-09 DO - http://dx.doi.org/10.1007/s12155-011-9130-x ER - TY - JOUR T1 - Rainfall and erosion response following a Southern California wildfire AN - 1637534908; 2014-103310 AB - Wildfire renders landscapes susceptible to flooding and accelerated surface erosion. Consumption of the vegetation canopy and the litter or duff layer removes resistances to the agents of erosion. Moreover, changes in soil properties can restrict infiltration, increasing the effectiveness of the driving forces of rainsplash and surface runoff. However, it is unclear whether surface erosion varies linearly with rainfall amounts and intensities or if thresholds exist beyond which erosion increases in a different trajectory. The Santiago Fire burned over 11000 ha in northeastern Orange County, California in October 2007. The burn area consists of a deeply dissected mountain block underlain by sedimentary and metamorphic rocks that produce erosive soils. Regional erosion and sediment transport is triggered by winter cyclonic storms. Recording raingages were deployed across a vertical gradient within the burned area and silt fences were constructed to monitor hillslope erosion. During the study period initial storms were characterized by moderate rainfall (amounts less than 25 mm with peak 10-minute intensities of less than 10 mm per hr). Surface erosion was concomitantly minor, less than 0.4 Mg per ha. However, an unusual thunderstorm in late May 2008 produced spatially variable rainfall and consequent surface erosion across the study area. The raingage at a lower elevation site measured 41.4 mm of rain for this storm with a peak 10-minute intensity of 81 mm per hr. The silt fences were overtopped, yielding a minimum value of 18.5 Mg per ha. In contrast, the raingage at an upper elevation site recorded 19.6 mm of rain with a peak 10-minute intensity of 50 mm per hr. Surface erosion in the higher elevation sites was negligible (0.1 Mg per ha). Subsequently, individual storms exceeded 100 mm of rainfall but peak 10-minute intensities never approached those of the May thunderstorm. Erosion was moderate (mostly less than 5 Mg per ha), albeit influenced by the presence of regrowing vegetation. We therefore believe that surface erosion in the immediate postfire environment is more related to storm intensity than rainfall amount. Even allowing for site-to-site differences and site changes over the first postfire winter season, it is clear that some threshold in erosion response was crossed at the lower elevation sites during the May 2008 thunderstorm. We suggest that this represents a threshold of peak 10-minute intensity of between 50 and 80 mm per hr. JF - American Geophysical Union Fall Meeting AU - Wohlgemuth, P M AU - Robichaud, P R AU - Brown, R E AU - Anonymous Y1 - 2011/12// PY - 2011 DA - December 2011 SP - Abstract H31B EP - 1140 PB - American Geophysical Union, Washington, DC VL - 2011 KW - United States KW - hydrology KW - gauging KW - erosion KW - rainfall KW - Orange County California KW - atmospheric precipitation KW - erosion rates KW - vegetation KW - fires KW - California KW - Southern California KW - infiltration KW - runoff KW - 21:Hydrogeology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1637534908?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+Geophysical+Union+Fall+Meeting&rft.atitle=Rainfall+and+erosion+response+following+a+Southern+California+wildfire&rft.au=Wohlgemuth%2C+P+M%3BRobichaud%2C+P+R%3BBrown%2C+R+E%3BAnonymous&rft.aulast=Wohlgemuth&rft.aufirst=P&rft.date=2011-12-01&rft.volume=2011&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=American+Geophysical+Union+Fall+Meeting&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 2011 fall meeting N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. Reference includes data supplied by, and/or abstract, Copyright, American Geophysical Union, Washington, DC, United States N1 - Date revised - 2014-01-01 N1 - PubXState - DC N1 - Last updated - 2014-12-18 N1 - CODEN - #07548 N1 - SubjectsTermNotLitGenreText - atmospheric precipitation; California; erosion; erosion rates; fires; gauging; hydrology; infiltration; Orange County California; rainfall; runoff; Southern California; United States; vegetation ER - TY - JOUR T1 - Temporal scaling of episodic point estimates of seed predation to long-term predation rates AN - 1529948791; 19804202 AB - 1. Post-dispersal seed predation influences plant population dynamics in many terrestrial ecosystems, including weeds in arable systems, the focus of this study. Simulation models of management effects on weed demography require estimates of long-term seed predation as input, yet extremely rapid seed losses to predators force most measurements of weed seed predation rates to be made at a daily time-scale. 2. We compared several models for estimating , the annual proportion of weed seeds consumed by granivores, from repeated short-term seed predation measurements. Competing models differed in duration of seed exposure to predators and weighting of short-term predation rates by concurrent seed rain. Verification data were obtained from field studies at experimental locations in Germany and the USA in which parallel measurements of short- and long-term weed seed predation were made in cereal crops. 3. Robust predictions of were given by a model that exposed seeds to predators for two 48-h predation intervals, with no weighting of predation rates by seed rain. Model performance was consistent across locations, years, weed species and predator type. Resampling indicated that high temporal sampling intensity was critical to model performance and should be prioritised over high levels of spatial replication. 4. Estimates of made from our experimental data and 10 published time series of short-term weed seed predation rates followed a normal distribution with mu =0.52 and sigma super(2)=0.05. Additional work is necessary to assess applicability of the predictive model to seed predation time series from natural systems. 5. Synthesis and applications: Our results demonstrate that annual rates of weed seed predation may be reliably predicted from repeated short-term predation measurements. Predicted values may then be used in applied demographic models. At a more fundamental level, these results indicate that weed seed predation in arable fields is an episodic process, in which newly dispersed seeds are subjected to brief, intense predation, after which they become unavailable to granivores because of burial. Future efforts at managing agroecosystems to promote weed seed predation may benefit by viewing the process as dynamic and ephemeral. JF - Methods in Ecology and Evolution AU - Davis, Adam S AU - Daedlow, Daniel AU - Schutte, Brian J AU - Westerman, Paula R AD - USDA-ARS, Global Change and Photosynthesis Research Unit, Urbana, IL 61801, USA. Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 682 EP - 890 PB - Wiley-Blackwell, Baffins Lane Chichester W. Sussex PO19 1UD United Kingdom VL - 2 IS - 6 SN - 2041-210X, 2041-210X KW - Ecology Abstracts KW - demographic models KW - goodness-of-fit KW - granivory KW - model verification KW - multi-scale processes KW - seed burial KW - weed seedbanks KW - Weeds KW - Seeds KW - Data processing KW - Seed predation KW - Replication KW - Predation KW - Predators KW - Population dynamics KW - Crops KW - Models KW - Demography KW - Terrestrial ecosystems KW - Cereals KW - Sampling KW - Rain KW - Scaling KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1529948791?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Methods+in+Ecology+and+Evolution&rft.atitle=Temporal+scaling+of+episodic+point+estimates+of+seed+predation+to+long-term+predation+rates&rft.au=Davis%2C+Adam+S%3BDaedlow%2C+Daniel%3BSchutte%2C+Brian+J%3BWesterman%2C+Paula+R&rft.aulast=Davis&rft.aufirst=Adam&rft.date=2011-12-01&rft.volume=2&rft.issue=6&rft.spage=682&rft.isbn=&rft.btitle=&rft.title=Methods+in+Ecology+and+Evolution&rft.issn=2041210X&rft_id=info:doi/10.1111%2Fj.2041-210X.2011.00119.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-05-01 N1 - Last updated - 2016-08-03 N1 - SubjectsTermNotLitGenreText - Weeds; Seeds; Data processing; Seed predation; Replication; Predation; Predators; Population dynamics; Crops; Models; Demography; Terrestrial ecosystems; Cereals; Rain; Sampling; Scaling DO - http://dx.doi.org/10.1111/j.2041-210X.2011.00119.x ER - TY - JOUR T1 - Two-dimensional proteome reference maps for the soybean cyst nematode Heterodera glycines AN - 1529924052; 19893062 AB - 2-DE reference maps of Heterodera glycines were constructed. After in-gel digestion with trypsin, 803 spots representing 426 proteins were subsequently identified by LC-MS/MS. Proteins with annotated function were further categorized by Gene Ontology. The results showed that proteins involved in metabolic, developmental and biological regulation processes were the most abundant. JF - Proteomics AU - Chen, Xi AU - MacDonald, Margaret H AU - Khan, Farooq AU - Garrett, Wesley M AU - Matthews, Benjamin F AU - Natarajan, Savithiry S AD - USDA-ARS, Soybean Genomics and Improvement Laboratory, PSI, Beltsville, MD, USA. Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 4742 EP - 4746 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 11 IS - 24 SN - 1615-9853, 1615-9853 KW - Biotechnology and Bioengineering Abstracts KW - Heterodera glycines KW - Trypsin KW - Glycine KW - proteomics KW - Cysts KW - Nematoda KW - Gene mapping KW - Soybeans KW - W 30960:Bioinformatics & Computer Applications UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1529924052?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Proteomics&rft.atitle=Two-dimensional+proteome+reference+maps+for+the+soybean+cyst+nematode+Heterodera+glycines&rft.au=Chen%2C+Xi%3BMacDonald%2C+Margaret+H%3BKhan%2C+Farooq%3BGarrett%2C+Wesley+M%3BMatthews%2C+Benjamin+F%3BNatarajan%2C+Savithiry+S&rft.aulast=Chen&rft.aufirst=Xi&rft.date=2011-12-01&rft.volume=11&rft.issue=24&rft.spage=4742&rft.isbn=&rft.btitle=&rft.title=Proteomics&rft.issn=16159853&rft_id=info:doi/10.1002%2Fpmic.201100220 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-05-01 N1 - Last updated - 2014-06-12 N1 - SubjectsTermNotLitGenreText - Trypsin; Glycine; proteomics; Cysts; Soybeans; Gene mapping; Heterodera glycines; Nematoda DO - http://dx.doi.org/10.1002/pmic.201100220 ER - TY - JOUR T1 - Antibacterial activities of magnesium oxide (MgO) nanoparticles against foodborne pathogens AN - 1439235725; 18524359 AB - The antibacterial activities of magnesium oxide nanoparticles (MgO NP) alone or in combination with other antimicrobials (nisin and ZnO NP) against Escherichia coli O157:H7 and Salmonella Stanley were investigated. The results show that MgO NP have strong bactericidal activity against the pathogens, achieving more than 7 log reductions in bacterial counts. The antibacterial activity of MgO NP increased as the concentrations of MgO increased. A synergistic effect of MgO in combination with nisin was observed as well. However, the addition of ZnO NP to MgO NP did not enhance the antibacterial activity of MgO against both pathogens. Scanning electron microscopy was used to characterize the morphological changes of E. coli O157:H7 before and after antimicrobial treatments. It was revealed that MgO NP treatments distort and damage the cell membrane, resulting in a leakage of intracellular contents and eventually the death of bacterial cells. These results suggest that MgO NP alone or in combination with nisin could potentially be used as an effective antibacterial agent to enhance food safety. JF - Journal of Nanoparticle Research AU - Jin, Tony AU - He, Yiping AD - Residue Chemistry and Predictive Microbiology Research Unit, U.S. Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, 600 East Mermaid Lane, Wyndmoor, PA, 19038, USA, tony.jin@ars.usda.gov Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 6877 EP - 6885 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 13 IS - 12 SN - 1388-0764, 1388-0764 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts B: Bacteriology KW - Scanning electron microscopy KW - Leakage KW - Antibacterial activity KW - Food KW - Pathogens KW - Antimicrobial agents KW - Cell membranes KW - Nisin KW - Escherichia coli KW - oxides KW - Antibacterial agents KW - Magnesium KW - Salmonella KW - Bactericidal activity KW - nanoparticles KW - A 01330:Food Microbiology KW - J 02340:Antibiotics & Antimicrobials UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1439235725?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Nanoparticle+Research&rft.atitle=Antibacterial+activities+of+magnesium+oxide+%28MgO%29+nanoparticles+against+foodborne+pathogens&rft.au=Jin%2C+Tony%3BHe%2C+Yiping&rft.aulast=Jin&rft.aufirst=Tony&rft.date=2011-12-01&rft.volume=13&rft.issue=12&rft.spage=6877&rft.isbn=&rft.btitle=&rft.title=Journal+of+Nanoparticle+Research&rft.issn=13880764&rft_id=info:doi/10.1007%2Fs11051-011-0595-5 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-10-01 N1 - Last updated - 2015-03-20 N1 - SubjectsTermNotLitGenreText - Scanning electron microscopy; Leakage; Antibacterial activity; Food; Pathogens; Antimicrobial agents; Cell membranes; Nisin; oxides; Magnesium; Antibacterial agents; nanoparticles; Bactericidal activity; Escherichia coli; Salmonella DO - http://dx.doi.org/10.1007/s11051-011-0595-5 ER - TY - JOUR T1 - Revivification of a method for identifying longleaf pine timber and its application to southern pine relicts in southeastern Virginia AN - 1434032847; 18512757 AB - Longleaf pine (Pinus palustris Mill.) cannot be distinguished from the other southern pines based on wood anatomy alone. A method that involves measuring pith and second annual ring diameters, reported by Arthur Koehler in 1932 (The Southern Lumberman, 145: 36-37), was revisited as an option for identifying longleaf pine timbers and stumps. Cross-section disks of longleaf, loblolly (Pinus taeda L.), and shortleaf (Pinus echinata Mill.) pines were measured and the diameters of their piths and second annual rings plotted against each other. From this plot, longleaf pine could be differentiated from the other two southern pine species, demonstrating that a method established with trees harvested more than 70 years ago is still applicable to standing timber of today. No evidence was found to suggest that different growth rates impact method applicability. In those situations where the second annual ring is intact, but not the pith, very large second annual ring diameters (>40 mm) may identify timbers with a lower probability of being longleaf pine. In addition to the identification of very old lightwood stumps as part of a longleaf pine restoration effort, both methods may be applied to timber identification in historic structures and the niche forest products industry involving the recovery and processing of highly prized longleaf pine logs from river bottoms. Measurements from relicts sampled in this study were consistent with the purported range for longleaf pine in Virginia.Original Abstract: On ne peut pas distinguer le pin des marais (Pinus palustris Mill.) des autres pins du Sud seulement sur la base des caracteristiques anatomiques du bois. Une methode qui consiste a mesurer les diametres de la moelle et du deuxieme cerne annuel, rapportee par Arthur Koehler en 1932 (The Southern Lumberman, 145: 36-37), a ete reexaminee a titre d'alternative pour identifier le bois et les souches de pin des marais. Des sections radiales de pin des marais, de pin a encens (Pinus taeda L.) et de pin a courtes feuilles (Pinus echinata Mill.) on ete mesurees et les diametres de la moelle et du deuxieme cerne annuel ont ete compares a l'aide d'un graphique. Le pin des marais pouvait etre distingue des deux autres especes de pin du Sud sur ce graphique demontrant qu'une methode mise au point a partir d'arbres recoltes il y a plus de 70 ans est encore applicable au bois sur pied aujourd'hui. Nous n'avons trouve aucun indice permettant de croire qu'une difference de taux de croissance a un impact sur l'applicabilite de la methode. Dans le cas ou le deuxieme cerne annuel est intact, mais pas la moelle, un deuxieme cerne annuel de tres grand diametre (>40 mm) peut indiquer qu'il s'agit de bois qui a une plus faible probabilite d'etre du pin des marais. En plus de l'identification de tres vieilles souches de bois gras associee a l'effort de restauration du pin des marais, les deux methodes peuvent etre appliquees pour l'identification du bois dans les structures historiques et la niche de l'industrie des produits du bois qui implique la recuperation et le traitement des billes tres prisees de pin des marais provenant du fond des rivieres. Les mesures des reliques echantillonnees dans cette etude correspondent a l'intervalle presume pour le pin des marais en Virginie. JF - Canadian Journal of Forest Research/Revue Canadienne de Recherche Forestiere AU - Eberhardt, Thomas L AU - Sheridan, Philip M AU - Bhuta, Arvind AR AD - USDA Forest Service, Southern Research Station, 2500 Shreveport Highway, Pineville, LA 71360, USA., teberhardt@fs.fed.us Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2440 EP - 2447 PB - NRC Research Press VL - 41 IS - 12 SN - 0045-5067, 0045-5067 KW - Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Environment Abstracts; Water Resources Abstracts; Ecology Abstracts KW - Forest products KW - Historical account KW - Trees KW - Cross-sections KW - Niches KW - Forests KW - Anatomy KW - Restoration KW - Pinus echinata KW - Mills KW - Pinus palustris KW - Rivers KW - Growth rate KW - Pinus taeda KW - Pine Trees KW - Industrial products KW - Wood KW - USA, Virginia KW - Growth Rates KW - Hardwood KW - Annual rings KW - Methodology KW - AQ 00001:Water Resources and Supplies KW - SW 5010:Network design KW - Q2 09123:Conservation KW - ENA 21:Wildlife KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1434032847?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.atitle=Revivification+of+a+method+for+identifying+longleaf+pine+timber+and+its+application+to+southern+pine+relicts+in+southeastern+Virginia&rft.au=Eberhardt%2C+Thomas+L%3BSheridan%2C+Philip+M%3BBhuta%2C+Arvind+AR&rft.aulast=Eberhardt&rft.aufirst=Thomas&rft.date=2011-12-01&rft.volume=41&rft.issue=12&rft.spage=2440&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.issn=00455067&rft_id=info:doi/10.1139%2Fx11-156 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-09-01 N1 - Number of references - 30 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Growth rate; Niches; Industrial products; Forests; Restoration; Methodology; Rivers; Forest products; Trees; Annual rings; Historical account; Wood; Anatomy; Mills; Cross-sections; Pine Trees; Growth Rates; Hardwood; Pinus echinata; Pinus taeda; Pinus palustris; USA, Virginia DO - http://dx.doi.org/10.1139/x11-156 ER - TY - JOUR T1 - Secondary insects and diseases contribute to sudden aspen decline in southwestern Colorado, USA AN - 1434032742; 18512742 AB - Reports of drought-associated forest mortality have increased around the world, but the mechanisms of mortality are rarely direct in nature. Biotic agents may kill trees that could otherwise recover and can perpetuate and expand mortality after the stress is relieved. Sudden aspen decline (SAD) has caused rapid, widespread branch dieback and mortality of quaking aspen (Populus tremuloides Michx.). We compared insects and diseases in 162 damaged and neighboring healthy plots to determine contributing factors and their ecological roles. Cytospora canker, bronze poplar borer, and aspen bark beetles were the most common agents in damaged plots and correlated with crown loss and other factors related to SAD. This was the first documented outbreak of Trypophloeus populi, an aspen bark beetle. As bark beetles and bronze poplar borer increased in damaged stands, they tended to attack trees with healthier crowns. Environmental stress may have directly affected the success of these agents by increasing host susceptibility followed by a density-dependent increase in the insects' invasive ability. In contrast, Cytospora canker had an identical relationship to crown loss in healthy versus damaged plots, suggesting that it was not limited by inoculum but responded to host susceptibility. Most other pathogens and insects contributed little to SAD and appear to be primary or weakening agents. The biotic agents of mortality in a decline differ greatly from primary agents and play complex and varied roles in healthy versus declining stands.Original Abstract: Les rapports de mortalite des forets associee a la secheresse ont augmente partout dans le monde mais les mecanismes responsables de la mortalite sont rarement de nature directe. Des agents biotiques peuvent tuer des arbres qui pourraient par ailleurs recuperer et peuvent perpetuer et augmenter la mortalite apres que le stress soit disparu. Le deperissement soudain du tremble (DST) est responsable de la mort en cime et de la mortalite rapide et generalisee du peuplier faux-tremble (Populus tremuloides Michx.). Nous avons compare les maladies et les insectes presents dans 162 placettes touchees par le deperissement appariees a des placettes saines avoisinantes pour determiner les facteurs contribuants et leurs roles ecologiques. Le chancre cytosporeen, l'agrile du peuplier et les scolytes du tremble etaient les agents les plus frequents dans les placettes touchees par le deperissement et ils etaient correles avec la mort en cime et d'autres facteurs relies au DST. Il s'agissait de la premiere epidemie documentee de Trypophloeus populi, un scolyte du tremble. A mesure que les populations de scolytes du tremble et d'agrile du peuplier augmentaient dans les peuplements touches par le deperissement, ces insectes avaient tendance a s'attaquer a des arbres dont la cime etait plus saine. Un stress environnemental pourrait avoir directement influence le succes de ces agents en provoquant une augmentation de la sensibilite de l'hote, suivie d'une augmentation de la capacite invasive des insectes qui serait dependante de la densite. Au contraire, le chancre cytosporeen avait la meme relation avec la mort en cime que les placettes soient touchees ou non par le deperissement, ce qui indique que son incidence ne depend pas de la quantite d'inoculum mais plutot de la sensibilite de l'hote. La plupart des autres pathogenes et insectes contribuaient peu au DST et semblent etre des agents primaires ou qui affaiblissent leur hote. Les causes biotiques de mortalite dans le cas du deperissement different grandement des agents primaires et jouent des roles complexes et varies dans les peuplements sains comparativement aux peuplements qui deperissent. JF - Canadian Journal of Forest Research/Revue Canadienne de Recherche Forestiere AU - Marchetti, Suzanne Bethers AU - Worrall, James J AU - Eager, Thomas AD - USDA Forest Service, Rocky Mountain Region, Forest Health Protection, 216 N. Colorado Street, Gunnison, CO 81230, USA., sbmarchetti@fs.fed.us Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2315 EP - 2325 PB - NRC Research Press VL - 41 IS - 12 SN - 0045-5067, 0045-5067 KW - Entomology Abstracts; Environment Abstracts; Sustainability Science Abstracts; Ecology Abstracts KW - Canker KW - Scolytidae KW - Trees KW - Forests KW - Branches KW - Inoculum KW - Environmental stress KW - Borers KW - Mortality KW - Dieback KW - Cytospora KW - Stress KW - Bark KW - Pathogens KW - Pest outbreaks KW - Insects KW - USA, Colorado KW - Outbreaks KW - Populus tremuloides KW - Z 05300:General KW - M3 1010:Issues in Sustainable Development KW - ENA 21:Wildlife KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1434032742?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.atitle=Secondary+insects+and+diseases+contribute+to+sudden+aspen+decline+in+southwestern+Colorado%2C+USA&rft.au=Marchetti%2C+Suzanne+Bethers%3BWorrall%2C+James+J%3BEager%2C+Thomas&rft.aulast=Marchetti&rft.aufirst=Suzanne&rft.date=2011-12-01&rft.volume=41&rft.issue=12&rft.spage=2315&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.issn=00455067&rft_id=info:doi/10.1139%2Fx11-106 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-09-01 N1 - Number of references - 42 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Canker; Mortality; Dieback; Branches; Trees; Inoculum; Forests; Environmental stress; Pathogens; Pest outbreaks; Borers; Stress; Bark; Outbreaks; Insects; Scolytidae; Cytospora; Populus tremuloides; USA, Colorado DO - http://dx.doi.org/10.1139/x11-106 ER - TY - JOUR T1 - A mixed-modes approach for estimating hiking on trails through diverse forest landscapes: the case of the Appalachian Trail AN - 1434030938; 18512753 AB - Many hiking trails traverse the forests and public lands across North America. It has therefore become important for federal management to gain an understanding of total use on these trails. However, there has never been a formal attempt to estimate hiking on these long, backcountry trails. This paper presents an approach that utilizes two survey instruments (exit-site tallies and a trail-user questionnaire) and two primary estimation components (standard and augmented sites) to estimate hikers over a spatial and temporal span. For illustrative purposes, the methodology is applied to a 175 km segment of the Appalachian Trail from 1 June through 14 August 2007. Two alternative estimation methodologies are presented and compared. The model-based approach may be preferred to the design-based approach when sample size is small because it smoothes erratic strata estimates and yields smaller standard errors. However, the design-based approach relaxes an assumption and is more appropriate as sample size increases. In our survey of the Appalachian Trail, there was a 5.6% difference between the visitation estimates based on these two approaches, and such stability reinforces confidence in the methodology.Original Abstract: Plusieurs sentiers de randonnee pedestre traversent les forets et les terres publiques partout en Amerique du Nord. Il est par consequent devenu important pour la gestion federale d'acquerir une comprehension de l'utilisation totale de ces sentiers. Cependant, il n'y a jamais eu de tentative formelle pour estimer la randonnee pedestre dans ces longs sentiers d'arriere-pays. Cet article presente une approche qui utilise deux instruments de sondage (des releves de sortie du site et un questionnaire destine aux utilisateurs des sentiers) pour estimer les randonneurs pedestres sur un horizon temporel et spatial. A titre d'exemple, la methodologie a ete appliquee a un segment de 175 km du sentier des Appalaches du 1 juin au 14 aout 2007. Deux methodes alternatives d'estimation sont presentees et comparees. L'approche basee sur un modele peut etre preferable a l'approche basee sur un plan lorsque la taille de l'echantillon est petite parce qu'elle adoucit les estimations des strates irregulieres et produit de plus petits ecarts types. Cependant, l'approche basee sur un plan assouplit une hypothese et est plus appropriee a mesure que la taille de l'echantillon augmente. Dans notre enquete sur le sentier des Appalaches, il y avait un ecart de 5,6 % entre les estimations de frequentation basees sur les deux approches et une telle stabilite renforce la confiance dans la methodologie. JF - Canadian Journal of Forest Research/Revue Canadienne de Recherche Forestiere AU - Zarnoch, Stanley J AU - Bowker, J M AU - Cordell, HKen AD - USDA Forest Service, Asheville, NC 28804, USA., szarnoch@fs.fed.us Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2346 EP - 2358 PB - NRC Research Press VL - 41 IS - 12 SN - 0045-5067, 0045-5067 KW - Environment Abstracts; Ecology Abstracts KW - Inventories KW - Landscape KW - Forests KW - Public lands KW - Hiking KW - ENA 07:General KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1434030938?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.atitle=A+mixed-modes+approach+for+estimating+hiking+on+trails+through+diverse+forest+landscapes%3A+the+case+of+the+Appalachian+Trail&rft.au=Zarnoch%2C+Stanley+J%3BBowker%2C+J+M%3BCordell%2C+HKen&rft.aulast=Zarnoch&rft.aufirst=Stanley&rft.date=2011-12-01&rft.volume=41&rft.issue=12&rft.spage=2346&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.issn=00455067&rft_id=info:doi/10.1139%2Fx11-147 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-09-01 N1 - Number of references - 37 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Inventories; Landscape; Forests; Public lands; Hiking DO - http://dx.doi.org/10.1139/x11-147 ER - TY - JOUR T1 - Overstory and understory relationships in longleaf pine plantations 14 years after thinning and woody control AN - 1434030686; 18512748 AB - To develop silvicultural strategies for restoring longleaf pine (Pinus palustris Mill.) savannas, mortality and growth of overstory pines and midstory hardwoods and abundance and species richness of herbs were studied for 14 years after pine thinning and nonpine woody control. Pine cover in thinned stands was about half of that in nonthinned stands through year 5, but it lagged by only 8% and 3% in years 9 and 14, respectively, because of vigorous crown responses. Despite a cumulative mortality of 64% of hardwood stems from prescribed fires in years 0, 4, and 9, hardwood basal area in thinned stands (2.1 m super(2).ha super(-1)) was three times that in nonthinned stands (0.7 m super(2).ha super(-1)) in year 14. Thinning was associated with 13%-22% more cover and six to eight more species of herbs in years 3-8 but only 6% more cover and two more species in year 14 because of accelerated growth of pine cover and hardwood basal area. However, similar increases in cover and richness of herb species in the woody control treatment were retained through year 14 because it had sustained reductions in hardwood and shrub abundance. Silvicultural strategies that substantially delay encroachment by pines, hardwoods, and shrubs will be those most effective at retaining herb species in longleaf pine savannas, including planting pines at wide spacing, periodic thinning and woody control, and frequent burning.Original Abstract: Pour mettre au point des strategies sylvicoles visant a restaurer les savanes de pin des marais (Pinus palustris Mill.), la mortalite et la croissance des pins de l'etage dominant et des feuillus de l'etage intermediaire de meme que l'abondance et la richesse en especes des plantes herbacees ont ete etudiees pendant les 14 annees qui ont suivi une eclaircie du pin et la maitrise de la vegetation ligneuse autre que le pin. Le couvert de pin des peuplements eclaircis etait environ la moitie de celui des peuplements non eclaircis apres 5 ans, mais l'ecart etait seulement de 8% apres 9 ans et de 3% apres 14 ans a cause d'une reaction vigoureuse des cimes. Malgre une mortalite cumulative de 64% des tiges feuillues a la suite de brulages diriges appliques aux annees 0, 4 et 9, la surface terriere en feuillus des peuplements eclaircis (2,1 m super(2).ha super(-1)) etait trois fois superieure a celle des peuplements non eclaircis (0,7 m super(2).ha super(-1)) apres 14 ans. L'eclaircie etait associee a des hausses de 13% a 22% du couvert herbace et a six a huit especes herbacees de plus pendant les annees 3 a 8, mais ces valeurs sont passees a seulement 6% du couvert herbace et deux especes de plus apres 14 ans a cause d'une acceleration de la croissance du couvert de pin et de la surface terriere en feuillus. Cependant, des augmentations similaires en couvert et richesse en especes herbacees ont ete observees dans le traitement de maitrise de la vegetation ligneuse a l'annee 14 parce que ce traitement a reduit l'abondance des feuillus et des arbustes. Les strategies sylvicoles qui retardent substantiellement l'etablissement des pins, des feuillus et des arbustes seront les plus efficaces a retenir les especes herbacees dans les savanes de pin des marais. De tels traitements incluent la plantation de pins a grand espacement, des eclaircies et des traitements periodiques de maitrise de la vegetation, et de frequents brulages diriges. JF - Canadian Journal of Forest Research/Revue Canadienne de Recherche Forestiere AU - Harrington, Timothy B AD - Pacific Northwest Research Station, USDA Forest Service, 3625 93rd Avenue Southwest, Olympia, WA 98512-9193, USA. Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2301 EP - 2314 PB - NRC Research Press VL - 41 IS - 12 SN - 0045-5067, 0045-5067 KW - Sustainability Science Abstracts; Ecology Abstracts KW - Abundance KW - Hardwoods KW - Silviculture KW - Savannahs KW - Planting KW - Pinus palustris KW - Herbs KW - Understory KW - Species richness KW - Shrubs KW - Fires KW - Mortality KW - Plantations KW - Thinning KW - Burning KW - M3 1010:Issues in Sustainable Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1434030686?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.atitle=Overstory+and+understory+relationships+in+longleaf+pine+plantations+14+years+after+thinning+and+woody+control&rft.au=Harrington%2C+Timothy+B&rft.aulast=Harrington&rft.aufirst=Timothy&rft.date=2011-12-01&rft.volume=41&rft.issue=12&rft.spage=2301&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.issn=00455067&rft_id=info:doi/10.1139%2Fx11-140 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-09-01 N1 - Number of references - 43 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Shrubs; Mortality; Fires; Abundance; Plantations; Hardwoods; Thinning; Savannahs; Silviculture; Planting; Burning; Herbs; Species richness; Understory; Pinus palustris DO - http://dx.doi.org/10.1139/x11-140 ER - TY - JOUR T1 - Everything you wanted to know about slope-area analysis * but were afraid to ask AN - 1316413724; 638186-78 AB - In the 1990's, the widespread availability of geographic information systems (GIS) and digital elevation models (DEMs) produced a flood of data describing landscapes, and slope-area analysis was used to reduce this torrent to a trickle of information about the processes shaping the landscape. At its most extreme, slope-area analysis reduces the landscape to a single line in a log-log plot of drainage area and local slope. Slope-area analysis has been used to display the landscape, divide it into process domains, and predict the location and movement of channel heads. However, slope-area analysis rests upon certain key assumptions (e.g. drainage area is linearly related to discharge) which may not be accurate in small, steep mountain basins, and some of the hypotheses generated within the context of slope-area plots may not apply outside of these graphs in the observed landscape. Some of the questions that should be asked about slope-area analysis: --Are drainage area and discharge really interchangeable across the entire landscape? --Are process and form uniquely related in slope-area plots? Can different landscape forms result from the same process? Or can one process occur in a variety of landscape forms? Can climatic changes lead to legacy landscapes that were carved by historic processes different than the modern processes? --Can an entire landscape be accurately decomposed to a single line and mechanistically interpreted? -- How do theoretical predictions (e.g. channel head locations or sediment transport laws) in slope-area plots transfer to an observed landscape that only occupies a limited portion of the slope-area space diagram? We answered some of these questions through analysis of surveys of steep, mountain channels and hillslopes that produced debris flows in the semi-arid mountains of southwest Idaho. We found two distinct slope-area trends in the debris flow initiation zone. These trends were associated with differently shaped basins that may control the concentration or dissipation of the peak discharge and leads to two different relationships between drainage area and discharge. These two distinct trends are obscured when the entire basin is decomposed into a single line in a slope-area plot through log-bin averaging, and the resulting line is a blend of the two trends. In addition to multiple forms resulting from a single process, we also observed a single process occurring in areas with multiple forms. In particular, we observed debris-flow erosion in the diffusive, fluvial, and debris flow process domains (as predicted by their trends in slope-area plots). We also found that the observed trends of the location of channel heads in slope-area plots is determined by the slope-area trend of the underlying landscape rather than by trends predicted by theoretical threshold relationships of sediment transport. Slope-area analysis provides a specific view of the landscape. This perspective may help to elucidate fundamental aspects of landscapes, but certain questions should be asked to ensure the applicability of slope-area analysis to a particular landscape and the accuracy of its predictions. JF - American Geophysical Union Fall Meeting AU - Welcker, C AU - Buffington, J M AU - McKean, J A Y1 - 2011/12// PY - 2011 DA - December 2011 SP - Abstract EP21C EP - 0715 PB - American Geophysical Union, Washington, DC VL - 2011 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1316413724?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefinprocess&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+Geophysical+Union+Fall+Meeting&rft.atitle=Everything+you+wanted+to+know+about+slope-area+analysis+*+but+were+afraid+to+ask&rft.au=Welcker%2C+C%3BBuffington%2C+J+M%3BMcKean%2C+J+A&rft.aulast=Welcker&rft.aufirst=C&rft.date=2011-12-01&rft.volume=2011&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=American+Geophysical+Union+Fall+Meeting&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 2011 fall meeting N1 - Copyright - GeoRef in Process, Copyright 2017, American Geosciences Institute. After editing and indexing, this record will be added to Georef. Reference includes data supplied by, and/or abstract, Copyright, American Geophysical Union, Washington, DC, United States N1 - PubXState - DC N1 - Last updated - 2017-01-24 N1 - CODEN - #07548 ER - TY - JOUR T1 - Beaver dam effects on gravel transport patterns - a case study AN - 1316399600; 638186-74 AB - Beaver dams are numerous in mountain streams, but little is known about gravel transport in those streams. The dams may be fully functioning and retain all incoming sediment or partially permeable to sediment or be almost completely removed. Beaver dams in their various states of preservation can have a profound influence on stream morphology and bedload transport. During the spring of 2011, the authors made a time series study of bedload transport in a mountain stream dominated by beavers dams. Dams occurred with a frequency of one every 50 feet and showed a range of decay and fluvial influence. Gravel transport was sampled with bedload traps over a 2-month long snowmelt highflow season. The reach-average gradient was 0.03 and stream widths ranged from 3 to 8 m. The stream bed was incised 0.5 to 1.5 m deep into a floodplain and typically trapezoidal in its cross-sectional shape. Much of the floodplain consisted of filled-in beaver dams. Partially breached dams that were permeable to gravel transport acted as an obstacle, forcing the flow around sharp bends. Complex hydraulic conditions developed in the vicinity of the bends with backwater eddies upstream and downstream of the remnant dam. Wake eddies at the downstream side of dam remnants caused gravel deposits. The tortuous channel course around the bends caused strong secondary currents that forced gravel transport into a narrow pathway along one of the banks causing a strong lateral concentration of transport. The pathway had a bed of fine and medium gravel, while the remainder of the bed consisted mostly of coarse gravel and cobbles that became immobile shortly after peak flows. Tracer experiments indicated that most of the mobile gravel traveled along that bankward path, even though flow velocities and depths were considerably smaller than in the stream center. Over the highflow season, flows increased to about 160% of the 1.5 year recurrence interval (Q (sub 1.5) ) within about a week and then remained within the range of 120-150% Q (sub 1.5) 5 for several weeks. During this time, gravel transport rates declined by three orders of magnitude, causing a pronounced hysteresis over the spring runoff season. The reason for the large hysteresis is attributed to the retention of gravel behind a mainly intact and impermeable beaver dam 700 ft above the study transect and subsequent limitation of bedload supply. Implications - gravel transport that is dominated by secondary flows around remnants of breached dams as well as by supply limitation below unbreached dams exhibits laterally concentrated gravel pathways and strong hysteresis effects, both of which make transport poorly predictable by conventional transport equations. Similarly, field measurements are problematic. Absent a season-long time series and full cross sectional measurements, results from occasional sampling within the highflow season probably cannot describe the relationship between flow and gravel transport rates. Given the large number of beaver-dominated streams, more studies on gravel transport and how it is affected by beaver dams would be useful. JF - American Geophysical Union Fall Meeting AU - Bunte, K AU - Swingle, K W AU - Potyondy, J P AU - Abt, S R Y1 - 2011/12// PY - 2011 DA - December 2011 SP - Abstract EP21C EP - 0711 PB - American Geophysical Union, Washington, DC VL - 2011 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1316399600?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefinprocess&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+Geophysical+Union+Fall+Meeting&rft.atitle=Beaver+dam+effects+on+gravel+transport+patterns+-+a+case+study&rft.au=Bunte%2C+K%3BSwingle%2C+K+W%3BPotyondy%2C+J+P%3BAbt%2C+S+R&rft.aulast=Bunte&rft.aufirst=K&rft.date=2011-12-01&rft.volume=2011&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=American+Geophysical+Union+Fall+Meeting&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 2011 fall meeting N1 - Copyright - GeoRef in Process, Copyright 2017, American Geosciences Institute. After editing and indexing, this record will be added to Georef. Reference includes data supplied by, and/or abstract, Copyright, American Geophysical Union, Washington, DC, United States N1 - PubXState - DC N1 - Last updated - 2017-01-24 N1 - CODEN - #07548 ER - TY - JOUR T1 - Evaluating the impact of conditional cash transfer programs on fertility: the case of the red de Protección social in Nicaragua AN - 1095629142; 4347419 AB - Evaluating the impact of poverty-reduction programs on fertility is complicated given that changes in incentives to have children take time to be incorporated into decision making and evaluation periods are usually quite brief. We explore the use of birth spacing as a short-run indicator of the impact of poverty-reduction programs on fertility. The data come from a Nicaraguan conditional cash transfer program that offers incentives for poor households to invest in children's health, nutrition, and education. We estimate a stratified Cox proportional hazard model and find that the program decreased the hazard of a birth, indicating an increase in birth spacing. Reprinted by permission of Springer JF - Journal of population economics AU - Todd, Jessica E AU - Winters, Paul AU - Stecklov, Guy AD - Economic Research Service, Washington DC ; American University Washington DC ; Hebrew University of Jerusalem Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 267 EP - 290 VL - 25 IS - 1 SN - 0933-1433, 0933-1433 KW - Economics KW - Decision making KW - Fertility KW - Nicaragua KW - Children KW - Transfer KW - Child health KW - Poverty alleviation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1095629142?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aibss&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+population+economics&rft.atitle=Evaluating+the+impact+of+conditional+cash+transfer+programs+on+fertility%3A+the+case+of+the+red+de+Protecci%C3%B3n+social+in+Nicaragua&rft.au=Todd%2C+Jessica+E%3BWinters%2C+Paul%3BStecklov%2C+Guy&rft.aulast=Todd&rft.aufirst=Jessica&rft.date=2011-12-01&rft.volume=25&rft.issue=1&rft.spage=267&rft.isbn=&rft.btitle=&rft.title=Journal+of+population+economics&rft.issn=09331433&rft_id=info:doi/10.1007%2Fs00148-010-0337-5 LA - English DB - International Bibliography of the Social Sciences (IBSS) N1 - Date revised - 2013-06-12 N1 - Last updated - 2013-09-16 N1 - SubjectsTermNotLitGenreText - 4869 3409 6306; 9963 9962; 3322 6071 1542 11325; 2212; 2199 5772; 12916; 288 84 14 DO - http://dx.doi.org/10.1007/s00148-010-0337-5 ER - TY - JOUR T1 - Using multilevel remote sensing and ground data to estimate forest biomass resources in remote regions: a case study in the boreal forests of interior Alaska AN - 1093459655; 17172676 AB - The emergence of a new generation of remote sensing and geopositioning technologies, as well as increased capabilities in image processing, computing, and inferential techniques, have enabled the development and implementation of increasingly efficient and cost-effective multilevel sampling designs for forest inventory. In this paper, we (i) describe the conceptual basis of multilevel sampling, (ii) provide a detailed review of several previously implemented multilevel inventory designs, (iii) describe several important technical considerations that can influence the efficiency of a multilevel sampling design, and (iv) demonstrate the application of a modem multilevel sampling approach for estimating the forest biomass resources in a remote area of interior Alaska. This approach utilized a combination of ground plots, Idiar strip sampling, satellite imagery (multispectral and radar), and classified land cover information. The variability in the total biomass estimate was assessed using a bootstrapping approach. The results indicated only marginal improvement in the precision of the total biomass estimate when the lidar sample was post-stratified using the classified land cover layer (reduction in relative standard error from 7.3% to 7.0%), whereas there was a substantial improvement in the precision when the estimate was based on the biomass map derived via nearest-neighbor imputation (reduction in relative standard error from 7.3% to 5.1%). JF - Canadian Journal of Remote Sensing/Journal Canadien de Teledetection AU - Andersen, H-E AU - Strunk, J AU - Temesgen, H AU - Atwood, D AU - Winterberger, K AD - Pacific Northwest Research Station, USDA Forest Service, Seattle, WA 98195, USA, handersen@fs.fed.us Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 596 EP - 611 PB - Canadian Aeronautics and Space Institute, 1685 Russell Rd, Unit 1R Ottawa ON K1G 0N1 Canada VL - 37 IS - 6 SN - 0703-8992, 0703-8992 KW - Meteorological & Geoastrophysical Abstracts; Sustainability Science Abstracts KW - USA, Alaska KW - Satellite design KW - Remote sensing KW - Forests KW - Lidar KW - Biomass KW - Satellites KW - Case studies KW - Forest biomass KW - Reviews KW - Economics KW - Lidar applications KW - Radar KW - M3 1010:Issues in Sustainable Development KW - M2 551.508:Instruments (551.508) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1093459655?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Remote+Sensing%2FJournal+Canadien+de+Teledetection&rft.atitle=Using+multilevel+remote+sensing+and+ground+data+to+estimate+forest+biomass+resources+in+remote+regions%3A+a+case+study+in+the+boreal+forests+of+interior+Alaska&rft.au=Andersen%2C+H-E%3BStrunk%2C+J%3BTemesgen%2C+H%3BAtwood%2C+D%3BWinterberger%2C+K&rft.aulast=Andersen&rft.aufirst=H-E&rft.date=2011-12-01&rft.volume=37&rft.issue=6&rft.spage=596&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Remote+Sensing%2FJournal+Canadien+de+Teledetection&rft.issn=07038992&rft_id=info:doi/10.5589%2Fm12-003 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-10-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Satellite design; Radar; Lidar applications; Remote sensing; Case studies; Forest biomass; Reviews; Economics; Lidar; Forests; Biomass; Satellites; USA, Alaska DO - http://dx.doi.org/10.5589/m12-003 ER - TY - JOUR T1 - Children's Participation in Multiple Food Assistance Programs: Changes from 1990 to 2009 AN - 1037876216; 201206038 AB - This study analyzes changes in the determinants of use of multiple food assistance (FA) programs by low-income children from 1990 to 2009. Using data from the 1990 and the 2008 panels of the Survey of Income and Program Participation, it compares very poor households with those that are poor and near poor. For both poverty groups, use of other welfare programs, especially Temporary Assistance for Needy Families, is found to be an important determinant of multiple FA program use, but the effects are found to decline over the study period. Volatility in household income-to-poverty ratios is also found to reduce both groups' participation in multiple programs, but this effect grows for the very poor over the length of the study. Very poor children in households with more employed and married adults are found to use fewer FA programs, although they are apparently eligible for these programs. Adapted from the source document. JF - Social Service Review AU - Newman, Constance AU - Todd, Jessica E AU - Ver Ploeg, Michele AD - Economist in the Food Economics Division, Food Assistance Branch, Economic Research Service of the US Department of Agriculture cnewman@ers.usda.gov Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 535 EP - 564 PB - University of Chicago Press, IL VL - 85 IS - 4 SN - 0037-7961, 0037-7961 KW - Low Income Groups KW - Participation KW - Poverty KW - Households KW - Welfare Services KW - Children KW - Child Care Services KW - Income KW - article KW - 6143: child & family welfare UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1037876216?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Asocialservices&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Social+Service+Review&rft.atitle=Children%27s+Participation+in+Multiple+Food+Assistance+Programs%3A+Changes+from+1990+to+2009&rft.au=Newman%2C+Constance%3BTodd%2C+Jessica+E%3BVer+Ploeg%2C+Michele&rft.aulast=Newman&rft.aufirst=Constance&rft.date=2011-12-01&rft.volume=85&rft.issue=4&rft.spage=535&rft.isbn=&rft.btitle=&rft.title=Social+Service+Review&rft.issn=00377961&rft_id=info:doi/ LA - English DB - Social Services Abstracts N1 - Date revised - 2014-02-21 N1 - Number of references - 6 N1 - Last updated - 2016-09-28 N1 - CODEN - SSRVAW N1 - SubjectsTermNotLitGenreText - Low Income Groups; Children; Participation; Households; Poverty; Child Care Services; Income; Welfare Services ER - TY - JOUR T1 - The Roles of Climate Variability and Habitat Heterogeneity in Structuring a Forested System: An Integrated Accumulation Function of Species Richness AN - 1034824788; 17046444 AB - As forested systems are impacted by both natural and anthropogenic factors such as climate change, the biodiversity supported by those forests is likely to change. Quantifying that change, however, remains a difficult task due to variations in the sizes and conditions of forested systems. Species accumulation curves are a commonly used tool to scale estimates of species richness and provide an avenue for comparing biodiversity among habitats through rarefaction. However, we found that the ranked biodiversity among forested systems depends on the sample unit used, and there is a need to integrate landscape heterogeneity in spatially scaleable estimates of biodiversity. Both of these biodiversity assessment issues can be addressed using a new approach we term the Integrated Accumulation Function (IAF), a method based on combining component species accumulation curves. Using this approach on communities of canopy arthropods found in pinyon pine forests in the southwestern United States, we found three major patterns. First, in small stands, trees growing under low environmental stress support the greatest species richness. Second, when stands are large, stands growing under higher environmental stress support greater species richness, and species richness is resilient to change over a broad range of the stress gradient. Third, there are threshold levels of stress at both ends of the stress spectrum beyond which species are rapidly lost. This analysis reveals unexpected patterns and suggests that conservation practices should consider the inclusion of forests growing under suboptimal conditions to maximize the preservation of biodiversity. JF - Journal of Sustainable Forestry AU - Trotter, RTalbot III AU - Whitham, Thomas G AD - Northeastern Research Station, USDA Forest Service, Hamden, Connecticut, USA Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 721 EP - 735 PB - Taylor & Francis Group Ltd., 2 Park Square Oxford OX14 4RN United Kingdom VL - 30 IS - 8 SN - 1054-9811, 1054-9811 KW - Sustainability Science Abstracts; Ecology Abstracts KW - arthropods KW - community KW - Pinus edulis KW - pinyon pine KW - species richness KW - Trees KW - Climate change KW - Climatic changes KW - Landscape KW - Biological diversity KW - Stress KW - Biodiversity KW - Forests KW - Habitat KW - USA KW - Arthropoda KW - Conservation KW - Environmental stress KW - Canopies KW - Preservation KW - Species richness KW - Forestry KW - M3 1010:Issues in Sustainable Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1034824788?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Sustainable+Forestry&rft.atitle=The+Roles+of+Climate+Variability+and+Habitat+Heterogeneity+in+Structuring+a+Forested+System%3A+An+Integrated+Accumulation+Function+of+Species+Richness&rft.au=Trotter%2C+RTalbot+III%3BWhitham%2C+Thomas+G&rft.aulast=Trotter&rft.aufirst=RTalbot&rft.date=2011-12-01&rft.volume=30&rft.issue=8&rft.spage=721&rft.isbn=&rft.btitle=&rft.title=Journal+of+Sustainable+Forestry&rft.issn=10549811&rft_id=info:doi/10.1080%2F10549811.2011.567963 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-08-01 N1 - Last updated - 2016-07-07 N1 - SubjectsTermNotLitGenreText - Trees; Landscape; Climatic changes; Conservation; Forests; Biodiversity; Environmental stress; Preservation; Canopies; Habitat; Species richness; Forestry; Climate change; Stress; Biological diversity; Arthropoda; USA DO - http://dx.doi.org/10.1080/10549811.2011.567963 ER - TY - JOUR T1 - U.S. Food Safety Policy Enters a New Era AN - 1030885141; 2011-219752 AB - In late 2010, Congress passed the Food safety Modernization Act (FSMA), the most comprehensive reforms to Federal food safety laws since 1928. The farm-to-fork, preventive approach embodied in the Act reflects an established scientific/managerial consensus on how to improve food safety systems. Economic research on similar food safety initiatives by industry and government can help guide implementation of the FSMA. Adapted from the source document. JF - Amber Waves AU - Hoffmann, Sandra Y1 - 2011/12// PY - 2011 DA - December 2011 SP - 24 EP - 37 PB - Economic Research Service, US Dept of Agriculture VL - 9 IS - 4 SN - 1545-8741, 1545-8741 KW - Health conditions and policy - Food and nutrition KW - Economic conditions and policy - Economic research KW - Law and ethics - Law and jurisprudence KW - United States Congress KW - Law KW - Food safety KW - Economic research KW - Legislation KW - article UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1030885141?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Apais&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Amber+Waves&rft.atitle=U.S.+Food+Safety+Policy+Enters+a+New+Era&rft.au=Hoffmann%2C+Sandra&rft.aulast=Hoffmann&rft.aufirst=Sandra&rft.date=2011-12-01&rft.volume=9&rft.issue=4&rft.spage=24&rft.isbn=&rft.btitle=&rft.title=Amber+Waves&rft.issn=15458741&rft_id=info:doi/ LA - English DB - PAIS Index N1 - Date revised - 2012-08-01 N1 - Last updated - 2016-09-28 N1 - SubjectsTermNotLitGenreText - Food safety; Economic research; Law; Legislation; United States Congress ER - TY - JOUR T1 - Extruded aquafeeds containing distillers dried grains with solubles: effects on extrudate properties and processing behaviour AN - 1020852160; 16688015 AB - BACKGROUND: The tremendous supply and low cost of distillers dried grains with solubles (DDGS) make it an attractive feedstuff for aquaculture diets. Also, several studies have shown that DDGS can be successfully fed to various finfish. The objective of this study was to evaluate the effects of inclusion rate of DDGS (0, 250, 500 g kg-1), feed moisture content (350, 450 g kg-1) and die opening area (die A = 18.85 mm2, die B = 3988.45 mm2) on the properties of the extrudates and on processing behaviour using a single-screw extruder. RESULTS: Increasing the inclusion rate of DDGS resulted in extrudates with lower unit density, bulk density, expansion ratio, water solubility index and brightness (Hunter L) but higher redness (Hunter a) and yellowness (Hunter b). The increase in moisture content affected the extrudate properties in different ways: it increased bulk density, Hunter L, Hunter b and mass flow rate, whereas specific mechanical energy decreased at high moisture content. Increasing the die opening area primarily decreased expansion ratio of extrudates, power consumption and barrel temperatures but increased mass flow rate. CONCLUSION: Extrudates from all treatments exhibited high durability and floatability, and less energy was required to produce extrudates when DDGS was used compared with soybean meal-based diets. The aquaculture industry can use this information to develop high-quality feeds at low cost. JF - Journal of the Science of Food and Agriculture AU - Mjoun, Kamal AU - Rosentrater, Kurt A Y1 - 2011/12// PY - 2011 DA - Dec 2011 SP - 2865 EP - 2874 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 91 IS - 15 SN - 1097-0010, 1097-0010 KW - Environment Abstracts; Water Resources Abstracts KW - Diets KW - Agriculture KW - Solubility KW - Density KW - Temperature KW - power consumption KW - Expansion KW - Aquaculture KW - Flow rates KW - Soybeans KW - Costs KW - Flow Rates KW - Moisture Content KW - Feeds KW - ENA 06:Food & Drugs KW - SW 0810:General UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1020852160?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+the+Science+of+Food+and+Agriculture&rft.atitle=Extruded+aquafeeds+containing+distillers+dried+grains+with+solubles%3A+effects+on+extrudate+properties+and+processing+behaviour&rft.au=Mjoun%2C+Kamal%3BRosentrater%2C+Kurt+A&rft.aulast=Mjoun&rft.aufirst=Kamal&rft.date=2011-12-01&rft.volume=91&rft.issue=15&rft.spage=2865&rft.isbn=&rft.btitle=&rft.title=Journal+of+the+Science+of+Food+and+Agriculture&rft.issn=10970010&rft_id=info:doi/10.1002%2Fjsfa.4536 L2 - http://onlinelibrary.wiley.com/doi/10.1002/jsfa.4536/abstract LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-06-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Agriculture; Diets; Temperature; power consumption; Aquaculture; Flow rates; Soybeans; Feeds; Costs; Solubility; Flow Rates; Density; Moisture Content; Expansion DO - http://dx.doi.org/10.1002/jsfa.4536 ER - TY - JOUR T1 - Synthesis of watershed and ecosystem responses to lehmann lovegrass invasion in a SE Arizona desert grassland watershed AN - 1008851254; 638157-102 AB - Compared to aridland systems that have undergone rapid change in dominant vegetation growth form, the responses of watershed and ecosystem processes to a shift in dominance of similar growth forms have not been well-studied. Following a prolonged drought period (2000-2005) at the Walnut Gulch Experimental Watershed's Kendall grassland site (WS#112), near Tombstone, AZ, strong summer monsoon rains in 2006 were accompanied by widespread mortality most native perennial grasses, a transient increase in annual forbs, followed by establishment and sustained dominance by a single perennial grass, the invasive bunchgrass, Lehmann lovegrass (Eragrostis lehmanniana). This loss of ecological diversity occurred across a watershed already instrumented for quantifying long-term climate, watershed, hill-slope, and ecosystem-level gas exchange processes. Salient findings from these data sets were: 1) annual watershed sediment discharge rapidly returned to pre-invasion levels following a large spike in 2006 that accounted for 65% of the total sediment yield summed over 35 years, 2) plot-level experimental runoff studies showed hill-slope sediment yields consistently doubled, as did growing season soil evaporation contributions to ET, and 3) the grassland was a carbon sink during dry conditions under lovegrass dominance. These findings show that while some aspects of overall watershed and ecosystem function were not strongly affected (i.e. sediment yield and net primary productivity), processes acting at lower spatial and temporal scales have been negatively impacted by lovegrass dominance. We believe these lower-order processes underlie the strong ecological effects associated with Lehmann lovegrass invasion, and will also eventually alter landform processes and change the basic ecohydrological characteristics of desert grassland watersheds. JF - American Geophysical Union Fall Meeting AU - Hamerlynck, E P AU - Scott, R L AU - Polyakov, V AU - Sugg, Z AU - Moran, S M AU - Stone, J AU - Nearing, M Y1 - 2011/12// PY - 2011 DA - December 2011 SP - Abstract B24C EP - 02 PB - American Geophysical Union, Washington, DC VL - 2011 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1008851254?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefinprocess&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=British+Journal+of+Sports+Medicine&rft.atitle=Personality+hardiness%2C+burnout+and+sport+competition+anxiety+among+athletics+and+wrestling+coaches&rft.au=Bawa%2C+Harmanpreet+Singh&rft.aulast=Bawa&rft.aufirst=Harmanpreet&rft.date=2010-09-01&rft.volume=44&rft.issue=&rft.spage=I57&rft.isbn=&rft.btitle=&rft.title=British+Journal+of+Sports+Medicine&rft.issn=03063674&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 2011 fall meeting N1 - Copyright - GeoRef in Process, Copyright 2017, American Geosciences Institute. After editing and indexing, this record will be added to Georef. Reference includes data supplied by, and/or abstract, Copyright, American Geophysical Union, Washington, DC, United States N1 - PubXState - DC N1 - Last updated - 2017-01-24 N1 - CODEN - #07548 ER - TY - JOUR T1 - Biotic-abiotic feedbacks in desertification: a modeling perspective on connectivity AN - 1008850362; 638157-105 AB - Shrub encroachment into perennial grasslands is a rapid and often irreversible state change observed in drylands throughout the world. It has been argued that changes to the length of connected pathways for the transport of soil resources by wind and water is a crucial part of this state change; aeolian and fluvial transport serves as key feedback mechanism in which bare unvegetated gaps allow increased transport, which promotes shrub growth and grass mortality, leading to a landscape with an increasing number and length of connected pathways that support increased rates of aeolian and fluvial transport. Here, we link a model of aeolian transport to an individual-based gap dynamics model of herbaceous and woody species to confirm the importance of the aeolian-vegetation feedback in landscapes undergoing shrub encroachment. Then, we employ the linked models to assess the use of management interventions, designed to decrease the length of connected pathways, to alter the positive feedback and halt, or even reverse, shrub encroachment. JF - American Geophysical Union Fall Meeting AU - Okin, G S AU - Peters, D P AU - Pillsbury, F C AU - Duniway, M AU - Yao, J AU - Huang, H Y1 - 2011/12// PY - 2011 DA - December 2011 SP - Abstract B24C EP - 06 PB - American Geophysical Union, Washington, DC VL - 2011 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1008850362?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefinprocess&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+Geophysical+Union+Fall+Meeting&rft.atitle=Biotic-abiotic+feedbacks+in+desertification%3A+a+modeling+perspective+on+connectivity&rft.au=Okin%2C+G+S%3BPeters%2C+D+P%3BPillsbury%2C+F+C%3BDuniway%2C+M%3BYao%2C+J%3BHuang%2C+H&rft.aulast=Okin&rft.aufirst=G&rft.date=2011-12-01&rft.volume=2011&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=American+Geophysical+Union+Fall+Meeting&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 2011 fall meeting N1 - Copyright - GeoRef in Process, Copyright 2017, American Geosciences Institute. After editing and indexing, this record will be added to Georef. Reference includes data supplied by, and/or abstract, Copyright, American Geophysical Union, Washington, DC, United States N1 - PubXState - DC N1 - Last updated - 2017-01-24 N1 - CODEN - #07548 ER - TY - JOUR T1 - Anthraquinone repellent to reduce take of non-target birds from zinc phosphide rodenticide applications AN - 911163532; 16058793 AB - We evaluated anthraquinone as an avian repellent to reduce take of non-target birds from zinc phosphide rodenticide applications. We observed zero mortalities and no overt signs of zinc phosphide toxicosis among 20 Canada geese (Branta canadensis), 24 horned larks (Eremophila alpestris), and 47 ring-necked pheasants (Phasianus colchicus) offered baits treated with 1% or 2% anthraquinone and 2% zinc phosphide (target concentrations; wt/wt) during laboratory performance experiments. Thus, anthraquinone successfully prevented consumption of 2% zinc phosphide baits among non-target birds in captivity. We observed 10% mortality among black-tailed prairie dogs (i.e., target rodent; Cynomys ludovicianus) offered oats treated with 1% anthraquinone and 2% zinc phosphide, and 30% mortality among black-tailed prairie dogs offered oats treated with 2% anthraquinone and 2% zinc phosphide. Upon completion of our experiments, chemical analyses indicated that actual concentrations were 1.66% and 1.45% zinc phosphide among oats treated with1% anthraquinone+2% zinc phosphide, and 2% anthraquinone+2% zinc phosphide, respectively. We observed 24-37% repellency during a concentration-response test with black-tailed prairie dogs offered corn seeds treated with 0.5-4% anthraquinone (target concentrations; wt/wt). Thus, anthraquinone may affect consumption of repellent-treated rodenticide baits for black-tailed prairie dogs. Supplemental performance testing and field efficacy studies (e.g., 0.25-0.5% anthraquinone and 2% zinc phosphide, actual concentrations; wt/wt) are necessary for further development of an efficacious, bird-repellent rodenticide bait. JF - Applied Animal Behaviour Science AU - Werner, Scott J AU - Tupper, Shelagh K AU - Pettit, Susan E AU - Carlson, James C AU - Linz, George M AD - United States Department of Agriculture, Animal and Plant Health Inspection Service, Wildlife Services, National Wildlife Research Center, 4101 LaPorte Avenue, Fort Collins, CO 80521-2154, USA, Scott.J.Werner@aphis.usda.gov Y1 - 2011/11/30/ PY - 2011 DA - 2011 Nov 30 SP - 146 EP - 153 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 135 IS - 1-2 SN - 0168-1591, 0168-1591 KW - Toxicology Abstracts; Animal Behavior Abstracts KW - zinc phosphide KW - Mortality KW - Seeds KW - Repellency KW - anthraquinone KW - toxicosis KW - Aves KW - Rodenticides KW - Branta canadensis KW - Eremophila alpestris KW - Phasianus colchicus KW - Repellents KW - Cynomys ludovicianus KW - Phasianidae KW - Captivity KW - Y 25140:Domestic Animals KW - X 24330:Agrochemicals UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911163532?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Animal+Behaviour+Science&rft.atitle=Anthraquinone+repellent+to+reduce+take+of+non-target+birds+from+zinc+phosphide+rodenticide+applications&rft.au=Werner%2C+Scott+J%3BTupper%2C+Shelagh+K%3BPettit%2C+Susan+E%3BCarlson%2C+James+C%3BLinz%2C+George+M&rft.aulast=Werner&rft.aufirst=Scott&rft.date=2011-11-30&rft.volume=135&rft.issue=1-2&rft.spage=146&rft.isbn=&rft.btitle=&rft.title=Applied+Animal+Behaviour+Science&rft.issn=01681591&rft_id=info:doi/10.1016%2Fj.applanim.2011.09.009 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2013-06-14 N1 - SubjectsTermNotLitGenreText - zinc phosphide; Mortality; Rodenticides; Seeds; Repellency; anthraquinone; toxicosis; Repellents; Captivity; Aves; Eremophila alpestris; Branta canadensis; Phasianus colchicus; Cynomys ludovicianus; Phasianidae DO - http://dx.doi.org/10.1016/j.applanim.2011.09.009 ER - TY - CPAPER T1 - N-methyl-2-vinylpyridinium ion as a thiol alkylator for thiol proteomics T2 - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AN - 1313109583; 6121342 JF - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AU - Picklo, MatthewNB AU - Idso, JosephNB AU - Jackson, MatthewNB Y1 - 2011/11/16/ PY - 2011 DA - 2011 Nov 16 KW - Thiols KW - proteomics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313109583?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.atitle=N-methyl-2-vinylpyridinium+ion+as+a+thiol+alkylator+for+thiol+proteomics&rft.au=Picklo%2C+MatthewNB%3BIdso%2C+JosephNB%3BJackson%2C+MatthewNB&rft.aulast=Picklo&rft.aufirst=MatthewNB&rft.date=2011-11-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://submissions.miracd.com/sfrbm2011/Itinerary/SearchHome.asp LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Nrf2 pathway proteins are differentially expressed during 3T3-L1 adipocyte differentiation T2 - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AN - 1313080138; 6121378 JF - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AU - Vomhof-DeKrey, Emilie AU - Picklo, MatthewNB Y1 - 2011/11/16/ PY - 2011 DA - 2011 Nov 16 KW - Differentiation KW - Adipocytes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313080138?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.atitle=Nrf2+pathway+proteins+are+differentially+expressed+during+3T3-L1+adipocyte+differentiation&rft.au=Vomhof-DeKrey%2C+Emilie%3BPicklo%2C+MatthewNB&rft.aulast=Vomhof-DeKrey&rft.aufirst=Emilie&rft.date=2011-11-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://submissions.miracd.com/sfrbm2011/Itinerary/SearchHome.asp LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Lack of Nrf2 reduces voluntary exercise in mice: influences of sex and diet T2 - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AN - 1313048144; 6121306 JF - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AU - Vomhof-DeKrey, Emilie AU - Picklo, MatthewNB Y1 - 2011/11/16/ PY - 2011 DA - 2011 Nov 16 KW - Diets KW - Mice KW - Sex KW - Physical training UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313048144?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.atitle=Lack+of+Nrf2+reduces+voluntary+exercise+in+mice%3A+influences+of+sex+and+diet&rft.au=Vomhof-DeKrey%2C+Emilie%3BPicklo%2C+MatthewNB&rft.aulast=Vomhof-DeKrey&rft.aufirst=Emilie&rft.date=2011-11-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://submissions.miracd.com/sfrbm2011/Itinerary/SearchHome.asp LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Glutathionylation of Hepatic and Visceral Adipose Proteins Decreases in Obese-Prone, Glucose-Intolerant Rats T2 - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AN - 1312988387; 6121169 JF - 18th Annual Meeting of the Society for Free Radical Biology and Medicine (SFRBM 2011) AU - Picklo, MatthewNB AU - Jackson, MatthewNB AU - Idso, JosephNB Y1 - 2011/11/16/ PY - 2011 DA - 2011 Nov 16 KW - Rats KW - Liver UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312988387?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.atitle=Glutathionylation+of+Hepatic+and+Visceral+Adipose+Proteins+Decreases+in+Obese-Prone%2C+Glucose-Intolerant+Rats&rft.au=Picklo%2C+MatthewNB%3BJackson%2C+MatthewNB%3BIdso%2C+JosephNB&rft.aulast=Picklo&rft.aufirst=MatthewNB&rft.date=2011-11-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=18th+Annual+Meeting+of+the+Society+for+Free+Radical+Biology+and+Medicine+%28SFRBM+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://submissions.miracd.com/sfrbm2011/Itinerary/SearchHome.asp LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - JOUR T1 - Identification and expression profiles of multiple genes in Nile tilapia in response to bacterial infections AN - 911160872; 15936049 AB - To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophila. A total of 31 unique expressed sequence tags (ESTs) were identified from 192 clones of the subtractive cDNA library. Quantitative PCR revealed that nine of the 31 ESTs were significantly (p<0.05) upregulated in Nile tilapia at 6h post infection with A. hydrophilaat an injection dose of 105CFU per fish (20% mortality). Of the nine upregulated genes, four were also significantly (p<0.05) induced in Nile tilapia at 6h post infection with A. hydrophilaat an injection dose of 106CFU per fish (60% mortality). Of the four genes induced by A. hydrophilaat both injection doses, three were also significantly (p<0.05) upregulated in Nile tilapia at 6h post infection with Streptococcus iniae at doses of 10 super(6) and at 10 super(5) CFU per fish (70% and 30% mortality, respectively). The three genes induced by both bacteria included EST 2A05 (similar to adenylate kinase domain containing protein 1), EST 2G11 (unknown protein, shared similarity with Salmo salar IgH locus B genomic sequence with e value of 0.02), and EST 2H04 (unknown protein). Significant upregulation of these genes in Nile tilapia following bacterial infections suggested that they might play important roles in host response to infections of A. hydrophila and S. iniae. JF - Veterinary Immunology and Immunopathology AU - Pridgeon, Julia W AU - Aksoy, Mediha AU - Klesius, Phillip H AU - Li, Yuehong AU - Mu, Xingjiang AU - Srivastava, Kunwar AU - Reddy, Gopal AD - Aquatic Animal Health Research Unit, USDA-ARS, 990 Wire Road, Auburn, AL 36832, United States, julia.pridgeon@ars.usda.gov Y1 - 2011/11/15/ PY - 2011 DA - 2011 Nov 15 SP - 111 EP - 119 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 144 IS - 1-2 SN - 0165-2427, 0165-2427 KW - Microbiology Abstracts B: Bacteriology; Immunology Abstracts; ASFA 1: Biological Sciences & Living Resources KW - Oreochromis niloticus KW - Subtractive hybridization KW - Upregulation KW - Aeromonas hydrophila KW - Streptococcus iniae KW - Molecular modelling KW - Nucleotide sequence KW - Adenylate kinase KW - Infection KW - expressed sequence tags KW - Gene expression KW - Polymerase chain reaction KW - genomics KW - Brackishwater fish KW - Immunoglobulins KW - Clones KW - Bacteria KW - Mortality KW - Immunology KW - Brackish KW - Kidneys KW - Salmo salar KW - Kidney KW - DNA KW - Heavy chains KW - Mortality causes KW - Q1 08484:Species interactions: parasites and diseases KW - J 02350:Immunology KW - F 06940:Fish Immunity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911160872?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Veterinary+Immunology+and+Immunopathology&rft.atitle=Identification+and+expression+profiles+of+multiple+genes+in+Nile+tilapia+in+response+to+bacterial+infections&rft.au=Pridgeon%2C+Julia+W%3BAksoy%2C+Mediha%3BKlesius%2C+Phillip+H%3BLi%2C+Yuehong%3BMu%2C+Xingjiang%3BSrivastava%2C+Kunwar%3BReddy%2C+Gopal&rft.aulast=Pridgeon&rft.aufirst=Julia&rft.date=2011-11-15&rft.volume=144&rft.issue=1-2&rft.spage=111&rft.isbn=&rft.btitle=&rft.title=Veterinary+Immunology+and+Immunopathology&rft.issn=01652427&rft_id=info:doi/10.1016%2Fj.vetimm.2011.07.018 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Clones; Gene expression; Immunology; Nucleotide sequence; DNA; Polymerase chain reaction; Kidneys; Brackishwater fish; Mortality causes; Molecular modelling; Mortality; Adenylate kinase; Kidney; genomics; Infection; Heavy chains; expressed sequence tags; Immunoglobulins; Bacteria; Aeromonas hydrophila; Streptococcus iniae; Salmo salar; Oreochromis niloticus; Brackish DO - http://dx.doi.org/10.1016/j.vetimm.2011.07.018 ER - TY - JOUR T1 - Specific serum antibody responses in channel catfish (Ictalurus punctatus) provide limited protection against Streptococcus ictaluri challenge AN - 911152386; 15936044 AB - Passive immunization studies were conducted to determine the role of specific antibodies in immunity to Streptococcus ictaluri. Adult channel catfish (Ictalurus punctatus) were injected i.p. with tryptic soy broth as control or with 1.5107colony-forming units (cfu) S. ictaluri/fish at 0, 30, and 60d, and serum was collected 90d after the original challenge. Fish were passively immunized by i.p. injection with serum from the tryptic soy broth (TSB) control group, anti-S. ictaluriserum from fish immunized three times and sampled at 90d (SSI), or heat-inactivated anti-S. ictaluriserum from fish immunized three times and sampled at 90d (HISSI). These passively immunized fish were then challenged 72h later with 1.5108cfu S. ictaluri/fish. Over 21d, the mean cumulative percent survival was 43.3 (TSB), 63.3 (SSI), and 50.0 (HISSI). A significant difference in cumulative percent survival was noted between the TSB and the HISSI groups, and significant differences were noted between these groups and the SSI group. Serum obtained from immunized fish 72h after passive immunization exhibited increased anti-S. ictaluriantibody levels. Twenty-one days after the challenge, the HISSI and SSI group antibody levels significantly increased above their corresponding pre-challenge levels. No significant (r|>2=0.0806; P<0.5985) correlation between increased pre-challenge specific serum antibody levels and survival after challenge was demonstrated when analyzing the control and passive immunization groups. The results indicate that both specific anti-S. ictaluri antibodies and non-specific immune responses are important for protection against S. ictaluri. JF - Veterinary Immunology and Immunopathology AU - Pasnik, David J AU - Evans, Joyce J AU - Klesius, Phillip H AD - Aquatic Animal Health Research Laboratory (AAHRL), United States Department of Agriculture-Agricultural Research Service (USDA-ARS), 118 B Lynchburg Street, Chestertown, MD 21620, USA, david.pasnik@ars.usda.gov Y1 - 2011/11/15/ PY - 2011 DA - 2011 Nov 15 SP - 144 EP - 146 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 144 IS - 1-2 SN - 0165-2427, 0165-2427 KW - Microbiology Abstracts B: Bacteriology; Immunology Abstracts KW - Antibody KW - Ictalurus punctatus KW - Passive immunization KW - Streptococcus ictaluri KW - Catfish KW - Streptococcus KW - Antibodies KW - Colony-forming cells KW - Survival KW - Immunization (passive) KW - Immune response KW - Immunity KW - Soybeans KW - J 02350:Immunology KW - F 06940:Fish Immunity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911152386?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Veterinary+Immunology+and+Immunopathology&rft.atitle=Specific+serum+antibody+responses+in+channel+catfish+%28Ictalurus+punctatus%29+provide+limited+protection+against+Streptococcus+ictaluri+challenge&rft.au=Pasnik%2C+David+J%3BEvans%2C+Joyce+J%3BKlesius%2C+Phillip+H&rft.aulast=Pasnik&rft.aufirst=David&rft.date=2011-11-15&rft.volume=144&rft.issue=1-2&rft.spage=144&rft.isbn=&rft.btitle=&rft.title=Veterinary+Immunology+and+Immunopathology&rft.issn=01652427&rft_id=info:doi/10.1016%2Fj.vetimm.2010.11.015 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Antibodies; Colony-forming cells; Survival; Immunization (passive); Immunity; Immune response; Soybeans; Streptococcus; Ictalurus punctatus DO - http://dx.doi.org/10.1016/j.vetimm.2010.11.015 ER - TY - JOUR T1 - Responses of time of anthesis and maturity to sowing dates and infrared warming in spring wheat AN - 902355710; 15723742 AB - Reliable prediction of the potential impacts of global warming on agriculture requires accurate data on crop responses to elevated temperatures. Controlled environments can precisely regulate temperature but may impose unrealistic radiation, photoperiod and humidity regimes. Infrared warming with automatic control of temperature rise has shown potential for warming field plots above ambient temperatures, while avoiding such biases. In a field experiment conducted at Maricopa, AZ, we assessed the utility of a temperature free-air controlled enhancement (T-FACE) approach by comparing phenology of wheat from a series of six sowing date treatments using T-FACE and an additional nine sowing dates that exposed crops to an exceptionally wide range of air temperatures (0 degree C to 40 degree C). The T-FACE treatments were intended to achieve a warming of +1.5 degree C during the daytime and +3.0 degree C at night; the achieved warming averaged +1.3 degree C during daytime and +2.8 degree C at night. T-FACE and sowing date treatments had large effects on phenology. A regression-based analysis of simulations with the CSM-CROPSIM-CERES model showed that effects of T-FACE on phenology were similar to what would be expected from equivalent changes in air temperature. However, systematic deviations from the expected 1-to-1 relation suggested that assumed cardinal temperatures for phenology should be revised. Based on the single cultivar and location, it appeared that the base temperature for emergence to anthesis should be reduced from 0 degree C to -5 degree C, whereas the base temperature for grain filling should be increased from 0 degree C to 4 degree C and the optimal temperature, from 30 degree C to 34 degree C. Both T-FACE and extreme sowing date treatments proved valuable for improving understanding of high temperature effects on plant processes, as required for accurate prediction of crop responses to elevated temperatures under climate change. JF - Field Crops Research AU - White, Jeffrey W AU - Kimball, Bruce A AU - Wall, Gerard W AU - Ottman, Michael J AU - Hunt, LA Y1 - 2011/11/14/ PY - 2011 DA - 2011 Nov 14 SP - 213 EP - 222 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 124 IS - 2 SN - 0378-4290, 0378-4290 KW - Sustainability Science Abstracts; Environment Abstracts KW - Climate change KW - Global warming KW - Modeling KW - Phenology KW - Wheat KW - Infrared warming KW - wheat KW - Triticum aestivum KW - maturity KW - air temperature KW - Temperature KW - Humidity KW - Greenhouse effect KW - phenology KW - Crops KW - M3 1010:Issues in Sustainable Development KW - ENA 01:Air Pollution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902355710?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Field+Crops+Research&rft.atitle=Responses+of+time+of+anthesis+and+maturity+to+sowing+dates+and+infrared+warming+in+spring+wheat&rft.au=White%2C+Jeffrey+W%3BKimball%2C+Bruce+A%3BWall%2C+Gerard+W%3BOttman%2C+Michael+J%3BHunt%2C+LA&rft.aulast=White&rft.aufirst=Jeffrey&rft.date=2011-11-14&rft.volume=124&rft.issue=2&rft.spage=213&rft.isbn=&rft.btitle=&rft.title=Field+Crops+Research&rft.issn=03784290&rft_id=info:doi/10.1016%2Fj.fcr.2011.06.020 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2016-07-07 N1 - SubjectsTermNotLitGenreText - wheat; maturity; air temperature; Climate change; Temperature; Humidity; Greenhouse effect; phenology; Crops; Triticum aestivum DO - http://dx.doi.org/10.1016/j.fcr.2011.06.020 ER - TY - CPAPER T1 - Proteomics and aphid transmission of viruses T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313036622; 6062759 JF - 59th Annual Meeting of the Entomological Society of America AU - Cilia, Michelle Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Viruses KW - proteomics KW - Disease transmission KW - Aphididae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313036622?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Proteomics+and+aphid+transmission+of+viruses&rft.au=Cilia%2C+Michelle&rft.aulast=Cilia&rft.aufirst=Michelle&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Inundative release of flea beetles as a "biological herbicide" on riparian leafy spurge T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313036320; 6062589 JF - 59th Annual Meeting of the Entomological Society of America AU - Progar, Robert Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Riparian environments KW - Herbicides KW - Biological control KW - Rivers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313036320?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Inundative+release+of+flea+beetles+as+a+%22biological+herbicide%22+on+riparian+leafy+spurge&rft.au=Progar%2C+Robert&rft.aulast=Progar&rft.aufirst=Robert&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Drought stress on two Tamarisk populations (WY and MT) in containment: effects on Diorhabda carinulata survival and adult size T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313035877; 6062327 JF - 59th Annual Meeting of the Entomological Society of America AU - Delaney, Kevin AU - Mayer, Mary AU - Kazmer, Dave Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Containment KW - Stress KW - Droughts KW - survival KW - Survival UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313035877?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Drought+stress+on+two+Tamarisk+populations+%28WY+and+MT%29+in+containment%3A+effects+on+Diorhabda+carinulata+survival+and+adult+size&rft.au=Delaney%2C+Kevin%3BMayer%2C+Mary%3BKazmer%2C+Dave&rft.aulast=Delaney&rft.aufirst=Kevin&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A probabilistic pathway model of forest insect dispersal via recreational firewood transport T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313034879; 6062482 JF - 59th Annual Meeting of the Entomological Society of America AU - Koch, Frank AU - Yemshanov, Denys AU - Magarey, Roger AU - Smith, William Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Recreation areas KW - Forests KW - dispersal KW - insects KW - Dispersal KW - Models KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313034879?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+probabilistic+pathway+model+of+forest+insect+dispersal+via+recreational+firewood+transport&rft.au=Koch%2C+Frank%3BYemshanov%2C+Denys%3BMagarey%2C+Roger%3BSmith%2C+William&rft.aulast=Koch&rft.aufirst=Frank&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Management of dogwood borer, Synanthedon scitula (Harris), with mating disruption and attract and remove strategies in Michigan apple T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313034107; 6062310 JF - 59th Annual Meeting of the Entomological Society of America AU - Epstein, David AU - Grieshop, Matt AU - Gut, Larry Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mating disruption KW - Borers KW - Reproductive behavior KW - Malus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313034107?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Management+of+dogwood+borer%2C+Synanthedon+scitula+%28Harris%29%2C+with+mating+disruption+and+attract+and+remove+strategies+in+Michigan+apple&rft.au=Epstein%2C+David%3BGrieshop%2C+Matt%3BGut%2C+Larry&rft.aulast=Epstein&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Climate, reproductive asynchrony, and mate-finding limitation in gypsy moth (Lymantria dispar) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313034003; 6062307 JF - 59th Annual Meeting of the Entomological Society of America AU - Tobin, Patrick AU - Haynes, Kyle AU - Onufrieva, Ksenia Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Climate KW - Lymantria dispar UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313034003?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Climate%2C+reproductive+asynchrony%2C+and+mate-finding+limitation+in+gypsy+moth+%28Lymantria+dispar%29&rft.au=Tobin%2C+Patrick%3BHaynes%2C+Kyle%3BOnufrieva%2C+Ksenia&rft.aulast=Tobin&rft.aufirst=Patrick&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Salivary proteins of Lygus hesperus (Hemiptera: Miridae) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313033847; 6062303 JF - 59th Annual Meeting of the Entomological Society of America AU - Cooper, William AU - Nicholson, Scott AU - Puterka, Gary Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Proteins KW - Lygus hesperus KW - Miridae KW - Hemiptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313033847?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Salivary+proteins+of+Lygus+hesperus+%28Hemiptera%3A+Miridae%29&rft.au=Cooper%2C+William%3BNicholson%2C+Scott%3BPuterka%2C+Gary&rft.aulast=Cooper&rft.aufirst=William&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - U.S. declines in honey bees and responding to the public T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313033631; 6062100 JF - 59th Annual Meeting of the Entomological Society of America AU - Pettis, Jeff Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA KW - Zoology KW - Apis mellifera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313033631?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=U.S.+declines+in+honey+bees+and+responding+to+the+public&rft.au=Pettis%2C+Jeff&rft.aulast=Pettis&rft.aufirst=Jeff&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Bumble bee declines in the headlines: the fact and the fiction T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313033419; 6062098 JF - 59th Annual Meeting of the Entomological Society of America AU - Strange, James Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313033419?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Bumble+bee+declines+in+the+headlines%3A+the+fact+and+the+fiction&rft.au=Strange%2C+James&rft.aulast=Strange&rft.aufirst=James&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Repellents and the future: consumer product or silver bullet T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313033295; 6062095 JF - 59th Annual Meeting of the Entomological Society of America AU - Strickman, Daniel Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Consumer products KW - Repellents KW - Silver KW - Pest control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313033295?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Repellents+and+the+future%3A+consumer+product+or+silver+bullet&rft.au=Strickman%2C+Daniel&rft.aulast=Strickman&rft.aufirst=Daniel&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Do we need to develop topical repellents any more? T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313033240; 6062094 JF - 59th Annual Meeting of the Entomological Society of America AU - Chauhan, Kamlesh Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Repellents KW - Pest control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313033240?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Do+we+need+to+develop+topical+repellents+any+more%3F&rft.au=Chauhan%2C+Kamlesh&rft.aulast=Chauhan&rft.aufirst=Kamlesh&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Host plant volatile effects on arthropods in cotton fields T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313028334; 6061410 JF - 59th Annual Meeting of the Entomological Society of America AU - Williams, Livy AU - Rodriguez-Saona, Cesar AU - Castle del Conte, Sandra Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Host plants KW - Cotton KW - arthropods KW - Volatiles KW - Arthropoda UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313028334?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Host+plant+volatile+effects+on+arthropods+in+cotton+fields&rft.au=Williams%2C+Livy%3BRodriguez-Saona%2C+Cesar%3BCastle+del+Conte%2C+Sandra&rft.aulast=Williams&rft.aufirst=Livy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Beyond attraction - methyl salicylate in strawberry, spruce and red maple fields T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313028245; 6061409 JF - 59th Annual Meeting of the Entomological Society of America AU - Lee, Jana Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Salicylic acid KW - Fragaria UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313028245?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Beyond+attraction+-+methyl+salicylate+in+strawberry%2C+spruce+and+red+maple+fields&rft.au=Lee%2C+Jana&rft.aulast=Lee&rft.aufirst=Jana&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Using host plant volatiles to improve the trap tree strategy for management of plum curculio T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313028135; 6061407 JF - 59th Annual Meeting of the Entomological Society of America AU - Wright, Starker AU - Leskey, Tracy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Host plants KW - Trees KW - Volatiles KW - Curculio KW - Prunus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313028135?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Using+host+plant+volatiles+to+improve+the+trap+tree+strategy+for+management+of+plum+curculio&rft.au=Wright%2C+Starker%3BLeskey%2C+Tracy&rft.aulast=Wright&rft.aufirst=Starker&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Host plant volatiles to improve detection and management of pepper weevil, Anthonomus eugenii, in pepper T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313027977; 6061405 JF - 59th Annual Meeting of the Entomological Society of America AU - Addesso, Karla AU - McAuslane, Heather AU - Alborn, Hans Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Host plants KW - Volatiles KW - Anthonomus eugenii UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313027977?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Host+plant+volatiles+to+improve+detection+and+management+of+pepper+weevil%2C+Anthonomus+eugenii%2C+in+pepper&rft.au=Addesso%2C+Karla%3BMcAuslane%2C+Heather%3BAlborn%2C+Hans&rft.aulast=Addesso&rft.aufirst=Karla&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Efficacy of "Horn" phosphine toward key stored product pests T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313027709; 6061447 JF - 59th Annual Meeting of the Entomological Society of America AU - Walse, Spenser AU - Bellamy, David AU - Tebbets, Steve Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - pests KW - phosphine KW - Horns KW - Stored products KW - Pests UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313027709?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Efficacy+of+%22Horn%22+phosphine+toward+key+stored+product+pests&rft.au=Walse%2C+Spenser%3BBellamy%2C+David%3BTebbets%2C+Steve&rft.aulast=Walse&rft.aufirst=Spenser&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Ovicidal efficacy of sulfuryl flouride to postharvest insect pests of California T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313027660; 6061446 JF - 59th Annual Meeting of the Entomological Society of America AU - Bellamy, David AU - Walse, Spenser AU - Tebbets, Steve Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, California KW - pests KW - insects KW - Pests KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313027660?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Ovicidal+efficacy+of+sulfuryl+flouride+to+postharvest+insect+pests+of+California&rft.au=Bellamy%2C+David%3BWalse%2C+Spenser%3BTebbets%2C+Steve&rft.aulast=Bellamy&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - What generates spatial pattern in Tribolium castaneum trap captures in flour mills? T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313027427; 6061441 JF - 59th Annual Meeting of the Entomological Society of America AU - Campbell, James AU - Semeao, Altair AU - Whitworth, R AU - Sloderbeck, Phil Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - spatial distribution KW - Flour KW - Tribolium castaneum UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313027427?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=What+generates+spatial+pattern+in+Tribolium+castaneum+trap+captures+in+flour+mills%3F&rft.au=Campbell%2C+James%3BSemeao%2C+Altair%3BWhitworth%2C+R%3BSloderbeck%2C+Phil&rft.aulast=Campbell&rft.aufirst=James&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Environmental and physiological factors affecting the flight initiation ability of the red flour beetle, Tribolium castaneum T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313027301; 6061438 JF - 59th Annual Meeting of the Entomological Society of America AU - Perez-Mendoza, Joel Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Physiology KW - Flight KW - Environmental factors KW - Tribolium castaneum UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313027301?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Environmental+and+physiological+factors+affecting+the+flight+initiation+ability+of+the+red+flour+beetle%2C+Tribolium+castaneum&rft.au=Perez-Mendoza%2C+Joel&rft.aulast=Perez-Mendoza&rft.aufirst=Joel&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Impact of the invasive brown marmorated stink bug in vineyards T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313026729; 6061429 JF - 59th Annual Meeting of the Entomological Society of America AU - Leskey, Tracy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - vineyards KW - Vineyards UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313026729?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Impact+of+the+invasive+brown+marmorated+stink+bug+in+vineyards&rft.au=Leskey%2C+Tracy&rft.aulast=Leskey&rft.aufirst=Tracy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The role of biosurveillance and Cerceris fumipennis in forest health management T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313021156; 6063145 JF - 59th Annual Meeting of the Entomological Society of America AU - Bohne, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Forests KW - Cerceris UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313021156?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+role+of+biosurveillance+and+Cerceris+fumipennis+in+forest+health+management&rft.au=Bohne%2C+Michael&rft.aulast=Bohne&rft.aufirst=Michael&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Functional diversity of honey bee (Apis mellifera) associated lactic-acid bacterial genomes T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313019287; 6063089 JF - 59th Annual Meeting of the Entomological Society of America AU - Anderson, Kirk Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Genomes KW - Genetic diversity KW - Apis mellifera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313019287?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Functional+diversity+of+honey+bee+%28Apis+mellifera%29+associated+lactic-acid+bacterial+genomes&rft.au=Anderson%2C+Kirk&rft.aulast=Anderson&rft.aufirst=Kirk&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Differences in nutritional profiles of pollen stored by African and European honey bees (Apis mellifera L.) and the effects on worker bees T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313018900; 6063083 JF - 59th Annual Meeting of the Entomological Society of America AU - DeGrandi-Hoffman, Gloria AU - Eckholm, Bruce AU - Huang, Ming Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Africa KW - pollen KW - Nutrition KW - Pollen KW - Apis mellifera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313018900?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Differences+in+nutritional+profiles+of+pollen+stored+by+African+and+European+honey+bees+%28Apis+mellifera+L.%29+and+the+effects+on+worker+bees&rft.au=DeGrandi-Hoffman%2C+Gloria%3BEckholm%2C+Bruce%3BHuang%2C+Ming&rft.aulast=DeGrandi-Hoffman&rft.aufirst=Gloria&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Honey bee signals that initiate vitellogenesis in the varroa mite, Varroa destructor T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313017276; 6062573 JF - 59th Annual Meeting of the Entomological Society of America AU - Cabrera-Cordon, Ana AU - Duehl, Adrian AU - Teal, Peter Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mites KW - Vitellogenesis KW - Apis mellifera KW - Varroa destructor UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313017276?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Honey+bee+signals+that+initiate+vitellogenesis+in+the+varroa+mite%2C+Varroa+destructor&rft.au=Cabrera-Cordon%2C+Ana%3BDuehl%2C+Adrian%3BTeal%2C+Peter&rft.aulast=Cabrera-Cordon&rft.aufirst=Ana&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - What do varroa mites (Varroa destructor) really want? T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313017211; 6062572 JF - 59th Annual Meeting of the Entomological Society of America AU - Duehl, Adrian AU - Cabrera-Cordon, Ana AU - Teal, Peter Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mites KW - Varroa destructor UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313017211?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=What+do+varroa+mites+%28Varroa+destructor%29+really+want%3F&rft.au=Duehl%2C+Adrian%3BCabrera-Cordon%2C+Ana%3BTeal%2C+Peter&rft.aulast=Duehl&rft.aufirst=Adrian&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A male-produced pheromone attracts both sexes of Sirex noctilio, the European woodwasp T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313016418; 6062476 JF - 59th Annual Meeting of the Entomological Society of America AU - Cooperband, Miriam AU - Hartness, Ashley AU - Boroczky, Katalin AU - Jones, Tappey AU - Zylstra, Kelley AU - Tumlinson, Jim AU - Mastro, Vic Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Sex KW - Pheromones KW - Noctilio KW - Sirex UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313016418?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+male-produced+pheromone+attracts+both+sexes+of+Sirex+noctilio%2C+the+European+woodwasp&rft.au=Cooperband%2C+Miriam%3BHartness%2C+Ashley%3BBoroczky%2C+Katalin%3BJones%2C+Tappey%3BZylstra%2C+Kelley%3BTumlinson%2C+Jim%3BMastro%2C+Vic&rft.aulast=Cooperband&rft.aufirst=Miriam&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Demographic matrix model for informing swallow-wort (Vincetoxicum spp.) biological control T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313016325; 6062474 JF - 59th Annual Meeting of the Entomological Society of America AU - Milbrath, Lindsey AU - Biazzo, Jeromy AU - Davis, Adam Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - demography KW - Demography KW - Models UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313016325?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Demographic+matrix+model+for+informing+swallow-wort+%28Vincetoxicum+spp.%29+biological+control&rft.au=Milbrath%2C+Lindsey%3BBiazzo%2C+Jeromy%3BDavis%2C+Adam&rft.aulast=Milbrath&rft.aufirst=Lindsey&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Capture and host strain of fall armyworm (Spodoptera frugiperda) in traps baited with different pheromone blends T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313016180; 6062471 JF - 59th Annual Meeting of the Entomological Society of America AU - Meagher, Robert AU - Nagoshi, Rodney AU - Armstrong, J Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Traps KW - Pheromones KW - Strains KW - Spodoptera frugiperda UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313016180?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Capture+and+host+strain+of+fall+armyworm+%28Spodoptera+frugiperda%29+in+traps+baited+with+different+pheromone+blends&rft.au=Meagher%2C+Robert%3BNagoshi%2C+Rodney%3BArmstrong%2C+J&rft.aulast=Meagher&rft.aufirst=Robert&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Insecticide resistance and gene regulation in the tarnished plant bug T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313015482; 6062231 JF - 59th Annual Meeting of the Entomological Society of America AU - Zhu, Yu AU - Guo, Zibiao AU - Luttrell, Randall Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Insecticides KW - Gene regulation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313015482?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Insecticide+resistance+and+gene+regulation+in+the+tarnished+plant+bug&rft.au=Zhu%2C+Yu%3BGuo%2C+Zibiao%3BLuttrell%2C+Randall&rft.aulast=Zhu&rft.aufirst=Yu&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Juvenile coloration as a predictor of health in Nezara viridula (Heteroptera: Pentatomidae) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313015377; 6062302 JF - 59th Annual Meeting of the Entomological Society of America AU - Rojas, M AU - Morales-Ramos, Juan AU - Jones, Walker Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Coloration KW - Nezara viridula KW - Pentatomidae KW - Hemiptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313015377?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Juvenile+coloration+as+a+predictor+of+health+in+Nezara+viridula+%28Heteroptera%3A+Pentatomidae%29&rft.au=Rojas%2C+M%3BMorales-Ramos%2C+Juan%3BJones%2C+Walker&rft.aulast=Rojas&rft.aufirst=M&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Sugars and free amino acids in weed and crop host plants of the Mexican rice borer, Eoreuma loftini (Dyar) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313015284; 6062301 JF - 59th Annual Meeting of the Entomological Society of America AU - Showler, A AU - Moran, Patrick Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Host plants KW - weeds KW - Amino acids KW - Crops KW - Sugar KW - Weeds KW - Borers KW - Eoreuma loftini KW - Oryza sativa UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313015284?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Sugars+and+free+amino+acids+in+weed+and+crop+host+plants+of+the+Mexican+rice+borer%2C+Eoreuma+loftini+%28Dyar%29&rft.au=Showler%2C+A%3BMoran%2C+Patrick&rft.aulast=Showler&rft.aufirst=A&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Neighborhood size of European corn borer, and net dispersal distance from the natal field T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313015206; 6062299 JF - 59th Annual Meeting of the Entomological Society of America AU - Sappington, Thomas AU - Kim, Kyung AU - Coates, Brad Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - corn KW - dispersal KW - Dispersal KW - Borers KW - Ostrinia nubilalis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313015206?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Neighborhood+size+of+European+corn+borer%2C+and+net+dispersal+distance+from+the+natal+field&rft.au=Sappington%2C+Thomas%3BKim%2C+Kyung%3BCoates%2C+Brad&rft.aulast=Sappington&rft.aufirst=Thomas&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Field longevity of a fluorescent protein marker in an engineered strain of the pink bollworm, Pectinophora gossypiella (Saunders) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313015165; 6062298 JF - 59th Annual Meeting of the Entomological Society of America AU - Walters, Michelle AU - Morrison, Neil AU - Claus, John AU - Tang, Guolei AU - Phillips, Caroline AU - Young, Robin AU - Zink, Richard AU - Alphey, Luke Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - longevity KW - Longevity KW - Strains KW - Pectinophora gossypiella UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313015165?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Field+longevity+of+a+fluorescent+protein+marker+in+an+engineered+strain+of+the+pink+bollworm%2C+Pectinophora+gossypiella+%28Saunders%29&rft.au=Walters%2C+Michelle%3BMorrison%2C+Neil%3BClaus%2C+John%3BTang%2C+Guolei%3BPhillips%2C+Caroline%3BYoung%2C+Robin%3BZink%2C+Richard%3BAlphey%2C+Luke&rft.aulast=Walters&rft.aufirst=Michelle&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Persistence and hard work will get you there: from academia to industry to government T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313014653; 6062180 JF - 59th Annual Meeting of the Entomological Society of America AU - Blanco, Carlos Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313014653?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Persistence+and+hard+work+will+get+you+there%3A+from+academia+to+industry+to+government&rft.au=Blanco%2C+Carlos&rft.aulast=Blanco&rft.aufirst=Carlos&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The push that started a domino effect of researchable topics for a weed biological control practitioner T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313014473; 6062619 JF - 59th Annual Meeting of the Entomological Society of America AU - Hight, Stephen Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - weeds KW - Weeds UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313014473?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+push+that+started+a+domino+effect+of+researchable+topics+for+a+weed+biological+control+practitioner&rft.au=Hight%2C+Stephen&rft.aulast=Hight&rft.aufirst=Stephen&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Systematics and biology of the invasive Agrilus planipennis Fairmaire (emerald ash borer) and its relatives T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313014226; 6062239 JF - 59th Annual Meeting of the Entomological Society of America AU - Chamorro, Maria AU - Lingafelter, Steve AU - Haack, Robert AU - Poland, Therese AU - Volkovitsh, Mark AU - Jendek, Eduard AU - Grebennikov, Vasily AU - Konstantinov, Alexander AU - Petrice, Toby AU - Zhang, Ying AU - Chen, Hongyin AU - Nelson, Darcy AU - Song, Yang AU - Woodley, Norman AU - Zhang, Runzhi Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Ash KW - Borers KW - Agrilus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313014226?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Systematics+and+biology+of+the+invasive+Agrilus+planipennis+Fairmaire+%28emerald+ash+borer%29+and+its+relatives&rft.au=Chamorro%2C+Maria%3BLingafelter%2C+Steve%3BHaack%2C+Robert%3BPoland%2C+Therese%3BVolkovitsh%2C+Mark%3BJendek%2C+Eduard%3BGrebennikov%2C+Vasily%3BKonstantinov%2C+Alexander%3BPetrice%2C+Toby%3BZhang%2C+Ying%3BChen%2C+Hongyin%3BNelson%2C+Darcy%3BSong%2C+Yang%3BWoodley%2C+Norman%3BZhang%2C+Runzhi&rft.aulast=Chamorro&rft.aufirst=Maria&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Insect vector of Xylella fastidiosa in Brazil and California mediate the transmission of an entomologist to the northern hemisphere T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313014021; 6062184 JF - 59th Annual Meeting of the Entomological Society of America AU - Krugner, Rodrigo Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, California KW - insects KW - Disease transmission KW - Vectors KW - Entomologists KW - Aquatic insects KW - Xylella fastidiosa UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313014021?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Insect+vector+of+Xylella+fastidiosa+in+Brazil+and+California+mediate+the+transmission+of+an+entomologist+to+the+northern+hemisphere&rft.au=Krugner%2C+Rodrigo&rft.aulast=Krugner&rft.aufirst=Rodrigo&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Invasive and beneficial insects entrance into the USA T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313012780; 6061174 JF - 59th Annual Meeting of the Entomological Society of America AU - Bancroft, Jay Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA KW - insects KW - Beneficial arthropods KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313012780?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Invasive+and+beneficial+insects+entrance+into+the+USA&rft.au=Bancroft%2C+Jay&rft.aulast=Bancroft&rft.aufirst=Jay&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Jumping the bar(code): did a numt in blue orchard bees (Osmia lignaria) come from the barcode region of Osmia californica? T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313012400; 6063030 JF - 59th Annual Meeting of the Entomological Society of America AU - Roehrdanz, Richard AU - Sears, Sheila Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - orchards KW - Orchards KW - Jumping KW - Osmia KW - Osmia lignaria UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313012400?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Jumping+the+bar%28code%29%3A+did+a+numt+in+blue+orchard+bees+%28Osmia+lignaria%29+come+from+the+barcode+region+of+Osmia+californica%3F&rft.au=Roehrdanz%2C+Richard%3BSears%2C+Sheila&rft.aulast=Roehrdanz&rft.aufirst=Richard&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Nucleic acid collections from the pink spotted lady beetle, Coleomegilla maculata T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313012364; 6063029 JF - 59th Annual Meeting of the Entomological Society of America AU - Allen, Margaret Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Nucleic acids KW - nucleic acids KW - Coleomegilla maculata UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313012364?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Nucleic+acid+collections+from+the+pink+spotted+lady+beetle%2C+Coleomegilla+maculata&rft.au=Allen%2C+Margaret&rft.aulast=Allen&rft.aufirst=Margaret&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - As the worm turns: biological control of Sirex woodwasps with an exotic nematode T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313011435; 6062600 JF - 59th Annual Meeting of the Entomological Society of America AU - Williams, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - nematodes KW - Nematoda KW - Sirex UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313011435?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=As+the+worm+turns%3A+biological+control+of+Sirex+woodwasps+with+an+exotic+nematode&rft.au=Williams%2C+David&rft.aulast=Williams&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A comparison of the impact of EAB natural enemies between the pest's native range and the newly invaded region T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313011363; 6062598 JF - 59th Annual Meeting of the Entomological Society of America AU - Duan, Jian AU - Gould, Juli AU - Bauer, Leah AU - Van Driesche, Roy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Natural enemies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313011363?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+comparison+of+the+impact+of+EAB+natural+enemies+between+the+pest%27s+native+range+and+the+newly+invaded+region&rft.au=Duan%2C+Jian%3BGould%2C+Juli%3BBauer%2C+Leah%3BVan+Driesche%2C+Roy&rft.aulast=Duan&rft.aufirst=Jian&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Sampling methods to assess establishment and prevalence of emerald ash borer parasitoids T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313011318; 6062597 JF - 59th Annual Meeting of the Entomological Society of America AU - Bauer, Leah AU - Hansen, Jason AU - Duan, Jian AU - Gould, Juli Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Sampling methods KW - Ash KW - Parasitoids KW - Borers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313011318?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Sampling+methods+to+assess+establishment+and+prevalence+of+emerald+ash+borer+parasitoids&rft.au=Bauer%2C+Leah%3BHansen%2C+Jason%3BDuan%2C+Jian%3BGould%2C+Juli&rft.aulast=Bauer&rft.aufirst=Leah&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Determining optimal nutrient balance in Tenebrio molitor (Coleoptera: Tenebrionidae) by self selection T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313010646; 6062401 JF - 59th Annual Meeting of the Entomological Society of America AU - Morales-Ramos, Juan AU - Rojas, Guadalupe AU - Shapiro-Ilan, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - nutrient balance KW - Nutrient balance KW - Self KW - Aquatic insects KW - Coleoptera KW - Tenebrio molitor KW - Tenebrionidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313010646?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Determining+optimal+nutrient+balance+in+Tenebrio+molitor+%28Coleoptera%3A+Tenebrionidae%29+by+self+selection&rft.au=Morales-Ramos%2C+Juan%3BRojas%2C+Guadalupe%3BShapiro-Ilan%2C+David&rft.aulast=Morales-Ramos&rft.aufirst=Juan&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The walnut twig beetle, Pityophthorus juglandis (Coleoptera: Scolytidae): distribution, genetic diversity, and impact on native walnuts of the southwestern U.S T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313010125; 6062316 JF - 59th Annual Meeting of the Entomological Society of America AU - Graves, Andrew AU - Coleman, Tom AU - Rugman-Jones, Paul AU - Stouthamer, Richard AU - Seybold, Steven Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA KW - genetic diversity KW - Genetic diversity KW - Aquatic insects KW - Scolytidae KW - Coleoptera KW - Pityophthorus KW - Juglans UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313010125?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+walnut+twig+beetle%2C+Pityophthorus+juglandis+%28Coleoptera%3A+Scolytidae%29%3A+distribution%2C+genetic+diversity%2C+and+impact+on+native+walnuts+of+the+southwestern+U.S&rft.au=Graves%2C+Andrew%3BColeman%2C+Tom%3BRugman-Jones%2C+Paul%3BStouthamer%2C+Richard%3BSeybold%2C+Steven&rft.aulast=Graves&rft.aufirst=Andrew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Foreign exploration, importation and release of biological control agents T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313009141; 6061370 JF - 59th Annual Meeting of the Entomological Society of America AU - Williams, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Importation KW - Exploration UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313009141?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Foreign+exploration%2C+importation+and+release+of+biological+control+agents&rft.au=Williams%2C+David&rft.aulast=Williams&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Improving insect rearingfrom an ARS scientist's perspective T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313003229; 6062753 JF - 59th Annual Meeting of the Entomological Society of America AU - Coudron, Thomas Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313003229?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Improving+insect+rearingfrom+an+ARS+scientist%27s+perspective&rft.au=Coudron%2C+Thomas&rft.aulast=Coudron&rft.aufirst=Thomas&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Hybrid weeds and agent genotypes: factors confounding biological control of weeds T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313003008; 6062748 JF - 59th Annual Meeting of the Entomological Society of America AU - Sing, Sharlene Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - weeds KW - Biological control KW - hybrids KW - Genotypes KW - Weeds KW - Hybrids UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313003008?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Hybrid+weeds+and+agent+genotypes%3A+factors+confounding+biological+control+of+weeds&rft.au=Sing%2C+Sharlene&rft.aulast=Sing&rft.aufirst=Sharlene&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Herbivore-induced plant defenses and biological control of invasive plants T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313002964; 6062747 JF - 59th Annual Meeting of the Entomological Society of America AU - Runyon, Justin Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - invasive plants KW - Introduced species UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313002964?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Herbivore-induced+plant+defenses+and+biological+control+of+invasive+plants&rft.au=Runyon%2C+Justin&rft.aulast=Runyon&rft.aufirst=Justin&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Working in Pacific island forests: a search for hope T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313002905; 6062746 JF - 59th Annual Meeting of the Entomological Society of America AU - Johnson, Tracy AU - Hughes, Flint AU - Giardina, Christian Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Central Pacific, Pacific Ocean Is. KW - Forests KW - Islands UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313002905?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Working+in+Pacific+island+forests%3A+a+search+for+hope&rft.au=Johnson%2C+Tracy%3BHughes%2C+Flint%3BGiardina%2C+Christian&rft.aulast=Johnson&rft.aufirst=Tracy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Exploration and evaluation of natural enemies for biological control of Anoplophora spp T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313002337; 6062602 JF - 59th Annual Meeting of the Entomological Society of America AU - Smith, Michael AU - Herard, Franck Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Natural enemies KW - Exploration KW - Anoplophora UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313002337?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Exploration+and+evaluation+of+natural+enemies+for+biological+control+of+Anoplophora+spp&rft.au=Smith%2C+Michael%3BHerard%2C+Franck&rft.aulast=Smith&rft.aufirst=Michael&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Isothermal amplification of insect DNA T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313002190; 6063031 JF - 59th Annual Meeting of the Entomological Society of America AU - Dickey, Aaron AU - Osborne, Lance AU - Shatters, Robert AU - McKenzie, Cindy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313002190?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Isothermal+amplification+of+insect+DNA&rft.au=Dickey%2C+Aaron%3BOsborne%2C+Lance%3BShatters%2C+Robert%3BMcKenzie%2C+Cindy&rft.aulast=Dickey&rft.aufirst=Aaron&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Pheromones of Spathius agrili and S. floridanus: exotic and native parasitoids of the invasive emerald ash borer T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313002165; 6062984 JF - 59th Annual Meeting of the Entomological Society of America AU - Cosse, Allard Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Ash KW - Pheromones KW - Parasitoids KW - Introduced species KW - Borers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313002165?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Pheromones+of+Spathius+agrili+and+S.+floridanus%3A+exotic+and+native+parasitoids+of+the+invasive+emerald+ash+borer&rft.au=Cosse%2C+Allard&rft.aulast=Cosse&rft.aufirst=Allard&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Update on landing preferences of the sand fly Phlebotomus papatasi on multiple surface materials T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313002118; 6062864 JF - 59th Annual Meeting of the Entomological Society of America AU - Aubuchon, Matt AU - Allan, Sandra AU - Clark, Gary Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Sand KW - Landing statistics KW - Phlebotomus papatasi UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313002118?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Update+on+landing+preferences+of+the+sand+fly+Phlebotomus+papatasi+on+multiple+surface+materials&rft.au=Aubuchon%2C+Matt%3BAllan%2C+Sandra%3BClark%2C+Gary&rft.aulast=Aubuchon&rft.aufirst=Matt&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Biosystematics of the Dendroctonus frontalis species complex in Mesoamerica T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313001914; 6062413 JF - 59th Annual Meeting of the Entomological Society of America AU - Sullivan, Brian AU - Zuniga Bermudez, Gerardo AU - Nino Dominguez, Alicia AU - Armendariz Toledano, Francisco AU - Macias Samano, Jorge Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology KW - Dendroctonus frontalis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313001914?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Biosystematics+of+the+Dendroctonus+frontalis+species+complex+in+Mesoamerica&rft.au=Sullivan%2C+Brian%3BZuniga+Bermudez%2C+Gerardo%3BNino+Dominguez%2C+Alicia%3BArmendariz+Toledano%2C+Francisco%3BMacias+Samano%2C+Jorge&rft.aulast=Sullivan&rft.aufirst=Brian&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Natural carbon dioxide generation for the attraction of blood feeding arthropods T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313001611; 6062870 JF - 59th Annual Meeting of the Entomological Society of America AU - Cohnstaedt, Lee AU - Yarnell, William AU - Nayduch, Dana AU - Schacht, Matthew Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - feeding KW - arthropods KW - Carbon dioxide KW - Feeding KW - Blood KW - Arthropoda UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313001611?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Natural+carbon+dioxide+generation+for+the+attraction+of+blood+feeding+arthropods&rft.au=Cohnstaedt%2C+Lee%3BYarnell%2C+William%3BNayduch%2C+Dana%3BSchacht%2C+Matthew&rft.aulast=Cohnstaedt&rft.aufirst=Lee&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Comparative effects of cattle, horse, and chicken blood on stable fly (Stomoxys calcitrans (L.)) fecundity T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313001511; 6062867 JF - 59th Annual Meeting of the Entomological Society of America AU - Hale, Kristina Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - horses KW - Cattle KW - fecundity KW - Blood KW - Fecundity KW - Stomoxys calcitrans UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313001511?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Comparative+effects+of+cattle%2C+horse%2C+and+chicken+blood+on+stable+fly+%28Stomoxys+calcitrans+%28L.%29%29+fecundity&rft.au=Hale%2C+Kristina&rft.aulast=Hale&rft.aufirst=Kristina&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Identifying additional pollinators for U.S. agriculture: utilizing blue orchard bees in California almond orchards T2 - 59th Annual Meeting of the Entomological Society of America AN - 1313000330; 6062546 JF - 59th Annual Meeting of the Entomological Society of America AU - Pitts-Singer, Theresa Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, California KW - orchards KW - agriculture KW - Orchards KW - Pollinators KW - Agriculture KW - Prunus dulcis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313000330?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Identifying+additional+pollinators+for+U.S.+agriculture%3A+utilizing+blue+orchard+bees+in+California+almond+orchards&rft.au=Pitts-Singer%2C+Theresa&rft.aulast=Pitts-Singer&rft.aufirst=Theresa&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Mountain pine beetle outbreaks in western North America: causes and consequences T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312999988; 6062739 JF - 59th Annual Meeting of the Entomological Society of America AU - Fettig, Christopher AU - Bentz, Barbara AU - Gibson, Ken AU - Gillette, Nancy AU - Jenkins, Michael AU - Jorgensen, Carl AU - McKelvey, Stephen AU - Munson, A AU - Negron, Jose AU - Progar, Robert AU - Steed, Brytten Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - North America KW - outbreaks KW - Mountains UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312999988?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Mountain+pine+beetle+outbreaks+in+western+North+America%3A+causes+and+consequences&rft.au=Fettig%2C+Christopher%3BBentz%2C+Barbara%3BGibson%2C+Ken%3BGillette%2C+Nancy%3BJenkins%2C+Michael%3BJorgensen%2C+Carl%3BMcKelvey%2C+Stephen%3BMunson%2C+A%3BNegron%2C+Jose%3BProgar%2C+Robert%3BSteed%2C+Brytten&rft.aulast=Fettig&rft.aufirst=Christopher&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Invasive species, Diuraphis noxia, successfully hybridizes with native U.S. Diuraphis species resulting in hypervirulent offspring T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312998881; 6062337 JF - 59th Annual Meeting of the Entomological Society of America AU - Puterka, Gary AU - Shufran, Kevin Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA KW - offspring KW - invasive species KW - Progeny KW - Introduced species KW - Invasive Species KW - Diuraphis noxia UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998881?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Invasive+species%2C+Diuraphis+noxia%2C+successfully+hybridizes+with+native+U.S.+Diuraphis+species+resulting+in+hypervirulent+offspring&rft.au=Puterka%2C+Gary%3BShufran%2C+Kevin&rft.aulast=Puterka&rft.aufirst=Gary&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Rapid development of cold phytosanitary treatments for the invasive tephritid fruit flies Bactrocera invadens and B. zonata by comparison with known species T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312998797; 6062335 JF - 59th Annual Meeting of the Entomological Society of America AU - Hallman, Guy AU - Myers, Scott AU - El-Wakkad, Mokhtar AU - Hennessey, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - fruits KW - Bactrocera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998797?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Rapid+development+of+cold+phytosanitary+treatments+for+the+invasive+tephritid+fruit+flies+Bactrocera+invadens+and+B.+zonata+by+comparison+with+known+species&rft.au=Hallman%2C+Guy%3BMyers%2C+Scott%3BEl-Wakkad%2C+Mokhtar%3BHennessey%2C+Michael&rft.aulast=Hallman&rft.aufirst=Guy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Biology of spotted wing Drosophila T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312998761; 6062334 JF - 59th Annual Meeting of the Entomological Society of America AU - Lee, Jana Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Wings KW - Drosophila UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998761?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Biology+of+spotted+wing+Drosophila&rft.au=Lee%2C+Jana&rft.aulast=Lee&rft.aufirst=Jana&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Management of spotted wing Drosophila in West Coast small fruits T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312998698; 6062333 JF - 59th Annual Meeting of the Entomological Society of America AU - Bruck, Denny Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - fruits KW - Wings KW - Fruits KW - Coastal zone management KW - Drosophila UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998698?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Management+of+spotted+wing+Drosophila+in+West+Coast+small+fruits&rft.au=Bruck%2C+Denny&rft.aulast=Bruck&rft.aufirst=Denny&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Feasibility of a fruit fly-free zone on the island of Puerto Rico: multiple lines of evidence T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312998520; 6062330 JF - 59th Annual Meeting of the Entomological Society of America AU - Jenkins, David AU - Van Bloem, Skip AU - Whitmire, Stephanie AU - Peterson, Kristin AU - Goenaga, Ricardo Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Caribbean Sea, Greater Antilles, Puerto Rico KW - Islands KW - fruits KW - Feasibility studies KW - Fruits UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998520?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Feasibility+of+a+fruit+fly-free+zone+on+the+island+of+Puerto+Rico%3A+multiple+lines+of+evidence&rft.au=Jenkins%2C+David%3BVan+Bloem%2C+Skip%3BWhitmire%2C+Stephanie%3BPeterson%2C+Kristin%3BGoenaga%2C+Ricardo&rft.aulast=Jenkins&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The psyllid fauna (Homoptera) of south Texas T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312997255; 6062422 JF - 59th Annual Meeting of the Entomological Society of America AU - Thomas, Donald Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, Texas KW - fauna KW - Homoptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312997255?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+psyllid+fauna+%28Homoptera%29+of+south+Texas&rft.au=Thomas%2C+Donald&rft.aulast=Thomas&rft.aufirst=Donald&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Significance of water stress on the host-selection behavior and management of Xylosandrus germanus and other ambrosia beetles T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312995707; 6062361 JF - 59th Annual Meeting of the Entomological Society of America AU - Ranger, Christopher AU - Schultz, Peter AU - Frank, Steven AU - Oliver, Jason AU - Reding, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Water stress KW - Water management KW - Xylosandrus KW - Ambrosia UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312995707?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Significance+of+water+stress+on+the+host-selection+behavior+and+management+of+Xylosandrus+germanus+and+other+ambrosia+beetles&rft.au=Ranger%2C+Christopher%3BSchultz%2C+Peter%3BFrank%2C+Steven%3BOliver%2C+Jason%3BReding%2C+Michael&rft.aulast=Ranger&rft.aufirst=Christopher&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - New technologies in electrical penetration graph (EPG) monitors of insect feeding and their applications for 21st century entomology T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312994883; 6062157 JF - 59th Annual Meeting of the Entomological Society of America AU - Backus, Elaine Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - feeding KW - insects KW - Technology KW - Feeding KW - Aquatic insects KW - Entomology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312994883?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=New+technologies+in+electrical+penetration+graph+%28EPG%29+monitors+of+insect+feeding+and+their+applications+for+21st+century+entomology&rft.au=Backus%2C+Elaine&rft.aulast=Backus&rft.aufirst=Elaine&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Oral uptake of host-gene-targeted dsRNA increases mortality in the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312991243; 6063025 JF - 59th Annual Meeting of the Entomological Society of America AU - Shatters, Robert AU - Shaffer, Lindsay AU - Powell, Charles AU - Borovsky, Dov Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mortality KW - Double-stranded RNA KW - Citrus KW - Kuwayama KW - Psyllidae KW - Diaphorina citri KW - Hemiptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312991243?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Oral+uptake+of+host-gene-targeted+dsRNA+increases+mortality+in+the+Asian+citrus+psyllid%2C+Diaphorina+citri+Kuwayama+%28Hemiptera%3A+Psyllidae%29&rft.au=Shatters%2C+Robert%3BShaffer%2C+Lindsay%3BPowell%2C+Charles%3BBorovsky%2C+Dov&rft.aulast=Shatters&rft.aufirst=Robert&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Compositional and biosynthetic studies of the Asian citrus psyllid (Hemiptera: Psyllidae, Diaphorina citri) salivary sheath T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312991201; 6063024 JF - 59th Annual Meeting of the Entomological Society of America AU - Morgan, J AU - Alessandro, Rocco AU - Hunter, Wayne AU - Shatters, Robert Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Sheaths KW - Citrus KW - Diaphorina citri KW - Psyllidae KW - Hemiptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312991201?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Compositional+and+biosynthetic+studies+of+the+Asian+citrus+psyllid+%28Hemiptera%3A+Psyllidae%2C+Diaphorina+citri%29+salivary+sheath&rft.au=Morgan%2C+J%3BAlessandro%2C+Rocco%3BHunter%2C+Wayne%3BShatters%2C+Robert&rft.aulast=Morgan&rft.aufirst=J&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Effect of biogenic amines on the mating and egg-laying behaviors in the stable fly T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312990922; 6063016 JF - 59th Annual Meeting of the Entomological Society of America AU - Liu, Samuel AU - Li, Andrew Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Amines KW - Mating behavior KW - Biogenic amines KW - Mating KW - Reproductive behavior UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312990922?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Effect+of+biogenic+amines+on+the+mating+and+egg-laying+behaviors+in+the+stable+fly&rft.au=Liu%2C+Samuel%3BLi%2C+Andrew&rft.aulast=Liu&rft.aufirst=Samuel&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Myosin gene expression and protein abundance in the Formosan subterranean termite (Coptotermes formosanus) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312990806; 6063014 JF - 59th Annual Meeting of the Entomological Society of America AU - Tarver, Matthew AU - Florane, Christopher AU - Mattison, Christopher AU - Lax, Alan Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Abundance KW - Gene expression KW - Myosin KW - Coptotermes formosanus KW - Isoptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312990806?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Myosin+gene+expression+and+protein+abundance+in+the+Formosan+subterranean+termite+%28Coptotermes+formosanus%29&rft.au=Tarver%2C+Matthew%3BFlorane%2C+Christopher%3BMattison%2C+Christopher%3BLax%2C+Alan&rft.aulast=Tarver&rft.aufirst=Matthew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Women in government T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312989558; 6061466 JF - 59th Annual Meeting of the Entomological Society of America AU - Kopp, Dennis Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312989558?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Women+in+government&rft.au=Kopp%2C+Dennis&rft.aulast=Kopp&rft.aufirst=Dennis&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Heat curing of microsporidian, neogregarine, and eugregarine infections in Tribolium castaneum T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312989238; 6062400 JF - 59th Annual Meeting of the Entomological Society of America AU - Lord, Jeff Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - infection KW - Infection KW - Heat KW - Curing KW - Tribolium castaneum UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312989238?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Heat+curing+of+microsporidian%2C+neogregarine%2C+and+eugregarine+infections+in+Tribolium+castaneum&rft.au=Lord%2C+Jeff&rft.aulast=Lord&rft.aufirst=Jeff&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Behaviorally based evaluation of insecticides for BMSB: mobility, mortality, and recovery T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312989000; 6061279 JF - 59th Annual Meeting of the Entomological Society of America AU - Wright, Starker AU - Leskey, Tracy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mortality KW - Mobility KW - Insecticides UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312989000?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Behaviorally+based+evaluation+of+insecticides+for+BMSB%3A+mobility%2C+mortality%2C+and+recovery&rft.au=Wright%2C+Starker%3BLeskey%2C+Tracy&rft.aulast=Wright&rft.aufirst=Starker&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Mass rearing and release of sterile fruit flies, a Florida perspective T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312988823; 6061368 JF - 59th Annual Meeting of the Entomological Society of America AU - Dean, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, Florida KW - fruits KW - Mass rearing UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312988823?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Mass+rearing+and+release+of+sterile+fruit+flies%2C+a+Florida+perspective&rft.au=Dean%2C+David&rft.aulast=Dean&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Prediction of Rift Valley fever outbreaks and impact on disease control T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312988388; 6061259 JF - 59th Annual Meeting of the Entomological Society of America AU - Linthicum, Kenneth AU - Anyamba, Assaf AU - Small, Jennifer AU - Britch, Seth AU - Pak, Edwin AU - Tucker, Compton Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - disease control KW - outbreaks KW - rift valleys KW - Disease control KW - Rift Valley fever KW - Rift valleys UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312988388?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Prediction+of+Rift+Valley+fever+outbreaks+and+impact+on+disease+control&rft.au=Linthicum%2C+Kenneth%3BAnyamba%2C+Assaf%3BSmall%2C+Jennifer%3BBritch%2C+Seth%3BPak%2C+Edwin%3BTucker%2C+Compton&rft.aulast=Linthicum&rft.aufirst=Kenneth&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Novel technologies developed to control cattle fever ticks feeding on free-ranging white-tailed deer along the Rio Grande in South Texas T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312988133; 6062785 JF - 59th Annual Meeting of the Entomological Society of America AU - Pound, J AU - Davey, R AU - Lohmeyer, Kh AU - Kammlah, D AU - Olafson, P Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, Texas KW - feeding KW - Cattle KW - deer KW - Technology KW - Feeding KW - Fever KW - Ixodidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312988133?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Novel+technologies+developed+to+control+cattle+fever+ticks+feeding+on+free-ranging+white-tailed+deer+along+the+Rio+Grande+in+South+Texas&rft.au=Pound%2C+J%3BDavey%2C+R%3BLohmeyer%2C+Kh%3BKammlah%2C+D%3BOlafson%2C+P&rft.aulast=Pound&rft.aufirst=J&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Integrating olfactory and visual stimuli as attractants for BMSB T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312987963; 6061275 JF - 59th Annual Meeting of the Entomological Society of America AU - Leskey, Tracy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Visual stimuli KW - Attractants KW - Olfaction UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312987963?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Integrating+olfactory+and+visual+stimuli+as+attractants+for+BMSB&rft.au=Leskey%2C+Tracy&rft.aulast=Leskey&rft.aufirst=Tracy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Chiapas insect amber fossils T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312987957; 6062781 JF - 59th Annual Meeting of the Entomological Society of America AU - Thomas, Donald Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mexico, Chiapas KW - insects KW - Amber KW - Fossils KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312987957?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Chiapas+insect+amber+fossils&rft.au=Thomas%2C+Donald&rft.aulast=Thomas&rft.aufirst=Donald&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Comparison of ant (Hymenoptera: Formicidae) fauna between native and saltcedar-invaded habitats in western Nevada T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312986247; 6062378 JF - 59th Annual Meeting of the Entomological Society of America AU - Tonkel, Kirk AU - Rector, Brian AU - Steele, Tashia Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, Nevada KW - Habitat KW - fauna KW - Formicidae KW - Hymenoptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312986247?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Comparison+of+ant+%28Hymenoptera%3A+Formicidae%29+fauna+between+native+and+saltcedar-invaded+habitats+in+western+Nevada&rft.au=Tonkel%2C+Kirk%3BRector%2C+Brian%3BSteele%2C+Tashia&rft.aulast=Tonkel&rft.aufirst=Kirk&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Guidelines for creating web-based digital identification tools for plant protection and quarantine T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312985965; 6062124 JF - 59th Annual Meeting of the Entomological Society of America AU - Walters, Terrence Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - plant protection KW - guidelines KW - Quarantine KW - Plant protection UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312985965?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Guidelines+for+creating+web-based+digital+identification+tools+for+plant+protection+and+quarantine&rft.au=Walters%2C+Terrence&rft.aulast=Walters&rft.aufirst=Terrence&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Opportunities for classical biological control of Piezodorus, Bagrada, and Megacopta T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312982844; 6061384 JF - 59th Annual Meeting of the Entomological Society of America AU - Jones, Walker Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Piezodorus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312982844?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Opportunities+for+classical+biological+control+of+Piezodorus%2C+Bagrada%2C+and+Megacopta&rft.au=Jones%2C+Walker&rft.aulast=Jones&rft.aufirst=Walker&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Perspectives from USDA-APHIS T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312982264; 6062036 JF - 59th Annual Meeting of the Entomological Society of America AU - Firko, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312982264?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Perspectives+from+USDA-APHIS&rft.au=Firko%2C+Michael&rft.aulast=Firko&rft.aufirst=Michael&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Perspectives from USDA-ARS T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312982235; 6062035 JF - 59th Annual Meeting of the Entomological Society of America AU - Hackett, Kevin Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312982235?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Perspectives+from+USDA-ARS&rft.au=Hackett%2C+Kevin&rft.aulast=Hackett&rft.aufirst=Kevin&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Entomological careers in the USDA, Agricultural Research Service T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312976347; 6062771 JF - 59th Annual Meeting of the Entomological Society of America AU - Yokoyama, Victoria Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - agricultural research KW - careers KW - Careers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312976347?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Entomological+careers+in+the+USDA%2C+Agricultural+Research+Service&rft.au=Yokoyama%2C+Victoria&rft.aulast=Yokoyama&rft.aufirst=Victoria&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Somewhere over the rainbow: opportunities for careers at USDA's National Institute of Food and Agriculture T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312976250; 6062768 JF - 59th Annual Meeting of the Entomological Society of America AU - Purcell-Miramontes, Mary Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - agriculture KW - careers KW - Food KW - Agriculture KW - Careers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312976250?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Somewhere+over+the+rainbow%3A+opportunities+for+careers+at+USDA%27s+National+Institute+of+Food+and+Agriculture&rft.au=Purcell-Miramontes%2C+Mary&rft.aulast=Purcell-Miramontes&rft.aufirst=Mary&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Studies of the chemical ecology of Laricobius nigrinus T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312974797; 6062935 JF - 59th Annual Meeting of the Entomological Society of America AU - Shepherd, William AU - Mayfield, Albert AU - Sullivan, Brian AU - Wallin, Kimberly Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Ecology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312974797?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Studies+of+the+chemical+ecology+of+Laricobius+nigrinus&rft.au=Shepherd%2C+William%3BMayfield%2C+Albert%3BSullivan%2C+Brian%3BWallin%2C+Kimberly&rft.aulast=Shepherd&rft.aufirst=William&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Characterization of volatile compounds associated with thousand cankers disease and walnut twig beetle in northern California black walnut, Juglans hindsii T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312974745; 6062934 JF - 59th Annual Meeting of the Entomological Society of America AU - Nelson, Lori AU - Seybold, Steven AU - Bostock, Richard AU - Roubtsova, Tatiana AU - Nguyen, Tivonne AU - Hishinuma, Stacy AU - Dallara, Paul AU - Graves, Andrew Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, California KW - Volatile compounds KW - Canker KW - Juglans hindsii KW - Juglans UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312974745?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Characterization+of+volatile+compounds+associated+with+thousand+cankers+disease+and+walnut+twig+beetle+in+northern+California+black+walnut%2C+Juglans+hindsii&rft.au=Nelson%2C+Lori%3BSeybold%2C+Steven%3BBostock%2C+Richard%3BRoubtsova%2C+Tatiana%3BNguyen%2C+Tivonne%3BHishinuma%2C+Stacy%3BDallara%2C+Paul%3BGraves%2C+Andrew&rft.aulast=Nelson&rft.aufirst=Lori&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Entomopathogenic nematode infection behavior: from mechanism to adaptive value T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312973150; 6062559 JF - 59th Annual Meeting of the Entomological Society of America AU - Campbell, James AU - Lewis, Edwin AU - Shapiro-Ilan, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - infection KW - nematodes KW - Infection KW - Nematoda UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312973150?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Entomopathogenic+nematode+infection+behavior%3A+from+mechanism+to+adaptive+value&rft.au=Campbell%2C+James%3BLewis%2C+Edwin%3BShapiro-Ilan%2C+David&rft.aulast=Campbell&rft.aufirst=James&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A warm soup of plants, predators, parasitoids and whiteflies T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312972444; 6062626 JF - 59th Annual Meeting of the Entomological Society of America AU - Simmons, Alvin Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - predators KW - Predators KW - Soups KW - Parasitoids UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312972444?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+warm+soup+of+plants%2C+predators%2C+parasitoids+and+whiteflies&rft.au=Simmons%2C+Alvin&rft.aulast=Simmons&rft.aufirst=Alvin&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Trophic interactions between lima bean, spider mites, and lady beetles T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312972331; 6062623 JF - 59th Annual Meeting of the Entomological Society of America AU - Riddick, Eric Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Peru, Lima KW - Mites KW - Beans KW - Trophic structure KW - Lima KW - Araneae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312972331?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Trophic+interactions+between+lima+bean%2C+spider+mites%2C+and+lady+beetles&rft.au=Riddick%2C+Eric&rft.aulast=Riddick&rft.aufirst=Eric&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Preliminary study of cotton yield response to Lygus hesperus infestation T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971956; 6062461 JF - 59th Annual Meeting of the Entomological Society of America AU - Spurgeon, Dale AU - Cooper, William Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Cotton KW - Infestation KW - Lygus hesperus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971956?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Preliminary+study+of+cotton+yield+response+to+Lygus+hesperus+infestation&rft.au=Spurgeon%2C+Dale%3BCooper%2C+William&rft.aulast=Spurgeon&rft.aufirst=Dale&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Field evaluation of a sub-lethal insecticide stressor with Beauveria bassiana for control of rangeland grasshoppers T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971876; 6062978 JF - 59th Annual Meeting of the Entomological Society of America AU - Foster, R AU - Jech, Larry AU - Reuter, K AU - Black, Lonnie AU - Jaronski, Stefan AU - Roberts, Donald Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Insecticides KW - Rangelands KW - Beauveria bassiana UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971876?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Field+evaluation+of+a+sub-lethal+insecticide+stressor+with+Beauveria+bassiana+for+control+of+rangeland+grasshoppers&rft.au=Foster%2C+R%3BJech%2C+Larry%3BReuter%2C+K%3BBlack%2C+Lonnie%3BJaronski%2C+Stefan%3BRoberts%2C+Donald&rft.aulast=Foster&rft.aufirst=R&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Outdoor evaluation of Beauveria and Metarhizium fungi for mormon cricket management T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971815; 6062977 JF - 59th Annual Meeting of the Entomological Society of America AU - Jaronski, Stefan AU - Foster, R AU - Reuter, K AU - Black, Lonnie AU - Schlothauer, Robin AU - Roberts, Donald Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Fungi KW - Beauveria KW - Gryllidae KW - Metarhizium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971815?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Outdoor+evaluation+of+Beauveria+and+Metarhizium+fungi+for+mormon+cricket+management&rft.au=Jaronski%2C+Stefan%3BFoster%2C+R%3BReuter%2C+K%3BBlack%2C+Lonnie%3BSchlothauer%2C+Robin%3BRoberts%2C+Donald&rft.aulast=Jaronski&rft.aufirst=Stefan&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Host plants of the Heliothis/Helicoverpa complex in central Colombia T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971652; 6062454 JF - 59th Annual Meeting of the Entomological Society of America AU - Hallman, Guy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Colombia KW - Host plants KW - Helicoverpa KW - Heliothis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971652?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Host+plants+of+the+Heliothis%2FHelicoverpa+complex+in+central+Colombia&rft.au=Hallman%2C+Guy&rft.aulast=Hallman&rft.aufirst=Guy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Field trials with Metarhizium spp. against rangeland grasshopper (Orthoptera: Acrididae) populations in the western US T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971650; 6062976 JF - 59th Annual Meeting of the Entomological Society of America AU - Jech, Larry AU - Foster, R AU - Reuter, K AU - Black, Lonnie AU - Jaronski, Stefan AU - Roberts, Donald Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Rangelands KW - Acrididae KW - Orthoptera KW - Metarhizium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971650?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Field+trials+with+Metarhizium+spp.+against+rangeland+grasshopper+%28Orthoptera%3A+Acrididae%29+populations+in+the+western+US&rft.au=Jech%2C+Larry%3BFoster%2C+R%3BReuter%2C+K%3BBlack%2C+Lonnie%3BJaronski%2C+Stefan%3BRoberts%2C+Donald&rft.aulast=Jech&rft.aufirst=Larry&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Tephritid fruit fly parasitoid mass rearing and release: challenges and achievements T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971550; 6062110 JF - 59th Annual Meeting of the Entomological Society of America AU - Sivinski, John Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - fruits KW - Parasitoids KW - Mass rearing UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971550?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Tephritid+fruit+fly+parasitoid+mass+rearing+and+release%3A+challenges+and+achievements&rft.au=Sivinski%2C+John&rft.aulast=Sivinski&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - New approaches to using factitious foods and artificial diets for predators T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971140; 6062108 JF - 59th Annual Meeting of the Entomological Society of America AU - Riddick, Eric AU - Rojas, M Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - predators KW - Diets KW - Predators KW - Artificial diets KW - Food UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971140?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=New+approaches+to+using+factitious+foods+and+artificial+diets+for+predators&rft.au=Riddick%2C+Eric%3BRojas%2C+M&rft.aulast=Riddick&rft.aufirst=Eric&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Tenebrio molitor, a potential host for biological control agents T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312971127; 6062107 JF - 59th Annual Meeting of the Entomological Society of America AU - Morales-Ramos, Juan Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Tenebrio molitor UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312971127?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Tenebrio+molitor%2C+a+potential+host+for+biological+control+agents&rft.au=Morales-Ramos%2C+Juan&rft.aulast=Morales-Ramos&rft.aufirst=Juan&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Novel interactions between a "reverse invasive" bark beetle and its newly acquired fungal associates T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312970733; 6062745 JF - 59th Annual Meeting of the Entomological Society of America AU - Gillette, Nancy AU - Sun, Jianghua AU - Lu, Min AU - Owen, Donald AU - Wingfield, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - bark KW - Scolytidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312970733?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Novel+interactions+between+a+%22reverse+invasive%22+bark+beetle+and+its+newly+acquired+fungal+associates&rft.au=Gillette%2C+Nancy%3BSun%2C+Jianghua%3BLu%2C+Min%3BOwen%2C+Donald%3BWingfield%2C+Michael&rft.aulast=Gillette&rft.aufirst=Nancy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Climate and high elevation defoliators in the Southwest T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312970626; 6062743 JF - 59th Annual Meeting of the Entomological Society of America AU - Lynch, Ann Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Climate UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312970626?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Climate+and+high+elevation+defoliators+in+the+Southwest&rft.au=Lynch%2C+Ann&rft.aulast=Lynch&rft.aufirst=Ann&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Assessing pest impacts under a changing climate T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312970583; 6062742 JF - 59th Annual Meeting of the Entomological Society of America AU - Lundquist, John Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - pests KW - Climate KW - Pests UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312970583?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Assessing+pest+impacts+under+a+changing+climate&rft.au=Lundquist%2C+John&rft.aulast=Lundquist&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Efforts to reduce mountain pine beetle attack in lodgepole pine using verbenone T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312970526; 6062741 JF - 59th Annual Meeting of the Entomological Society of America AU - Progar, Robert AU - Jorgensen, Carl AU - Blackford, Darren AU - Cluck, Danny AU - Halsey, R AU - Costello, Sheryl AU - Eager, Tom AU - Mocettini, Philip AU - Munson, A AU - Steed, Brytten Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Mountains KW - verbenone UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312970526?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Efforts+to+reduce+mountain+pine+beetle+attack+in+lodgepole+pine+using+verbenone&rft.au=Progar%2C+Robert%3BJorgensen%2C+Carl%3BBlackford%2C+Darren%3BCluck%2C+Danny%3BHalsey%2C+R%3BCostello%2C+Sheryl%3BEager%2C+Tom%3BMocettini%2C+Philip%3BMunson%2C+A%3BSteed%2C+Brytten&rft.aulast=Progar&rft.aufirst=Robert&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Toxicity of insecticidal soap to Asian citrus psyllid (Diaphorina citri) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312969882; 6062188 JF - 59th Annual Meeting of the Entomological Society of America AU - Richardson, Matthew AU - Hall, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Toxicity KW - Soaps KW - Citrus KW - Diaphorina citri UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312969882?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Toxicity+of+insecticidal+soap+to+Asian+citrus+psyllid+%28Diaphorina+citri%29&rft.au=Richardson%2C+Matthew%3BHall%2C+David&rft.aulast=Richardson&rft.aufirst=Matthew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A novel dispenser for dissemination of Isaria fumosorosea and infection of Diaphorina citri in residential and organic citrus T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312969493; 6062186 JF - 59th Annual Meeting of the Entomological Society of America AU - Chow, Andrew AU - Dunlap, Christopher AU - Flores, Daniel AU - Jackson, Mark AU - Moran, Patrick AU - Meikle, William AU - Patt, Joseph Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - infection KW - Infection KW - Citrus KW - Diaphorina citri UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312969493?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+novel+dispenser+for+dissemination+of+Isaria+fumosorosea+and+infection+of+Diaphorina+citri+in+residential+and+organic+citrus&rft.au=Chow%2C+Andrew%3BDunlap%2C+Christopher%3BFlores%2C+Daniel%3BJackson%2C+Mark%3BMoran%2C+Patrick%3BMeikle%2C+William%3BPatt%2C+Joseph&rft.aulast=Chow&rft.aufirst=Andrew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Task allocation in the tunneling behavior of workers of the Formosan subterranean termite T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312969333; 6061343 JF - 59th Annual Meeting of the Entomological Society of America AU - Cornelius, Mary AU - Lathrop, Erin AU - Tarver, Matthew Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Tunnels KW - Isoptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312969333?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Task+allocation+in+the+tunneling+behavior+of+workers+of+the+Formosan+subterranean+termite&rft.au=Cornelius%2C+Mary%3BLathrop%2C+Erin%3BTarver%2C+Matthew&rft.aulast=Cornelius&rft.aufirst=Mary&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Assessment of donor : recipient ratios in laboratory transfer studies with Reticulitermes virginicus Banks T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312968614; 6061348 JF - 59th Annual Meeting of the Entomological Society of America AU - Shelton, Thomas Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology KW - Reticulitermes virginicus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312968614?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Assessment+of+donor+%3A+recipient+ratios+in+laboratory+transfer+studies+with+Reticulitermes+virginicus+Banks&rft.au=Shelton%2C+Thomas&rft.aulast=Shelton&rft.aufirst=Thomas&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Colony size and initial establishment of hemlock woolly adelgid (Adelges tsugae) T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312966690; 6061492 JF - 59th Annual Meeting of the Entomological Society of America AU - Tobin, Patrick AU - Turcotte, Richard AU - Snider, Daniel Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Colonies KW - Adelges tsugae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312966690?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Colony+size+and+initial+establishment+of+hemlock+woolly+adelgid+%28Adelges+tsugae%29&rft.au=Tobin%2C+Patrick%3BTurcotte%2C+Richard%3BSnider%2C+Daniel&rft.aulast=Tobin&rft.aufirst=Patrick&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Chalkbrood co-infections of leafcutting bees (Megachile rotundata): Understanding the arms race between obligate, facultative, and non-pathogenic fungal species T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312965950; 6061529 JF - 59th Annual Meeting of the Entomological Society of America AU - Klinger, Ellen AU - James, Rosalind Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Races KW - Subpopulations KW - Megachile rotundata UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312965950?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Chalkbrood+co-infections+of+leafcutting+bees+%28Megachile+rotundata%29%3A+Understanding+the+arms+race+between+obligate%2C+facultative%2C+and+non-pathogenic+fungal+species&rft.au=Klinger%2C+Ellen%3BJames%2C+Rosalind&rft.aulast=Klinger&rft.aufirst=Ellen&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Impact of the entomopathogenic fungus Beauveriia bassiana on several biological control agents T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312965039; 6062979 JF - 59th Annual Meeting of the Entomological Society of America AU - Portilla, Maribel AU - Snodgrass, Gordon AU - Luttrell, Randy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312965039?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Impact+of+the+entomopathogenic+fungus+Beauveriia+bassiana+on+several+biological+control+agents&rft.au=Portilla%2C+Maribel%3BSnodgrass%2C+Gordon%3BLuttrell%2C+Randy&rft.aulast=Portilla&rft.aufirst=Maribel&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Why sequence 5000 arthropod (mostly insect) genomes? T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312964623; 6061293 JF - 59th Annual Meeting of the Entomological Society of America AU - Hackett, Kevin AU - Edwards, Owain AU - Robinson, Gene Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - arthropods KW - Genomes KW - Aquatic insects KW - Arthropoda UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312964623?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Why+sequence+5000+arthropod+%28mostly+insect%29+genomes%3F&rft.au=Hackett%2C+Kevin%3BEdwards%2C+Owain%3BRobinson%2C+Gene&rft.aulast=Hackett&rft.aufirst=Kevin&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A new 'detached leaf assay' method to test the inoculativity of psyllids with Candidatus Liberibacter asiaticus associated with citrus huanglongbing disease T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312964507; 6062355 JF - 59th Annual Meeting of the Entomological Society of America AU - Ammar, El-Desouky AU - Walter, Abigail AU - Hall, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Leaves KW - Citrus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312964507?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+new+%27detached+leaf+assay%27+method+to+test+the+inoculativity+of+psyllids+with+Candidatus+Liberibacter+asiaticus+associated+with+citrus+huanglongbing+disease&rft.au=Ammar%2C+El-Desouky%3BWalter%2C+Abigail%3BHall%2C+David&rft.aulast=Ammar&rft.aufirst=El-Desouky&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Recent Bactrocera fruit fly area-wide management programs in the Pacific T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962494; 6061452 JF - 59th Annual Meeting of the Entomological Society of America AU - Vargas, Roger Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Pacific KW - fruits KW - Bactrocera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962494?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Recent+Bactrocera+fruit+fly+area-wide+management+programs+in+the+Pacific&rft.au=Vargas%2C+Roger&rft.aulast=Vargas&rft.aufirst=Roger&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Invasive bark- and wood-infesting insects worldwide: establishment patterns, international trade, and efforts to slow the flow T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962453; 6061450 JF - 59th Annual Meeting of the Entomological Society of America AU - Haack, Robert Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - International trade KW - insects KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962453?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Invasive+bark-+and+wood-infesting+insects+worldwide%3A+establishment+patterns%2C+international+trade%2C+and+efforts+to+slow+the+flow&rft.au=Haack%2C+Robert&rft.aulast=Haack&rft.aufirst=Robert&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Shipping issues associated with the importation of arthropods T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962374; 6061249 JF - 59th Annual Meeting of the Entomological Society of America AU - Wehling, Wayne Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - arthropods KW - Importation KW - Arthropoda UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962374?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Shipping+issues+associated+with+the+importation+of+arthropods&rft.au=Wehling%2C+Wayne&rft.aulast=Wehling&rft.aufirst=Wayne&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The regulatory process for genetically engineered insects T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962346; 6061248 JF - 59th Annual Meeting of the Entomological Society of America AU - Blanco, Carlos AU - Beetham, Patricia Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Genetic engineering KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962346?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+regulatory+process+for+genetically+engineered+insects&rft.au=Blanco%2C+Carlos%3BBeetham%2C+Patricia&rft.aulast=Blanco&rft.aufirst=Carlos&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - USDA APHIS permits for arthropods of veterinary importance T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962331; 6061247 JF - 59th Annual Meeting of the Entomological Society of America AU - Letonja, Thomas Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - arthropods KW - Arthropoda KW - Aphis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962331?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=USDA+APHIS+permits+for+arthropods+of+veterinary+importance&rft.au=Letonja%2C+Thomas&rft.aulast=Letonja&rft.aufirst=Thomas&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - USDA APHIS containment facilities for high risk arthropods T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962245; 6061245 JF - 59th Annual Meeting of the Entomological Society of America AU - Sengupta, Ashima Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Containment KW - arthropods KW - Risk factors KW - Arthropoda KW - Aphis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962245?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=USDA+APHIS+containment+facilities+for+high+risk+arthropods&rft.au=Sengupta%2C+Ashima&rft.aulast=Sengupta&rft.aufirst=Ashima&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The USDA APHIS permitting process for plant pests and biocontrol agents T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312962232; 6061244 JF - 59th Annual Meeting of the Entomological Society of America AU - Stewart, Colin Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - pests KW - Biological control KW - Pest control KW - Aphis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312962232?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+USDA+APHIS+permitting+process+for+plant+pests+and+biocontrol+agents&rft.au=Stewart%2C+Colin&rft.aulast=Stewart&rft.aufirst=Colin&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Host preferences of the redbay ambrosia beetle (Xyleborus glabratus) in Florida T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312961666; 6062359 JF - 59th Annual Meeting of the Entomological Society of America AU - Kendra, Paul AU - Montgomery, Wayne AU - Niogret, Jerome AU - Pruett, Grechen AU - Ploetz, Randy AU - Epsky, Nancy AU - Heath, Robert Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA, Florida KW - Host preferences KW - Xyleborus KW - Ambrosia UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312961666?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Host+preferences+of+the+redbay+ambrosia+beetle+%28Xyleborus+glabratus%29+in+Florida&rft.au=Kendra%2C+Paul%3BMontgomery%2C+Wayne%3BNiogret%2C+Jerome%3BPruett%2C+Grechen%3BPloetz%2C+Randy%3BEpsky%2C+Nancy%3BHeath%2C+Robert&rft.aulast=Kendra&rft.aufirst=Paul&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - SiGNBP, a potential target for RNA interference-based pest control of Solenopsis invicta T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312956290; 6063185 JF - 59th Annual Meeting of the Entomological Society of America AU - Zhao, Liming AU - Chen, Jian Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Pest control KW - RNA KW - Solenopsis invicta UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312956290?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=SiGNBP%2C+a+potential+target+for+RNA+interference-based+pest+control+of+Solenopsis+invicta&rft.au=Zhao%2C+Liming%3BChen%2C+Jian&rft.aulast=Zhao&rft.aufirst=Liming&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - New pest-resistant sweetpotato cultivars from USDA, ARS T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312955895; 6062290 JF - 59th Annual Meeting of the Entomological Society of America AU - Jackson, Michael AU - Thies, Judy AU - Harrison, Howard Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - cultivars UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312955895?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=New+pest-resistant+sweetpotato+cultivars+from+USDA%2C+ARS&rft.au=Jackson%2C+Michael%3BThies%2C+Judy%3BHarrison%2C+Howard&rft.aulast=Jackson&rft.aufirst=Michael&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in North America - investigating the Q invasion T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312955836; 6062289 JF - 59th Annual Meeting of the Entomological Society of America AU - McKenzie, Cindy AU - Bethke, James AU - Byrne, Frank AU - Chamberlin, Joe AU - Dennehy, Timothy AU - Gilrein, Daniel AU - Ludwig, Scott AU - Oetting, Ron AU - Osborne, Lance AU - Schmale, Lin AU - Shatters, Robert Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - North America KW - biotypes KW - invasions KW - Biotypes KW - Aleyrodidae KW - Bemisia tabaci KW - Hemiptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312955836?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Distribution+of+Bemisia+tabaci+%28Hemiptera%3A+Aleyrodidae%29+biotypes+in+North+America+-+investigating+the+Q+invasion&rft.au=McKenzie%2C+Cindy%3BBethke%2C+James%3BByrne%2C+Frank%3BChamberlin%2C+Joe%3BDennehy%2C+Timothy%3BGilrein%2C+Daniel%3BLudwig%2C+Scott%3BOetting%2C+Ron%3BOsborne%2C+Lance%3BSchmale%2C+Lin%3BShatters%2C+Robert&rft.aulast=McKenzie&rft.aufirst=Cindy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Impact of the agricultural landscape on pollinator movement: a case study using insect pollinators of alfalfa T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312954525; 6061326 JF - 59th Annual Meeting of the Entomological Society of America AU - Brunet, Johanne AU - Van Etten, Megan Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - case studies KW - Agricultural land KW - alfalfa KW - insects KW - Pollinators KW - Landscape KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312954525?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Impact+of+the+agricultural+landscape+on+pollinator+movement%3A+a+case+study+using+insect+pollinators+of+alfalfa&rft.au=Brunet%2C+Johanne%3BVan+Etten%2C+Megan&rft.aulast=Brunet&rft.aufirst=Johanne&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A global biological control index for Trichogramma and other beneficials in mass-rearing T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312949918; 6062112 JF - 59th Annual Meeting of the Entomological Society of America AU - Greenburg, Shoil Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Trichogramma UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312949918?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+global+biological+control+index+for+Trichogramma+and+other+beneficials+in+mass-rearing&rft.au=Greenburg%2C+Shoil&rft.aulast=Greenburg&rft.aufirst=Shoil&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Caterpillar feeding resonses to sorghum leaves with altered lignin T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312944243; 6062292 JF - 59th Annual Meeting of the Entomological Society of America AU - Sattler, Scott AU - Dowd, Patrick AU - Pedersen, Jeffery Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - feeding KW - Feeding KW - Lignin KW - Leaves KW - Sorghum UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312944243?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Caterpillar+feeding+resonses+to+sorghum+leaves+with+altered+lignin&rft.au=Sattler%2C+Scott%3BDowd%2C+Patrick%3BPedersen%2C+Jeffery&rft.aulast=Sattler&rft.aufirst=Scott&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Biological control of the invasive weed Brazilian pepper with Gracillariidae species of leaf blotchers T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312943819; 6062507 JF - 59th Annual Meeting of the Entomological Society of America AU - Wheeler, Gregory AU - McKay, F AU - Davis, Don Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - weeds KW - Leaves KW - Weeds KW - Introduced species KW - Gracillariidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312943819?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Biological+control+of+the+invasive+weed+Brazilian+pepper+with+Gracillariidae+species+of+leaf+blotchers&rft.au=Wheeler%2C+Gregory%3BMcKay%2C+F%3BDavis%2C+Don&rft.aulast=Wheeler&rft.aufirst=Gregory&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Applied genomics for the control of corn insect pests T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312943184; 6061230 JF - 59th Annual Meeting of the Entomological Society of America AU - Coates, Brad AU - Hellmich, Richard AU - Siegfried, Blair AU - Abel, Craig Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - pests KW - corn KW - insects KW - genomics KW - Pest control KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312943184?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Applied+genomics+for+the+control+of+corn+insect+pests&rft.au=Coates%2C+Brad%3BHellmich%2C+Richard%3BSiegfried%2C+Blair%3BAbel%2C+Craig&rft.aulast=Coates&rft.aufirst=Brad&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - New upgrades and procedures to improve operations in an invasive insect and biocontrol quarantine T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312920651; 6063105 JF - 59th Annual Meeting of the Entomological Society of America AU - Bancroft, Jay Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Quarantine KW - Biological control KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312920651?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=New+upgrades+and+procedures+to+improve+operations+in+an+invasive+insect+and+biocontrol+quarantine&rft.au=Bancroft%2C+Jay&rft.aulast=Bancroft&rft.aufirst=Jay&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Quarantine and biocontrol issues when agents are geared for distant release T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312920609; 6063104 JF - 59th Annual Meeting of the Entomological Society of America AU - Goolsby, John Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Quarantine KW - Biological control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312920609?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Quarantine+and+biocontrol+issues+when+agents+are+geared+for+distant+release&rft.au=Goolsby%2C+John&rft.aulast=Goolsby&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Challenges with starting up a new insect quarantine rearing facility T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312920582; 6063103 JF - 59th Annual Meeting of the Entomological Society of America AU - Milbrath, Lindsey AU - Hajek, Ann Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Quarantine KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312920582?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Challenges+with+starting+up+a+new+insect+quarantine+rearing+facility&rft.au=Milbrath%2C+Lindsey%3BHajek%2C+Ann&rft.aulast=Milbrath&rft.aufirst=Lindsey&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Biological differences between populations of Rhipicephalus (Boophilus) microplus collected from white-tailed deer and from cattle T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312919375; 6062789 JF - 59th Annual Meeting of the Entomological Society of America AU - Scoles, Glen AU - Davey, Ronald AU - Olafson, Pia AU - Busch, Joseph AU - Wagner, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Cattle KW - deer KW - Boophilus microplus KW - Rhipicephalus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312919375?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Biological+differences+between+populations+of+Rhipicephalus+%28Boophilus%29+microplus+collected+from+white-tailed+deer+and+from+cattle&rft.au=Scoles%2C+Glen%3BDavey%2C+Ronald%3BOlafson%2C+Pia%3BBusch%2C+Joseph%3BWagner%2C+David&rft.aulast=Scoles&rft.aufirst=Glen&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Comparative modeling for the development of quarantine treatments T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312919132; 6062901 JF - 59th Annual Meeting of the Entomological Society of America AU - Neven, Lisa AU - Johnson, Shelley Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Quarantine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312919132?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Comparative+modeling+for+the+development+of+quarantine+treatments&rft.au=Neven%2C+Lisa%3BJohnson%2C+Shelley&rft.aulast=Neven&rft.aufirst=Lisa&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Pharmacological modulation of blood feeding and egg-laying behaviors in the southern cattle tick Rhipicephalus microplus T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312918507; 6063176 JF - 59th Annual Meeting of the Entomological Society of America AU - Li, Andrew Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Cattle KW - feeding KW - Feeding behavior KW - Blood KW - Ixodidae KW - Rhipicephalus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312918507?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Pharmacological+modulation+of+blood+feeding+and+egg-laying+behaviors+in+the+southern+cattle+tick+Rhipicephalus+microplus&rft.au=Li%2C+Andrew&rft.aulast=Li&rft.aufirst=Andrew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Tracking honey bee (Apis mellifera) movement with protein markers to enhance gene flow evaluations T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312917624; 6062917 JF - 59th Annual Meeting of the Entomological Society of America AU - Hagler, James AU - Mueller, Shannon AU - Teuber, Larry Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Gene flow KW - Tracking KW - Apis mellifera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312917624?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Tracking+honey+bee+%28Apis+mellifera%29+movement+with+protein+markers+to+enhance+gene+flow+evaluations&rft.au=Hagler%2C+James%3BMueller%2C+Shannon%3BTeuber%2C+Larry&rft.aulast=Hagler&rft.aufirst=James&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - A study of the gall midges (Diptera: Cecidomyiidae) on hackberries (Celtis: Ulmaceae) in North America T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312917355; 6062911 JF - 59th Annual Meeting of the Entomological Society of America AU - Moser, John AU - Gagne, Raymond Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - North America KW - Aquatic insects KW - Ulmaceae KW - Celtis KW - Diptera KW - Cecidomyiidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312917355?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=A+study+of+the+gall+midges+%28Diptera%3A+Cecidomyiidae%29+on+hackberries+%28Celtis%3A+Ulmaceae%29+in+North+America&rft.au=Moser%2C+John%3BGagne%2C+Raymond&rft.aulast=Moser&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Searching for baits with insect growth regulating effects on an invasive crazy ant, Nylanderia pubens T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312915958; 6063188 JF - 59th Annual Meeting of the Entomological Society of America AU - Oi, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Bait KW - Aquatic insects KW - Growth KW - Formicidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312915958?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Searching+for+baits+with+insect+growth+regulating+effects+on+an+invasive+crazy+ant%2C+Nylanderia+pubens&rft.au=Oi%2C+David&rft.aulast=Oi&rft.aufirst=David&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Potential use of Solenopsis invicta viruses to control fire ants T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312915927; 6063187 JF - 59th Annual Meeting of the Entomological Society of America AU - Valles, Steven Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Fires KW - Viruses KW - Solenopsis invicta KW - Formicidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312915927?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Potential+use+of+Solenopsis+invicta+viruses+to+control+fire+ants&rft.au=Valles%2C+Steven&rft.aulast=Valles&rft.aufirst=Steven&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Can almond and pistachio orchard volatile emissions help control the navel orangeworm (Amyelois transitella)? T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312915506; 6062438 JF - 59th Annual Meeting of the Entomological Society of America AU - Beck, John AU - Higbee, Bradley AU - Gee, Wai AU - Hayashi, Jennifer Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - orchards KW - Emissions KW - Volatiles KW - Orchards KW - Umbilicus KW - Prunus dulcis KW - Amyelois transitella UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312915506?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Can+almond+and+pistachio+orchard+volatile+emissions+help+control+the+navel+orangeworm+%28Amyelois+transitella%29%3F&rft.au=Beck%2C+John%3BHigbee%2C+Bradley%3BGee%2C+Wai%3BHayashi%2C+Jennifer&rft.aulast=Beck&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Relationships of host plant phylogeny, plant chemistry and host plant specificity of a prospective biological control agent of yellow starthistle T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914857; 6062511 JF - 59th Annual Meeting of the Entomological Society of America AU - Smith, Lincoln AU - Beck, John AU - Gaskin, John Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Host plants KW - Biological control KW - phylogeny KW - Phylogeny KW - Specificity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914857?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Relationships+of+host+plant+phylogeny%2C+plant+chemistry+and+host+plant+specificity+of+a+prospective+biological+control+agent+of+yellow+starthistle&rft.au=Smith%2C+Lincoln%3BBeck%2C+John%3BGaskin%2C+John&rft.aulast=Smith&rft.aufirst=Lincoln&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Molecular analysis of host-specificity in plant-feeding insects: phylogenetics and phylogeography of Fergusonina flies on Australian paperbarks T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914798; 6062826 JF - 59th Annual Meeting of the Entomological Society of America AU - Scheffer, Sonja AU - Giblin-Davis, Robin AU - Purcell, Matt AU - Davies, Kerrie AU - Taylor, Gary AU - Center, Ted Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Australia KW - insects KW - Phylogenetics KW - Aquatic insects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914798?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Molecular+analysis+of+host-specificity+in+plant-feeding+insects%3A+phylogenetics+and+phylogeography+of+Fergusonina+flies+on+Australian+paperbarks&rft.au=Scheffer%2C+Sonja%3BGiblin-Davis%2C+Robin%3BPurcell%2C+Matt%3BDavies%2C+Kerrie%3BTaylor%2C+Gary%3BCenter%2C+Ted&rft.aulast=Scheffer&rft.aufirst=Sonja&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Potential for microbial control of Asian ambrosia beetles in the genus Xylosandrus T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914546; 6062604 JF - 59th Annual Meeting of the Entomological Society of America AU - Vandenberg, John AU - Castrillo, Louela AU - Griggs, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Zoology KW - Xylosandrus KW - Ambrosia UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914546?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Potential+for+microbial+control+of+Asian+ambrosia+beetles+in+the+genus+Xylosandrus&rft.au=Vandenberg%2C+John%3BCastrillo%2C+Louela%3BGriggs%2C+Michael&rft.aulast=Vandenberg&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Viral sequence polymorphism as a surrogate data set to assess attributes of an invasive insect population T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914323; 6062342 JF - 59th Annual Meeting of the Entomological Society of America AU - Stenger, Drake AU - Sisterson, Mark AU - French, Roy Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - insects KW - Data processing KW - Public health KW - Aquatic insects KW - Population genetics KW - Biopolymorphism UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914323?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Viral+sequence+polymorphism+as+a+surrogate+data+set+to+assess+attributes+of+an+invasive+insect+population&rft.au=Stenger%2C+Drake%3BSisterson%2C+Mark%3BFrench%2C+Roy&rft.aulast=Stenger&rft.aufirst=Drake&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Novel semiochemical roles for honey bee brood volatiles T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914170; 6062083 JF - 59th Annual Meeting of the Entomological Society of America AU - Carroll, Mark Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Volatiles KW - Semiochemicals KW - Apis mellifera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914170?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Novel+semiochemical+roles+for+honey+bee+brood+volatiles&rft.au=Carroll%2C+Mark&rft.aulast=Carroll&rft.aufirst=Mark&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Exploring the genetic basis for movement behavior in Ostrinia nubilalis: insights into the molecular mechanisms of behavioral transition in the European corn borer T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914152; 6062226 JF - 59th Annual Meeting of the Entomological Society of America AU - Kroemer, Jeremy AU - Rausch, Michael AU - Kroemer, Tyasning AU - Moser, Susan AU - Schrum, Elizabeth AU - Hellmich, Richard Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - corn KW - Molecular modelling KW - Borers KW - Ostrinia nubilalis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914152?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Exploring+the+genetic+basis+for+movement+behavior+in+Ostrinia+nubilalis%3A+insights+into+the+molecular+mechanisms+of+behavioral+transition+in+the+European+corn+borer&rft.au=Kroemer%2C+Jeremy%3BRausch%2C+Michael%3BKroemer%2C+Tyasning%3BMoser%2C+Susan%3BSchrum%2C+Elizabeth%3BHellmich%2C+Richard&rft.aulast=Kroemer&rft.aufirst=Jeremy&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Small hive beetle volatile attraction and the evolution of a colony parasite T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914127; 6062082 JF - 59th Annual Meeting of the Entomological Society of America AU - Duehl, Adrian Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Parasites KW - Volatiles KW - Colonies KW - Evolution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914127?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Small+hive+beetle+volatile+attraction+and+the+evolution+of+a+colony+parasite&rft.au=Duehl%2C+Adrian&rft.aulast=Duehl&rft.aufirst=Adrian&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Identification of three general odorant binding proteins expressed in codling moth antennae T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914027; 6062223 JF - 59th Annual Meeting of the Entomological Society of America AU - Garczynski, Stephen Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Odors KW - Antennae KW - Odorant-binding protein UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914027?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Identification+of+three+general+odorant+binding+proteins+expressed+in+codling+moth+antennae&rft.au=Garczynski%2C+Stephen&rft.aulast=Garczynski&rft.aufirst=Stephen&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Soldier influences on candidate primer pheromone levels, gene expression and caste differentiation in workers of R. flavipes termites T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312914008; 6062080 JF - 59th Annual Meeting of the Entomological Society of America AU - Tarver, Matthew AU - Scharf, Michael Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Military KW - Gene expression KW - Pheromones KW - Primers KW - Soldiers KW - Caste differentiation KW - Isoptera UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312914008?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Soldier+influences+on+candidate+primer+pheromone+levels%2C+gene+expression+and+caste+differentiation+in+workers+of+R.+flavipes+termites&rft.au=Tarver%2C+Matthew%3BScharf%2C+Michael&rft.aulast=Tarver&rft.aufirst=Matthew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Acoustic and pheromone trap surveys of red palm weevil (Rhynchophorus ferrugineus) in Curacao T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312913988; 6062222 JF - 59th Annual Meeting of the Entomological Society of America AU - Mankin, Richard AU - Fiaboe, K AU - Roda, Amy AU - Kairo, Moses Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Acoustics KW - Pheromone traps KW - Pheromones KW - Rhynchophorus ferrugineus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312913988?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Acoustic+and+pheromone+trap+surveys+of+red+palm+weevil+%28Rhynchophorus+ferrugineus%29+in+Curacao&rft.au=Mankin%2C+Richard%3BFiaboe%2C+K%3BRoda%2C+Amy%3BKairo%2C+Moses&rft.aulast=Mankin&rft.aufirst=Richard&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Challenges in rearing Cecidomyiidae for applied weed biocontrol programs T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312913953; 6063107 JF - 59th Annual Meeting of the Entomological Society of America AU - Hansen, Richard Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - weeds KW - Biological control KW - Weeds KW - Cecidomyiidae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312913953?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Challenges+in+rearing+Cecidomyiidae+for+applied+weed+biocontrol+programs&rft.au=Hansen%2C+Richard&rft.aulast=Hansen&rft.aufirst=Richard&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Identification and characterization of the Lygus hesperus sex peptide receptor T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312913779; 6062219 JF - 59th Annual Meeting of the Entomological Society of America AU - Hull, Joe Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Sex KW - Peptides KW - Lygus hesperus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312913779?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Identification+and+characterization+of+the+Lygus+hesperus+sex+peptide+receptor&rft.au=Hull%2C+Joe&rft.aulast=Hull&rft.aufirst=Joe&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Biodiversity and biological control from an omnivore's point of view T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312913163; 6062728 JF - 59th Annual Meeting of the Entomological Society of America AU - Lundgren, Jonathan Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Biological diversity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312913163?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Biodiversity+and+biological+control+from+an+omnivore%27s+point+of+view&rft.au=Lundgren%2C+Jonathan&rft.aulast=Lundgren&rft.aufirst=Jonathan&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Host plant resistance in citrus germplasm to the Asian citrus psyllid, Diaphorina citri T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312912957; 6062443 JF - 59th Annual Meeting of the Entomological Society of America AU - Richardson, Matthew AU - Westbrook, Catherine AU - Hall, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Host plants KW - Germplasm KW - Citrus KW - Diaphorina citri UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312912957?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Host+plant+resistance+in+citrus+germplasm+to+the+Asian+citrus+psyllid%2C+Diaphorina+citri&rft.au=Richardson%2C+Matthew%3BWestbrook%2C+Catherine%3BHall%2C+David&rft.aulast=Richardson&rft.aufirst=Matthew&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Enhanced phosphine toxicity by oxygen and its implications for postharvest pest control T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312912845; 6061316 JF - 59th Annual Meeting of the Entomological Society of America AU - Liu, Yong-Biao Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Toxicity KW - Oxygen KW - Pest control KW - phosphine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312912845?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Enhanced+phosphine+toxicity+by+oxygen+and+its+implications+for+postharvest+pest+control&rft.au=Liu%2C+Yong-Biao&rft.aulast=Liu&rft.aufirst=Yong-Biao&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Lessons for biofuels from the experience with invasive giant reed and its biological control T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312911981; 6061184 JF - 59th Annual Meeting of the Entomological Society of America AU - Goolsby, John AU - Moran, Patrick AU - Racelis, Alex AU - Kirk, Alan AU - Yang, Chenghai AU - Adamczyk, John J AU - Ciomperlik, Matt AU - Manhart, James AU - Pepper, Alan AU - Tarin, Daniel AU - Vaughan, Tom AU - Rubio, Amede AU - Lacewell, Ron AU - Cortes Mendoza, Elena AU - Marcos-Garcia, Mariangeles AU - Martinez Jimenez, Maricela Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Biological control KW - Fuel technology KW - biofuels KW - Biofuels UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312911981?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Lessons+for+biofuels+from+the+experience+with+invasive+giant+reed+and+its+biological+control&rft.au=Goolsby%2C+John%3BMoran%2C+Patrick%3BRacelis%2C+Alex%3BKirk%2C+Alan%3BYang%2C+Chenghai%3BAdamczyk%2C+John+J%3BCiomperlik%2C+Matt%3BManhart%2C+James%3BPepper%2C+Alan%3BTarin%2C+Daniel%3BVaughan%2C+Tom%3BRubio%2C+Amede%3BLacewell%2C+Ron%3BCortes+Mendoza%2C+Elena%3BMarcos-Garcia%2C+Mariangeles%3BMartinez+Jimenez%2C+Maricela&rft.aulast=Goolsby&rft.aufirst=John&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The context of biofuels within the national policy framework T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312911942; 6061183 JF - 59th Annual Meeting of the Entomological Society of America AU - Steiner, Jeffrey Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - Fuel technology KW - biofuels KW - Biofuels KW - Policies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312911942?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=The+context+of+biofuels+within+the+national+policy+framework&rft.au=Steiner%2C+Jeffrey&rft.aulast=Steiner&rft.aufirst=Jeffrey&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Phenology of Sirex noctilio development and adult emergence in the northeastern United States T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312911799; 6061487 JF - 59th Annual Meeting of the Entomological Society of America AU - Myers, Scott AU - Zylstra, Kelley Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - USA KW - phenology KW - Phenology KW - Noctilio KW - Sirex UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312911799?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Phenology+of+Sirex+noctilio+development+and+adult+emergence+in+the+northeastern+United+States&rft.au=Myers%2C+Scott%3BZylstra%2C+Kelley&rft.aulast=Myers&rft.aufirst=Scott&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Miscanthus invasion biology T2 - 59th Annual Meeting of the Entomological Society of America AN - 1312903436; 6061187 JF - 59th Annual Meeting of the Entomological Society of America AU - Davis, Adam AU - Matlaga, David Y1 - 2011/11/13/ PY - 2011 DA - 2011 Nov 13 KW - invasions KW - Miscanthus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312903436?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.atitle=Miscanthus+invasion+biology&rft.au=Davis%2C+Adam%3BMatlaga%2C+David&rft.aulast=Davis&rft.aufirst=Adam&rft.date=2011-11-13&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=59th+Annual+Meeting+of+the+Entomological+Society+of+America&rft.issn=&rft_id=info:doi/ L2 - http://esa.confex.com/esa/2011/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Folate depletion differentially affects the interrelationship between folate, choline and acetylcholine metabolism in young and adult rats T2 - 2011 Annual meeting of the Society for Neuroscience (Neuroscience 2011) AN - 1313091351; 6103323 JF - 2011 Annual meeting of the Society for Neuroscience (Neuroscience 2011) AU - Crivello, N AU - Shaul, M AU - Shukitt-Hale, B AU - Dobson, B AU - Gomes, S AU - Blusztajn, K AU - Rosenberg, I Y1 - 2011/11/12/ PY - 2011 DA - 2011 Nov 12 KW - Metabolism KW - Rats KW - Folic acid KW - Acetylcholine KW - Choline KW - Neurotransmitters UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313091351?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+meeting+of+the+Society+for+Neuroscience+%28Neuroscience+2011%29&rft.atitle=Folate+depletion+differentially+affects+the+interrelationship+between+folate%2C+choline+and+acetylcholine+metabolism+in+young+and+adult+rats&rft.au=Crivello%2C+N%3BShaul%2C+M%3BShukitt-Hale%2C+B%3BDobson%2C+B%3BGomes%2C+S%3BBlusztajn%2C+K%3BRosenberg%2C+I&rft.aulast=Crivello&rft.aufirst=N&rft.date=2011-11-12&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+meeting+of+the+Society+for+Neuroscience+%28Neuroscience+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.sfn.org/am2011/index.aspx?pagename=final_program LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - JOUR T1 - Difficult Lessons Learned in Measuring Stage and Flow Rate on Small Watersheds AN - 968171872; 16414552 AB - Submersible pressure transducers integrated with data loggers are commonly used to measure stage (water level) and estimate flow rate from established stage-discharge relationships; however, proper data quality assurance is important to reduce uncertainty in resulting estimates. For 2 yr, USDA-ARS researchers in Watkinsville, Georgia, continuously monitored flow rate from a spring using a flume fitted with a pressure transducer and data logger and performed periodic manual flow rate checks. Initially, during a 162-day period in 2003 with 72 comparisons, the automated system underestimated the mean flow rate by approximately 17% due to presumed drift and lack of frequent calibration. After calibrating the transducer to adjust for drift with the data logger program, 66 comparisons during a 349-day period in 2004 showed that the difference in mean flow rate between the manual and automated estimates was < 5%. During 235 days late in the monitoring period, the automated system overestimated the mean flow rate by approximately 29% because of another apparent drift. In a similar set-up at a pond outflow, a drift of 32 mm in transducer output caused underestimation of pond outflow by 27% during a 30-day period. Users should not assume that pressure transducer-based automated water level measurement systems continuously record correct data. Routine verification of transducer output is crucial to avoid inaccurate (and possibly useless) stage and flow rate estimates. JF - Applied Engineering in Agriculture AU - Endale, D M AU - Fisher, D S AU - Jenkins, M B AU - Schomberg, H H AD - Natural Resource Conservation Center, Watkinsville, Georgia, Dinku.Endale@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 933 EP - 936 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 27 IS - 6 SN - 0883-8542, 0883-8542 KW - Meteorological & Geoastrophysical Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Aqualine Abstracts KW - Agriculture KW - Submersibles KW - Quality assurance KW - Automation KW - Quality Assurance KW - Watersheds KW - Water level measurement KW - Ponds KW - Data loggers KW - USA, Georgia, Watkinsville KW - Flow Rates KW - Calibrations KW - Manuals KW - Transducers KW - USA, Georgia KW - Water Level KW - Monitoring KW - Small Watersheds KW - AQ 00001:Water Resources and Supplies KW - Q2 09202:Methods and instruments KW - M2 551.5:General (551.5) KW - SW 6010:Structures UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/968171872?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Engineering+in+Agriculture&rft.atitle=Difficult+Lessons+Learned+in+Measuring+Stage+and+Flow+Rate+on+Small+Watersheds&rft.au=Endale%2C+D+M%3BFisher%2C+D+S%3BJenkins%2C+M+B%3BSchomberg%2C+H+H&rft.aulast=Endale&rft.aufirst=D&rft.date=2011-11-01&rft.volume=27&rft.issue=6&rft.spage=933&rft.isbn=&rft.btitle=&rft.title=Applied+Engineering+in+Agriculture&rft.issn=08838542&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Number of references - 9 N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Transducers; Submersibles; Quality assurance; Watersheds; Water level measurement; Manuals; Ponds; Data loggers; Agriculture; Calibrations; Flow Rates; Quality Assurance; Automation; Water Level; Small Watersheds; Monitoring; USA, Georgia, Watkinsville; USA, Georgia ER - TY - JOUR T1 - Cattle Selection for Aspen and Meadow Vegetation: Implications for Restoration AN - 954660807; 16388505 AB - There is concern over the decline of aspen and the lack of successful regeneration due to excessive browsing of aspen suckers by cattle and other wild and domestic ungulates. We conducted a 2-yr study on Lassen National Forest, California, to aid development of cattle grazing strategies to enhance aspen regeneration. We evaluated seasonal biomass, nutritional quality, and utilization by cattle of aspen suckers, aspen herbaceous understory vegetation, and meadow herbaceous vegetation within six aspen-meadow complexes. Aspen suckers had greater nutritional quality compared to aspen understory and meadow vegetation regardless of season or year. Nutritional quality declined with season in all three vegetation types. Early-growing season foraging by cattle focused on meadow and aspen understory vegetation. Mid-growing season decreases in meadow and aspen understory nutritional quality coincided with a marked increase in utilization of aspen suckers. By late-growing season, utilization on aspen suckers was significantly greater than aspen understory or meadow vegetation. Managers can use early-growing season grazing to reduce aspen consumption by cattle, set stocking rates so that adequate herbaceous vegetation is available throughout the growing season, provide nutritional supplements to reduce demand for nutritious aspen suckers, construct protective fencing, and implement grazing systems that insure years with mid- and late-growing season rest from heavy browsing. JF - Rangeland Ecology & Management AU - Jones, Bobette E AU - Lile, David F AU - Tate, Kenneth W AD - District Ecologist, United States Forest Service, Eagle Lake Ranger District, Lassen National Forest, Susanville, CA 96130, USA, kwtate@ucdavis.edu Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 625 EP - 632 PB - Society for Range Management VL - 64 IS - 6 SN - 1550-7424, 1550-7424 KW - Ecology Abstracts KW - Rangelands KW - Ungulates KW - Grazing KW - Meadows KW - Dietary supplements KW - Browsing KW - Stocking rates KW - Vegetation KW - Biomass KW - Understory KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954660807?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Rangeland+Ecology+%26+Management&rft.atitle=Cattle+Selection+for+Aspen+and+Meadow+Vegetation%3A+Implications+for+Restoration&rft.au=Jones%2C+Bobette+E%3BLile%2C+David+F%3BTate%2C+Kenneth+W&rft.aulast=Jones&rft.aufirst=Bobette&rft.date=2011-11-01&rft.volume=64&rft.issue=6&rft.spage=625&rft.isbn=&rft.btitle=&rft.title=Rangeland+Ecology+%26+Management&rft.issn=15507424&rft_id=info:doi/10.2111%2FREM-D-10-00089.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 64 N1 - Last updated - 2013-06-28 N1 - SubjectsTermNotLitGenreText - Rangelands; Ungulates; Grazing; Dietary supplements; Meadows; Browsing; Stocking rates; Vegetation; Biomass; Understory DO - http://dx.doi.org/10.2111/REM-D-10-00089.1 ER - TY - JOUR T1 - Effect of Modification of the NI Artificial Diet on the Biological Fitness Parameters of Mass Reared Western Tarnished Plant Bug, Lygus hesperus AN - 954655923; 16386697 AB - The NI artificial diet is the only known successful diet for mass rearing the western tarnished plant bug, Lygus hesperus Knight (Hemiptera: Miridae). This diet has been used for more than a decade. However, because it contains cooked chicken egg, and thus requires laborious preparation (Cohen 2000), this diet is difficult to use. Three modifications (D1, D2, D3) of the NI diet were investigated in hopes of developing a more easily prepared diet that avoids the cooked egg and improves mass fitness parameters of L. hesperus. The modified D3 diet, containing autoclaved chicken egg yolk based component, had the highest egg/cage/day production (13120 +/- 812 SE). This was significantly greater than diets D1, containing autoclaved dry chicken egg yolk based component (9027 +/- 811 SE), D2, containing autoclaved chicken egg white based component (8311 +/- 628 SE), and NI, which contained autoclaved chicken egg yolk + cooked egg diet (7890 +/- 761 SE). Significant differences were observed in the weights of all developmental stages except for eggs and first instar nymphs. Higher rates of fertility, hatchability, and low mortality in nymphs during the first instar were also obtained in the modified D3 diet. The results clearly indicated that the D3 diet provided an opportunity to significantly reduce rearing cost by avoiding time-consuming issues with preparation of a cooked egg diet. This should result in an increase in production capacity and a reduction in production costs. JF - Journal of Insect Science (Tucson) AU - Portilla, Maribel AU - Snodgrass, Gordon AU - Streett, Doug AD - United States Department of Agriculture, Agricultural Research Service, USA, maribel.portilla@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1 EP - 10 PB - University of Wisconsin Library, 1510 East University Tucson AZ 85721-0055 United States VL - 11 IS - 149 SN - 1536-2442, 1536-2442 KW - Ecology Abstracts; Entomology Abstracts KW - Diets KW - Fitness KW - Mortality KW - Fertility KW - Mass rearing KW - Artificial diets KW - Developmental stages KW - Miridae KW - Hemiptera KW - Yolk KW - Albumen KW - Lygus hesperus KW - Hatchability KW - Z 05300:General KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954655923?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Insect+Science+%28Tucson%29&rft.atitle=Effect+of+Modification+of+the+NI+Artificial+Diet+on+the+Biological+Fitness+Parameters+of+Mass+Reared+Western+Tarnished+Plant+Bug%2C+Lygus+hesperus&rft.au=Portilla%2C+Maribel%3BSnodgrass%2C+Gordon%3BStreett%2C+Doug&rft.aulast=Portilla&rft.aufirst=Maribel&rft.date=2011-11-01&rft.volume=11&rft.issue=149&rft.spage=1&rft.isbn=&rft.btitle=&rft.title=Journal+of+Insect+Science+%28Tucson%29&rft.issn=15362442&rft_id=info:doi/10.1673%2F031.011.14901 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2012-04-06 N1 - SubjectsTermNotLitGenreText - Fitness; Diets; Mortality; Fertility; Albumen; Mass rearing; Artificial diets; Hatchability; Developmental stages; Yolk; Lygus hesperus; Miridae; Hemiptera DO - http://dx.doi.org/10.1673/031.011.14901 ER - TY - JOUR T1 - Feeding Preference for and Impact on an Invasive Weed (Crepis tectorum) by a Native, Generalist Insect Herbivore, Melanoplus borealis (Orthoptera: Acrididae) AN - 954652585; 16387653 AB - Crepis tectorum L., narrow leaf hawksbeard, first was collected in Alaska in 1974 and by 2004 was a common weed in agricultural fields. Introduction and establishment of a new plant species in a region represents a potential new resource for herbivores, as well as a new competitor for plant species already present. Objectives of this study were to determine the preference for C. tectorum, relative to other common plant species, by Melanoplus borealis (Fieber), a generalist herbivore grasshopper common in Alaska, and to determine the potential impact of grasshoppers on this weed. In choice tests, M. borealis preferred C. tectorum over two native forbs, and a grass species, but dandelion, Taraxacum officinale G. H. Weber ex Wiggers, was preferred over C. tectorum. In field cages, in each of 3 yr, grasshoppers reduced biomass of mature plants, flowers, and seedlings of C. tectorum, but not other forbs. We conclude that this weed is a readily accepted new food resource for generalist-feeding grasshoppers, and although grasshoppers could potentially limit seed production of C. tectorum, generally grasshopper densities are not high enough to have significant impact on the weed populations. JF - Annals of the Entomological Society of America AU - Fielding, Dennis J AU - Conn, Jeffery S AD - USDA-ARS Subarctic Agricultural Research Unit, P. O. Box 757200, Fairbanks, AK 99775, dennis.fielding@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 1303 EP - 1308 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 104 IS - 6 SN - 0013-8746, 0013-8746 KW - Animal Behavior Abstracts; Ecology Abstracts; Entomology Abstracts KW - grasshopper KW - invasive plant KW - AK KW - Weeds KW - Feeding KW - Seeds KW - Flowers KW - Grasses KW - Forbs KW - Leaves KW - Melanoplus KW - Biomass KW - Taraxacum officinale KW - Acrididae KW - Crepis tectorum KW - Herbivores KW - Orthoptera KW - Seedlings KW - Z 05340:Ecology and Behavior KW - D 04040:Ecosystem and Ecology Studies KW - Y 25030:Foraging and Ingestion UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954652585?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annals+of+the+Entomological+Society+of+America&rft.atitle=Feeding+Preference+for+and+Impact+on+an+Invasive+Weed+%28Crepis+tectorum%29+by+a+Native%2C+Generalist+Insect+Herbivore%2C+Melanoplus+borealis+%28Orthoptera%3A+Acrididae%29&rft.au=Fielding%2C+Dennis+J%3BConn%2C+Jeffery+S&rft.aulast=Fielding&rft.aufirst=Dennis&rft.date=2011-11-01&rft.volume=104&rft.issue=6&rft.spage=1303&rft.isbn=&rft.btitle=&rft.title=Annals+of+the+Entomological+Society+of+America&rft.issn=00138746&rft_id=info:doi/10.1603%2FAN10151 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 22 N1 - Last updated - 2016-03-17 N1 - SubjectsTermNotLitGenreText - Feeding; Weeds; Flowers; Seeds; Herbivores; Grasses; Forbs; Leaves; Seedlings; Biomass; Crepis tectorum; Acrididae; Orthoptera; Melanoplus; Taraxacum officinale DO - http://dx.doi.org/10.1603/AN10151 ER - TY - JOUR T1 - Foraging Range of Honey Bees, Apis mellifera, in Alfalfa Seed Production Fields AN - 954652572; 16386692 AB - A study was conducted in 2006 and 2007 designed to examine the foraging range of honey bees, Apis mellifera (Hymenoptera: Apidae), in a 15.2 km2 area dominated by a 128.9 ha glyphosate-resistant Roundup Ready registered alfalfa seed production field and several non-Roundup Ready alfalfa seed production fields (totaling 120.2 ha). Each year, honey bee self-marking devices were placed on 112 selected honey bee colonies originating from nine different apiary locations. The foraging bees exiting each apiary location were uniquely marked so that the apiary of origin and the distance traveled by the marked (field-collected) bees into each of the alfalfa fields could be pinpointed. Honey bee self-marking devices were installed on 14.4 and 11.2% of the total hives located within the research area in 2006 and 2007, respectively. The frequency of field-collected bees possessing a distinct mark was similar, averaging 14.0% in 2006 and 12.6% in 2007. A grand total of 12,266 bees were collected from the various alfalfa fields on seven sampling dates over the course of the study. The distances traveled by marked bees ranged from a minimum of 45 m to a maximum of 5983 m. On average, marked bees were recovered similar to 800 m from their apiary of origin and the recovery rate of marked bees decreased exponentially as the distance from the apiary of origin increased. Ultimately, these data will be used to identify the extent of pollen-mediated gene flow from Roundup Ready to conventional alfalfa. JF - Journal of Insect Science (Tucson) AU - Hagler, James R AU - Mueller, Shannon AU - Teuber, Larry R AU - Machtley, Scott A AU - Van Deynze, Allen AD - Arid Land Agricultural Research Center, USDA-ARS, 21881 North Cardon Lane, Maricopa, AZ, 85138 USA, james.hagler@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1 EP - 12 PB - University of Wisconsin Library, 1510 East University Tucson AZ 85721-0055 United States VL - 11 IS - 144 SN - 1536-2442, 1536-2442 KW - Animal Behavior Abstracts; Ecology Abstracts; Entomology Abstracts KW - Seeds KW - Colonies KW - Data processing KW - Gene flow KW - Apis mellifera KW - Sampling KW - Hymenoptera KW - Apidae KW - Y 25150:General/Miscellaneous KW - Z 05300:General KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954652572?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Insect+Science+%28Tucson%29&rft.atitle=Foraging+Range+of+Honey+Bees%2C+Apis+mellifera%2C+in+Alfalfa+Seed+Production+Fields&rft.au=Hagler%2C+James+R%3BMueller%2C+Shannon%3BTeuber%2C+Larry+R%3BMachtley%2C+Scott+A%3BVan+Deynze%2C+Allen&rft.aulast=Hagler&rft.aufirst=James&rft.date=2011-11-01&rft.volume=11&rft.issue=144&rft.spage=1&rft.isbn=&rft.btitle=&rft.title=Journal+of+Insect+Science+%28Tucson%29&rft.issn=15362442&rft_id=info:doi/10.1673%2F031.011.14401 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 25 N1 - Last updated - 2012-05-07 N1 - SubjectsTermNotLitGenreText - Colonies; Seeds; Data processing; Gene flow; Sampling; Apis mellifera; Hymenoptera; Apidae DO - http://dx.doi.org/10.1673/031.011.14401 ER - TY - JOUR T1 - Use of DNA Barcodes to Identify Invasive Armyworm Spodoptera Species in Florida AN - 954652568; 16386702 AB - A critical component for sustaining adequate food production is the protection of local agriculture from invasive pest insects. Essential to this goal is the ability to accurately distinguish foreign from closely related domestic species, a process that has traditionally required identification using diagnostic morphological "keys" that can be both subtle and labor-intensive. This is the case for the Lepidopteran group of insects represented by Spodoptera, a genus of Noctuidae "armyworm" moths that includes several important agricultural pests. Two of the most destructive species, Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae) and S. litura (F.) are not yet established in North America. To facilitate the monitoring for these pests, the feasibility of using DNA barcoding methodology for distinguishing between domestic and foreign Spodoptera species was tested. A DNA barcoding database was derived for a subset of Spodoptera species native to Florida, with an emphasis on those attracted to pheromone blends developed for S. litura or S. littoralis. These were then compared to the barcode sequences of S. litura collected from Taiwan and S. littoralis from Portugal. Consistent discrimination of the different species was obtained with phenetic relationships produced that were generally in agreement with phylogenetic studies using morphological characteristics. The data presented here indicate that DNA barcoding has the potential to be an efficient and accurate supplement to morphological methods for the identification of invasive Spodoptera pests in North America. JF - Journal of Insect Science (Tucson) AU - Nagoshi, Rodney N AU - Brambila, Julieta AU - Meagher, Robert L AD - Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, Gainesville, FL 32608, rodney.nagoshi@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1 EP - 11 PB - University of Wisconsin Library, 1510 East University Tucson AZ 85721-0055 United States VL - 11 IS - 154 SN - 1536-2442, 1536-2442 KW - Biochemistry Abstracts 2: Nucleic Acids; Ecology Abstracts; Entomology Abstracts KW - Phylogeny KW - Agriculture KW - Data processing KW - Food KW - Spodoptera littoralis KW - Keys KW - Lepidoptera KW - Databases KW - Pheromones KW - Dietary supplements KW - DNA KW - Noctuidae KW - Pests KW - Z 05300:General KW - D 04040:Ecosystem and Ecology Studies KW - N 14810:Methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954652568?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Insect+Science+%28Tucson%29&rft.atitle=Use+of+DNA+Barcodes+to+Identify+Invasive+Armyworm+Spodoptera+Species+in+Florida&rft.au=Nagoshi%2C+Rodney+N%3BBrambila%2C+Julieta%3BMeagher%2C+Robert+L&rft.aulast=Nagoshi&rft.aufirst=Rodney&rft.date=2011-11-01&rft.volume=11&rft.issue=154&rft.spage=1&rft.isbn=&rft.btitle=&rft.title=Journal+of+Insect+Science+%28Tucson%29&rft.issn=15362442&rft_id=info:doi/10.1673%2F031.011.15401 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 28 N1 - Last updated - 2012-05-07 N1 - SubjectsTermNotLitGenreText - Agriculture; Phylogeny; Databases; Data processing; Pheromones; Food; Dietary supplements; DNA; Pests; Keys; Spodoptera littoralis; Noctuidae; Lepidoptera DO - http://dx.doi.org/10.1673/031.011.15401 ER - TY - JOUR T1 - PERFORMANCE EVALUATION OF A NEWLY DEVELOPED VARIABLE-RATE SPRAYER FOR NURSERY LINER APPLICATIONS AN - 954647282; 16416270 AB - An experimental variable-rate sprayer designed for liner applications was tested by comparing its spray deposit, coverage, and droplet density inside canopies of six nursery liner varieties with constant-rate applications. Spray samplers, including water-sensitive papers (WSP) and nylon screens, were mounted inside tree canopies to collect spray deposit and coverage from variable-rate and constant-rate (555 and 1,110 L ha(-1)) applications. Models for estimating spray volume savings of the variable-rate sprayer compared to constant-rate and tree-row-volume (TRV) rate applications were developed for various liner canopy sizes and tree spacings. The accuracy of the model was validated with the field test data. For the liner trees tested, the variable-rate sprayer delivered 151 to 359 L ha(-1) application rates, while the conventional constant-rate application required 1,110 L ha(-1). Due to substantially lower spray output, the variable-rate application had lower (but sufficient) spray deposit, coverage, and droplet density than the constant-rate applications. The variable-rate application also had significantly less variations in spray deposit within canopies of different-size trees. Test results showed that the variable-rate sprayer reduced spray volume by up to 86.4% and 70.8% compared to the 1,110 L ha(-1) and TRV-based rate applications, respectively, while the model-estimated savings were up to 94.6% for the 1,110 L ha(-1) application and 57.7% for the TRV-based rate applications. Therefore, the newly developed variable-rate sprayer would bring great reductions in pesticide use and safeguard the environment for nursery liner production. JF - Transactions of the ASABE AU - Jeon, H Y AU - Zhu, H AU - Derksen, R C AU - Ozkan, H E AU - Krause, C R AU - Fox, R D AD - USDA-ARS Application Technology Research Unit (ATRU), Wooster, Ohio, heping.zhu@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1997 EP - 2007 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Water Resources Abstracts; Aqualine Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Environment Abstracts KW - Trees KW - Nursery grounds KW - Model Testing KW - Field Tests KW - Agricultural Chemicals KW - Canopies KW - Canopy KW - Testing Procedures KW - Density KW - Sprays KW - Samplers KW - Model Studies KW - Spray KW - Pesticides KW - canopies KW - SW 5080:Evaluation, processing and publication KW - ENA 09:Land Use & Planning KW - AQ 00008:Effects of Pollution KW - Q5 08502:Methods and instruments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954647282?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=PERFORMANCE+EVALUATION+OF+A+NEWLY+DEVELOPED+VARIABLE-RATE+SPRAYER+FOR+NURSERY+LINER+APPLICATIONS&rft.au=Jeon%2C+H+Y%3BZhu%2C+H%3BDerksen%2C+R+C%3BOzkan%2C+H+E%3BKrause%2C+C+R%3BFox%2C+R+D&rft.aulast=Jeon&rft.aufirst=H&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=1997&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 15 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Spray; Pesticides; Nursery grounds; Canopies; Samplers; Trees; Sprays; canopies; Testing Procedures; Agricultural Chemicals; Density; Field Tests; Model Testing; Canopy; Model Studies ER - TY - JOUR T1 - Cattle Grazing Toxic Delphinium andersonii in South-Central Idaho AN - 954645849; 16388517 AB - Anderson larkspur (Delphinium andersonii A. Gray) is a toxic plant responsible for cattle death losses in the western United States. The objectives of the present study were to determine when cattle consumed Anderson larkspur in relation to plant phenology and toxicity, and to determine if animal age influenced selection of Anderson larkspur. These grazing studies were conducted on semiarid sagebrush rangeland near Picabo, Idaho. Eight 6-7-yr-old mature Angus cows were used in 2008, whereas during 2009, 12 Angus cattle were used, including six yearling heifers and six 4-yr-old cows. The overall density of Anderson larkspur was 2.8 plants . m-2 during 2008, and 4.9 plants . m-2 during 2009. Total toxic alkaloid concentrations in Anderson larkspur plants were near or above 5 mg . g-1 during both studies. During 2008 consumption peaked during the late flower and pod stage of growth. Overall in 2008 cows ate 3%% of their bites as larkspur. During 2009 heifers ate about twice as much Anderson larkspur as did mature cows (5.1%% of bites vs. 2.9%%, respectively). Heifers repeatedly consumed sufficient larkspur that they collapsed; however, no animals were fatally intoxicated. Heifers appeared to become transiently averted to larkspur; however, heifers resumed consumption of D. andersonii after a period of one to several days of low or no consumption. Livestock management to reduce losses to Anderson larkspur should include timed grazing to avoid infested pastures during full flower to pod phenological stages, and grazing with older animals rather than yearling heifers. JF - Rangeland Ecology & Management AU - Pfister, James A AU - Cook, Daniel AU - Gardner, Dale R AD - Rangeland Scientist, USDA-ARS Poisonous Plant Research Laboratory, Logan, UT 84341, USA, jim.pfister@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 664 EP - 668 PB - Society for Range Management VL - 64 IS - 6 SN - 1550-7424, 1550-7424 KW - Ecology Abstracts KW - Rangelands KW - Flowers KW - Alkaloids KW - Age KW - Delphinium KW - Phenology KW - Grazing KW - Bites KW - Toxicity KW - Pasture KW - Livestock KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954645849?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Rangeland+Ecology+%26+Management&rft.atitle=Cattle+Grazing+Toxic+Delphinium+andersonii+in+South-Central+Idaho&rft.au=Pfister%2C+James+A%3BCook%2C+Daniel%3BGardner%2C+Dale+R&rft.aulast=Pfister&rft.aufirst=James&rft.date=2011-11-01&rft.volume=64&rft.issue=6&rft.spage=664&rft.isbn=&rft.btitle=&rft.title=Rangeland+Ecology+%26+Management&rft.issn=15507424&rft_id=info:doi/10.2111%2FREM-D-11-00001.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 15 N1 - Last updated - 2013-06-28 N1 - SubjectsTermNotLitGenreText - Rangelands; Age; Alkaloids; Flowers; Phenology; Bites; Grazing; Toxicity; Pasture; Livestock; Delphinium DO - http://dx.doi.org/10.2111/REM-D-11-00001.1 ER - TY - JOUR T1 - Ecotypic Variation in Elymus elymoides subsp. brevifolius in the Northern Intermountain West AN - 954645832; 16388503 AB - Bottlebrush squirreltail (Elymus elymoides [[Raf.]] Swezey) is an important native bunchgrass for rangeland restoration in western North America. This species is taxonomically complex and has diverged into as many as four subspecies, including subsp. brevifolius, for which four geographically distinct races have been described (A, B, C, and D). Of these four races, only C occurs in the northern Intermountain West. Our objectives were to describe phenotypic and genetic variation within C and to ascertain its taxonomic status. We evaluated 32 populations of C collected across the northern Intermountain West for a battery of biomass, phenological, and functional traits in common-garden settings in the field and greenhouse. Genetic variation was assessed with the use of amplified fragment length polymorphism (AFLP) markers, and correlations were calculated among phenotypic, genetic, environmental, and geographic distance matrices with the use of Mantel tests. Values for these four distance measures were positively correlated, suggesting that environmental heterogeneity and isolation by distance are shaping ecotypic divergence driven by natural selection. We describe three phenotypic zones for C that correspond to previously established ecoregion boundaries. Because genetic data group C apart from subsp. brevifolius races A, B, and D, which originate in the Rocky Mountains and western Great Plains, the so-called race C merits description as a new subspecies apart from subsp. brevifolius. JF - Rangeland Ecology & Management AU - Parsons, Matthew C AU - Jones, Thomas A AU - Larson, Steven R AU - Mott, Ivan W AU - Monaco, Thomas A AD - Restoration Ecologist H. T. Harvey & Associates, 983 University Avenue, Bldg D, Los Gatos, CA 95032, USA, thomas.jones@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 649 EP - 658 PB - Society for Range Management VL - 64 IS - 6 SN - 1550-7424, 1550-7424 KW - Ecology Abstracts KW - Amplified fragment length polymorphism KW - Biomass KW - Boundaries KW - Data processing KW - Genetic diversity KW - Greenhouses KW - Mountains KW - Natural selection KW - New subspecies KW - Races KW - Rangelands KW - Elymus elymoides KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954645832?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Rangeland+Ecology+%26+Management&rft.atitle=Ecotypic+Variation+in+Elymus+elymoides+subsp.+brevifolius+in+the+Northern+Intermountain+West&rft.au=Parsons%2C+Matthew+C%3BJones%2C+Thomas+A%3BLarson%2C+Steven+R%3BMott%2C+Ivan+W%3BMonaco%2C+Thomas+A&rft.aulast=Parsons&rft.aufirst=Matthew&rft.date=2011-11-01&rft.volume=64&rft.issue=6&rft.spage=649&rft.isbn=&rft.btitle=&rft.title=Rangeland+Ecology+%26+Management&rft.issn=15507424&rft_id=info:doi/10.2111%2FREM-D-09-00143.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 44 N1 - Last updated - 2013-01-25 N1 - SubjectsTermNotLitGenreText - Mountains; Rangelands; Amplified fragment length polymorphism; Data processing; New subspecies; Boundaries; Genetic diversity; Biomass; Natural selection; Races; Greenhouses; Elymus elymoides DO - http://dx.doi.org/10.2111/REM-D-09-00143.1 ER - TY - JOUR T1 - Allometry, biomass, and chemical content of Novel African Tulip Tree (Spathodea campanulata) Forests in Puerto Rico AN - 954642651; 16351113 AB - The African tulip tree, Spathodea campanulata, the most common tree in Puerto Rico, forms novel forest types with mixtures of native and other introduced tree species. Novel forests increase in area in response to human activity and there is no information about their biomass accumulation and nutrient cycling. We established allometric relationships and chemically analyzed plant parts of African tulip trees to determine the concentration and standing stock of chemical elements (C, N, P, K, Ca, Mg, S, Mn, Al, Fe, Na), and ash. Trees ranged in diameter at breast height from 8 to 85 cm and in height from 8.8 to 28 m. The concentrations of N, P, K, and Ca in leaves of the African tulip tree were similar to those of the native pioneer Cecropia schreberiana and higher than those of mature forest tree species in Puerto Rico. The over bark wood volume of African tulip trees in nine forest stands where it was dominant ranged from 163 to 849 m super(3)/ha. Aboveground biomass ranged from 60 to 296 Mg/ha, and N and P stocks ranged from 190 to 988 and 32 to 137 kg/ha, respectively. Novel forests on abandoned agricultural lands can store more biomass and elements than native and plantation forest stands of similar age. JF - New Forests AU - Lugo, Ariel E AU - Abelleira, Oscar J AU - Collado, Alexander AU - Viera, Christian A AU - Santiago, Cynthia AU - Velez, Diego O AU - Soto, Emilio AU - Amaro, Giovanni AU - Charon, Graciela AU - Colon, Hector AU - Santana, Jennifer AU - Morales, Jose L AU - Rivera, Katherine AU - Ortiz, Luis AU - Rivera, Luis AU - Maldonado, Mianel AU - Rivera, Natalia AU - Vazquez, Norelis J AD - International Institute of Tropical Forestry, USDA Forest Service, 1201 Ceiba St., Jardin Botanico Sur, Rio Piedras, 00926-1119, Puerto Rico, alugo@fs.fed.us Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 267 EP - 283 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 42 IS - 3 SN - 0169-4286, 0169-4286 KW - Environment Abstracts KW - Trees KW - Forests KW - Wood KW - agricultural land KW - Biomass KW - Cecropia KW - Nutrient cycles KW - plantations KW - ASW, Caribbean Sea, Greater Antilles, Puerto Rico KW - Spathodea campanulata KW - bark KW - Africa KW - Human factors KW - ENA 06:Food & Drugs UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954642651?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=New+Forests&rft.atitle=Allometry%2C+biomass%2C+and+chemical+content+of+Novel+African+Tulip+Tree+%28Spathodea+campanulata%29+Forests+in+Puerto+Rico&rft.au=Lugo%2C+Ariel+E%3BAbelleira%2C+Oscar+J%3BCollado%2C+Alexander%3BViera%2C+Christian+A%3BSantiago%2C+Cynthia%3BVelez%2C+Diego+O%3BSoto%2C+Emilio%3BAmaro%2C+Giovanni%3BCharon%2C+Graciela%3BColon%2C+Hector%3BSantana%2C+Jennifer%3BMorales%2C+Jose+L%3BRivera%2C+Katherine%3BOrtiz%2C+Luis%3BRivera%2C+Luis%3BMaldonado%2C+Mianel%3BRivera%2C+Natalia%3BVazquez%2C+Norelis+J&rft.aulast=Lugo&rft.aufirst=Ariel&rft.date=2011-11-01&rft.volume=42&rft.issue=3&rft.spage=267&rft.isbn=&rft.btitle=&rft.title=New+Forests&rft.issn=01694286&rft_id=info:doi/10.1007%2Fs11056-011-9258-8 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - plantations; Trees; bark; Wood; Forests; agricultural land; Human factors; Biomass; Nutrient cycles; Spathodea campanulata; Cecropia; ASW, Caribbean Sea, Greater Antilles, Puerto Rico; Africa DO - http://dx.doi.org/10.1007/s11056-011-9258-8 ER - TY - JOUR T1 - ADVANCES IN FOREST HYDROLOGY: CHALLENGES AND OPPORTUNITIES AN - 954642081; 16416275 AB - Forests are an integral component of the landscape, and maintaining their functional integrity is fundamental for the sustainability of ecosystems and societies alike. Tools, innovations, and practices, analogous to those developed to improve agricultural production and quantify environmental impacts, are needed to ensure the sustainability of these forested landscapes as well as the ecosystem goods and services they produce. This article introduces ten technical articles on critical ecohydrologic processes, protection and restoration, and the effects of management practices on the hydrology and water quality of forests and forested wetlands, using both monitoring and modeling approaches. Prepared by experts in forest science, forest and agricultural hydrology, and water management, the studies reported in this special collection are concentrated in the Atlantic Coastal plain and focus on forests with shallow water tables. Experimental studies describe the effects of riparian vegetation harvest, human disturbance, and future climatic change on groundwater, the significance of emergent vegetation after harvest, and long-term hydrologic water balance of a managed pine forest. Modeling studies use the SWAT model to predict streamflow dynamics of a less disturbed, coastal forested watershed, and DRAINMOD to determine the impacts of minor silvicultural drainage on wetland hydrology and to improve wetland restoration. Finally, a study describes potential uncertainties associated with infrequent water sampling of nutrient loads from drained forested watersheds. This introductory article summarizes these studies of shallow water table forests and relates them to the broader field of forest hydrology, including its challenges and opportunities, while identifying pressing issues of land use and climate change. The results from these studies should help guide management and restoration of forest wetland ecosystems and direct future forest hydrologic research, including research in large prior converted agricultural landscapes. JF - Transactions of the ASABE AU - Amatya, D M AU - Douglas-Mankin, K R AU - Williams, T M AU - Skaggs, R W AU - Nettles, J E AD - USDA Forest Service, Center for Forested Wetlands Research, Cordesville, South Carolina, damatya@fs.fed.us Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 2049 EP - 2056 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Aqualine Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Sustainability Science Abstracts; Environment Abstracts KW - silviculture KW - Resource management KW - Ecosystems KW - Climate change KW - Anthropogenic factors KW - Forests KW - Man-induced effects KW - Watersheds KW - Shallow Water KW - Forest Watersheds KW - shallow water KW - Forest Hydrology KW - ANW, USA, Atlantic Coastal Plain KW - Hydrologic Models KW - Hydrology KW - sustainability KW - Wetlands KW - Landscape KW - Habitat improvement KW - Water management KW - Groundwater KW - Q2 09243:Structure, mechanics and thermodynamics KW - AQ 00001:Water Resources and Supplies KW - SW 5040:Data acquisition KW - M3 1010:Issues in Sustainable Development KW - ENA 12:Oceans & Estuaries UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954642081?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=ADVANCES+IN+FOREST+HYDROLOGY%3A+CHALLENGES+AND+OPPORTUNITIES&rft.au=Amatya%2C+D+M%3BDouglas-Mankin%2C+K+R%3BWilliams%2C+T+M%3BSkaggs%2C+R+W%3BNettles%2C+J+E&rft.aulast=Amatya&rft.aufirst=D&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2049&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 60 N1 - Last updated - 2016-09-29 N1 - SubjectsTermNotLitGenreText - Resource management; Water management; Habitat improvement; Climate change; Anthropogenic factors; Man-induced effects; Hydrology; Wetlands; Watersheds; shallow water; silviculture; Ecosystems; Landscape; Forests; sustainability; Forest Hydrology; Hydrologic Models; Groundwater; Forest Watersheds; Shallow Water; ANW, USA, Atlantic Coastal Plain ER - TY - JOUR T1 - IRRIGATION SCHEDULING BASED ON CROP CANOPY TEMPERATURE FOR HUMID ENVIRONMENTS AN - 954642066; 16416272 AB - The use of infrared thermometers (IR) to measure canopy temperatures for irrigation scheduling has been successfully applied in arid environments. Functionality of this technique in humid areas has been limited due to the presence of low vapor pressure deficits (VPD) and intermittent cloud cover. This study evaluated an alternate scheduling method for humid environments based on comparing measured canopy temperature with calculated canopy temperature of a well-watered crop. Irrigation was applied when the measured canopy temperature was greater than the predicted canopy temperature for more than three consecutive hours on two consecutive days. This method was evaluated against well-watered, semi-stressed, and dryland treatments of corn, soybean, and cotton on the basis of yield, irrigation amount, and irrigation water use efficiency (IWUE). Canopy temperature was underpredicted when the VPD was greater than 2 kPa. Limiting data to conditions when the solar radiation was greater than 200 W m(-2) and the Richardson number was less than 0.2 resulted in very good prediction of canopy temperatures for cotton and soybean, particularly in the later growing period, but corn temperatures were consistently underpredicted. Although soybean and cotton yields were not significantly different across treatments, IWUE was improved for corn and cotton by use of this technique. Corn yield was greater for the well-watered crop, but the IR method resulted in 85% of the maximum yield while requiring less than 50% of the irrigation water. Results from this study suggest that the threshold temperature may be up to 1 degree C greater for corn and soybean and up to 0.5 degree C greater for cotton for humid compared to arid environments. This method shows potential as a tool for irrigation scheduling in humid environments. Further work is suggested to determine if conditions of excessive cloud cover and high VPD can be better accommodated, and to refine the threshold temperatures for corn, soybean, and cotton for humid environments. JF - Transactions of the ASABE AU - Bockhold, D L AU - Thompson, A L AU - Sudduth, K A AU - Henggeler, J C AD - USDA-NRCS, Fulton, Missouri, thompsona@missouri.edu Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 2021 EP - 2028 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Environment Abstracts KW - Arid environments KW - Temperature KW - ENA 06:Food & Drugs UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954642066?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=IRRIGATION+SCHEDULING+BASED+ON+CROP+CANOPY+TEMPERATURE+FOR+HUMID+ENVIRONMENTS&rft.au=Bockhold%2C+D+L%3BThompson%2C+A+L%3BSudduth%2C+K+A%3BHenggeler%2C+J+C&rft.aulast=Bockhold&rft.aufirst=D&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2021&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 1 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Temperature ER - TY - JOUR T1 - TREATMENTS OF PRECIPITATION INPUTS TO HYDROLOGIC MODELS AN - 954642061; 16416271 AB - Hydrologic models are used to assess many water resource problems, from agricultural use and water quality to engineering issues. This study shows how the combination of rain gauges (accurate at a point) and NEXRAD precipitation data (covering a wide area) can provide accurate, timely rainfall data that can drive the Soil and Water Assessment Tool (SWAT) model, which provides a more reliable tool for producers and policy-makers alike. The treatment of rainfall data was tested in the South Fork of the Iowa River, which covers about 788 km(2) (194,720 ac) and is one of 15 benchmark watersheds of the USDA Conservation Effects Assessment Project (CEAP). The results show significant improvement in model predictions in which rainfall data were correctly modified. Gauge records with values for trace events performed better as data sources than records in which trace events were given zero value, even though the mean annual rainfall differed by less than or equal to 25 mm. The combination of rain gauge and NEXRAD data provided superior results even when the watershed included a sufficient spatial distribution of rain gauges. Of the six methods used to adjust gauge and NEXRAD data, inverse distance weighting or kriging with external drift predicted streamflow among the four gauges was the best among those tested. In the absence of rain gauge data, the simple adjustment of the NEXRAD estimates to match total rainfall amounts in the region resulted in adequate streamflow estimates. This finding is important because uncorrected NEXRAD precipitation values, although only 15% below annual precipitation values, resulted in a greater than 50% difference in streamflow estimates. The choice of rainfall treatment should be considered carefully to provide accurate model predictions. JF - Transactions of the ASABE AU - Beeson, P C AU - Doraiswamy, P C AU - Sadeghi, A M AU - Di Luzio, M AU - Tomer, M D AU - Arnold, J G AU - Daughtry, C S T AD - USDA-ARS Hydrology and Remote Sensing Laboratory, Beltsville, Maryland, peter.beeson@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 2011 EP - 2020 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Aqualine Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Meteorological & Geoastrophysical Abstracts KW - Prediction KW - Precipitation data KW - Spatial distribution KW - Rainfall data KW - Rainfall KW - Water resources KW - USA, Iowa, Iowa R. KW - Watersheds KW - Water quality KW - Hydrologic Models KW - Assessments KW - Hydrologic Data KW - Hydrologic models KW - Modelling KW - Annual rainfall KW - Rain gauges KW - Streamflow KW - Precipitation KW - Stream flow KW - Methodology KW - Rainfall amount KW - Rain Gages KW - Conservation KW - Q2 09243:Structure, mechanics and thermodynamics KW - SW 1030:Use of water of impaired quality KW - AQ 00006:Sewage KW - M2 556:General (556) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954642061?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=TREATMENTS+OF+PRECIPITATION+INPUTS+TO+HYDROLOGIC+MODELS&rft.au=Beeson%2C+P+C%3BDoraiswamy%2C+P+C%3BSadeghi%2C+A+M%3BDi+Luzio%2C+M%3BTomer%2C+M+D%3BArnold%2C+J+G%3BDaughtry%2C+C+S+T&rft.aulast=Beeson&rft.aufirst=P&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2011&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 45 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Rain gauges; Water resources; Water quality; Watersheds; Modelling; Methodology; Stream flow; Precipitation data; Annual rainfall; Rainfall amount; Spatial distribution; Rainfall data; Conservation; Precipitation; Hydrologic models; Prediction; Hydrologic Models; Assessments; Rain Gages; Rainfall; Streamflow; Hydrologic Data; USA, Iowa, Iowa R. ER - TY - JOUR T1 - VARIATIONS OF INDICATOR BACTERIA IN A LARGE URBAN WATERSHED AN - 954641264; 16416292 AB - The contamination of water resources by nonpoint-source fecal pollution is a major concern to human health and water quality throughout the world. The Santa Ana River (SAR) in southern California is an impaired stream with historically high fecal coliform counts. This study evaluated the presence of indicator bacteria at 13 sites in the middle Santa Ana River watershed (MSAR). The objectives of this study were to: (1) examine spatial and temporal characteristics of fecal bacteria loading during dry weather (low or baseline) flow, wet weather (storm) flow, and recessional flow (72 h after storm) along two creeks, at two wastewater treatment plant (WWTP) outlets, and at a control site in the MSAR; and (2) determine how the various sampling locations affected indicator bacteria concentrations in the watershed. Total coliform (TC), fecal coliform (FC), E. coli, enterococci, and total bacterial concentrations were characterized at 13 locations in the watershed over a two-year period. Analysis of covariance (ANOCOVA) was used to test each specific set of bacteria counts, site effects, water flow conditions, and the four water quality covariate effects. Our results showed that the control site (S1) and WWTP estimates always showed significantly lower indicator bacteria than the channels influenced by urban runoff and agricultural activities. The water flow effects indicated that the recessional flow transported significantly lower bacterial counts into the watershed than either the dry weather flow or the storm or wet weather flow. In addition, bacterial count estimates changed far more significantly across different sites in comparison to estimates across seasons or time. These results imply that total TC, FC, E. coli, and enterococci bacterial counts in the MSAR watershed were strongly influenced by spatial location effects, with contamination due to local agricultural and/or urban runoff, in contrast to elevated upstream contamination and/or discharge contamination associated with the two WWTPs. Therefore, this study has provided data for evaluation of the Santa Ana River watershed's total maximum daily load (TMDL) management plans that could also be applicable to other large watersheds with different nonpoint-source pollutants. JF - Transactions of the ASABE AU - Ibekwe, A M AU - Lesch, S M AU - Bold, R M AU - Leddy, M B AU - Graves, A K AD - USDA-ARS U S Salinity Laboratory, Riverside, California, Mark.Ibekwe@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 2227 EP - 2236 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Meteorological & Geoastrophysical Abstracts; Aqualine Abstracts; Water Resources Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts B: Bacteriology; Pollution Abstracts; Environment Abstracts KW - Contamination KW - Indicators KW - Water resources KW - Water quality KW - Watersheds KW - USA, California, Santa Ana R. KW - Storms KW - Urban runoff KW - INE, USA, California KW - Escherichia coli KW - Seasonal variability KW - Rivers KW - Weather KW - Wastewater Facilities KW - Nonpoint pollution KW - Channels KW - Runoff KW - Streams KW - Wastewater treatment KW - Water treatment KW - Pollutants KW - USA, California KW - Sampling KW - Pollution KW - Bacteria KW - Coliforms KW - Fecal coliforms KW - Data processing KW - Water flow KW - AQ 00006:Sewage KW - SW 0810:General KW - A 01450:Environmental Pollution & Waste Treatment KW - P 2000:FRESHWATER POLLUTION KW - M2 551.5:General (551.5) KW - ENA 19:Water Pollution KW - J 02450:Ecology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954641264?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=VARIATIONS+OF+INDICATOR+BACTERIA+IN+A+LARGE+URBAN+WATERSHED&rft.au=Ibekwe%2C+A+M%3BLesch%2C+S+M%3BBold%2C+R+M%3BLeddy%2C+M+B%3BGraves%2C+A+K&rft.aulast=Ibekwe&rft.aufirst=A&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2227&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 40 N1 - Last updated - 2015-08-19 N1 - SubjectsTermNotLitGenreText - Rivers; Weather; Fecal coliforms; Data processing; Contamination; Water flow; Water resources; Watersheds; Water quality; Wastewater treatment; Streams; Storms; Pollutants; Sampling; Pollution; Runoff; Seasonal variability; Channels; Urban runoff; Water treatment; Nonpoint pollution; Bacteria; Coliforms; Wastewater Facilities; Indicators; Escherichia coli; INE, USA, California; USA, California; USA, California, Santa Ana R. ER - TY - JOUR T1 - Biology of Leptoypha hospita (Hemiptera: Tingidae), a Potential Biological Control Agent of Chinese Privet AN - 954639172; 16387664 AB - The biology of Leptoypha hospita Drake et Poor (Hemiptera: Tingidae), a potential biological control agent from China for Chinese privet, Ligustrum sinense Lour., was studied in quarantine in the United States. Both nymphs and adults feed on Chinese privet mesophyll cells that lead to a bleached appearance of leaves and dieback of branch tips. L. hospita has five nymphal instars with the mean duration of the life cycle from egg to new adult being 25 d. Females laid an average of 240 eggs per female and continued laying until death. Adults lived approximately 75 d on average. Because it feeds on Chinese privet, has multiple generations per year and a high reproductive rate, L. hospita may be a good biological control agent for this invasive plant. JF - Annals of the Entomological Society of America AU - Zhang, Yanzhuo AU - Hanula, James L AU - Horn, Scott AU - Braman, SKristine AU - Sun, Jianghua AD - USDA Forest Service, Southern Research Station, 320 Green St., Athens, GA 30602., yzzhang80@gmail.com Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1327 EP - 1333 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 104 IS - 6 SN - 0013-8746, 0013-8746 KW - Sustainability Science Abstracts; Entomology Abstracts KW - Biological control KW - Life cycle KW - Ligustrum sinense KW - Tingidae KW - Eggs KW - Mesophyll KW - Mortality KW - Dieback KW - Leaves KW - invasive plants KW - Hemiptera KW - USA KW - life cycle KW - dieback KW - Leptoypha KW - Quarantine KW - China, People's Rep. KW - Feeds KW - Z 05340:Ecology and Behavior KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954639172?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annals+of+the+Entomological+Society+of+America&rft.atitle=Biology+of+Leptoypha+hospita+%28Hemiptera%3A+Tingidae%29%2C+a+Potential+Biological+Control+Agent+of+Chinese+Privet&rft.au=Zhang%2C+Yanzhuo%3BHanula%2C+James+L%3BHorn%2C+Scott%3BBraman%2C+SKristine%3BSun%2C+Jianghua&rft.aulast=Zhang&rft.aufirst=Yanzhuo&rft.date=2011-11-01&rft.volume=104&rft.issue=6&rft.spage=1327&rft.isbn=&rft.btitle=&rft.title=Annals+of+the+Entomological+Society+of+America&rft.issn=00138746&rft_id=info:doi/10.1603%2FAN11042 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 35 N1 - Last updated - 2012-04-23 N1 - SubjectsTermNotLitGenreText - Biological control; Dieback; Leaves; Mesophyll; Quarantine; Life cycle; Eggs; Mortality; life cycle; dieback; invasive plants; Feeds; Leptoypha; Ligustrum sinense; Tingidae; Hemiptera; USA; China, People's Rep. DO - http://dx.doi.org/10.1603/AN11042 ER - TY - JOUR T1 - EVALUATING THE SWAT MODEL FOR A LOW-GRADIENT FORESTED WATERSHED IN COASTAL SOUTH CAROLINA AN - 954639002; 16416285 AB - Modeling the hydrology of low-gradient forested watersheds on shallow, poorly drained soils of the coastal plain is a challenging task due to complexities in watershed delineation, microtopography, evapotranspiration, runoff generation processes and pathways including flooding and submergence caused by tropical storms, and complexity of vegetation species. The main objective of this study was to calibrate and validate the GIS-based spatially distributed hydrologic model SWAT for the 72.6 km(2) low-gradient, third-order Turkey Creek watershed within the Francis Marion National Forest in the South Carolina Coastal Plain. Model calibration used GIS spatial data of the watershed and 2.75 years (2005-2007) of streamflow and climate data, and the model was validated with 2.5 years (2008-2010) of data. Based on limited field measurements, results showed that the SWAT model with an improved one-parameter "depletion coefficient" for plant evapotranspiration in the SCS curve number (CN) estimate can predict the daily and monthly streamflow processes of this watershed reasonably well and better than the CN method. The model performance was "good" (E = 0.68; RSR = 0.56) to "very good" (E = 0.90; RSR = 0.31) for the monthly calibration and validation periods but only "satisfactory" (E = 0.59; RSR = 0.64) to "good" (E = 0.70; RSR = 0.55) for the daily calibration and validation periods. Better predictions were found for the validation period that included two wetter years than the calibration with two drier years. The model's predictions of the zero or near-zero flow days of summer were also in agreement with the measurements for 60% of the time. However, it was concluded that the refined SWAT model was still unable to accurately capture the flow dynamics of this forest ecosystem with shallow, high water table soils for events preceded by wet saturated conditions during the dry summer and wet winter periods, warranting further investigations on these forest systems. The five-year average annual runoff coefficient of 19% with a baseflow amount of 27%, on average, of the runoff (streamflow) and ET of 987 mm predicted by the model were found reasonable compared to the estimated values and other published data for the region. Further improvements in estimates of forest potential evapotranspiration, rainfall spatial variability, and antecedent moisture as a function of water table should reduce uncertainties in flow predictions, allowing the model to be used in hydrologic impact assessments of land use change, land management practices, and climate change in coastal landscapes. JF - Transactions of the ASABE AU - Amatya, D M AU - Jha, M K AD - USDA Forest Service, Center for Forested Wetlands Research, Cordesville, South Carolina, damatya@fs.fed.us Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 2151 EP - 2163 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Aqualine Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Sustainability Science Abstracts; Environment Abstracts KW - Prediction KW - Resource management KW - Ecological distribution KW - ANW, USA, South Carolina KW - Forests KW - Water table KW - Summer KW - Watersheds KW - Flow rates KW - Soil KW - Spatial variations KW - Hydrologic Models KW - Calibrations KW - Hydrology KW - Submergence KW - plains KW - Hydrologic Data KW - Streamflow KW - Evapotranspiration KW - Water Table KW - Stream flow KW - water table KW - summer KW - Geographic information systems KW - Runoff KW - Q2 09243:Structure, mechanics and thermodynamics KW - SW 5010:Network design KW - AQ 00006:Sewage KW - M3 1010:Issues in Sustainable Development KW - ENA 12:Oceans & Estuaries UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954639002?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=EVALUATING+THE+SWAT+MODEL+FOR+A+LOW-GRADIENT+FORESTED+WATERSHED+IN+COASTAL+SOUTH+CAROLINA&rft.au=Amatya%2C+D+M%3BJha%2C+M+K&rft.aulast=Amatya&rft.aufirst=D&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2151&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 61 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Spatial variations; Resource management; Ecological distribution; Submergence; Hydrology; Evapotranspiration; Watersheds; Runoff; Stream flow; Prediction; Soil; water table; Water table; summer; Forests; Summer; plains; Geographic information systems; Flow rates; Hydrologic Models; Calibrations; Streamflow; Water Table; Hydrologic Data; ANW, USA, South Carolina ER - TY - JOUR T1 - LINKING PLANT ECOLOGY AND LONG-TERM HYDROLOGY TO IMPROVE WETLAND RESTORATION SUCCESS AN - 954638992; 16416283 AB - Although millions of dollars are spent restoring wetlands, failures are common, in part because the planted vegetation cannot survive in the restored hydrology. Wetland restoration would be more successful if the hydrologic requirements of wetland plant communities were known so that the most appropriate plants could be selected for the range of projected hydrology at the site. Here we describe how hydrologic models can be used to characterize the long-term hydrology of wetland plant communities, and we show how these results can be used to define wetland design criteria. In our study, we quantified differences in long-term (40-year) hydrologic characteristics of the pond pine woodland (PPW), nonriverine swamp forest (NRSF), high pocosin (HP), and bay forest (BF) plant communities native to the North Carolina Coastal Plain. We found that the median water level was 8 cm below the land surface in PPW and 9, 2, and 8 cm above the land surface for NRSF, HP, and BF, respectively. When the land surface was inundated, the median duration of inundation was 91 d year(-1) for PPW and 317, 243, and 307 d year1 for NRSF, HP, and BF, respectively. Our models suggested that the PPW received an average of 15% of its water input from groundwater inflow, whereas the other communities we modeled did not appear to receive groundwater inflow. Using these results and soil organic layer thickness, we developed and propose design criteria linking soil, vegetation, and hydrology parameters that should contribute to improved restoration success. JF - Transactions of the ASABE AU - Caldwell, P V AU - Vepraskas, M J AU - Gregory, J D AU - Skaggs, R W AU - Huffman, R L AD - USDA Forest Service, Eastern Forest Environmental Threat Assessment Center, Raleigh, North Carolina, peter_caldwell@ncsu.edu Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 2129 EP - 2137 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Environment Abstracts KW - Soil KW - ANW, USA, North Carolina KW - plant communities KW - Plants KW - Hydrology KW - Forests KW - Environmental restoration KW - inflow KW - Wetlands KW - Groundwater KW - ENA 12:Oceans & Estuaries UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954638992?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=LINKING+PLANT+ECOLOGY+AND+LONG-TERM+HYDROLOGY+TO+IMPROVE+WETLAND+RESTORATION+SUCCESS&rft.au=Caldwell%2C+P+V%3BVepraskas%2C+M+J%3BGregory%2C+J+D%3BSkaggs%2C+R+W%3BHuffman%2C+R+L&rft.aulast=Caldwell&rft.aufirst=P&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2129&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 43 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Soil; plant communities; Plants; inflow; Environmental restoration; Forests; Hydrology; Wetlands; Groundwater; ANW, USA, North Carolina ER - TY - JOUR T1 - EFFECTS OF RIPARIAN BUFFERS ON HYDROLOGY OF NORTHERN SEASONAL PONDS AN - 954638983; 16416281 AB - Although seasonal ponds are common in northern, glaciated, forested landscapes, forest management guidelines are generally lacking for these systems. The objective of this study was to determine the effect of riparian buffer type on seasonal pond hydrology following harvest of the adjacent upland forest. A replicated block design consisting of four buffer treatments was established in north central Minnesota in 2000. Treatments included an uncut control (i.e., the upland and buffer were uncut) and three treatments in which the upland was clearcut but the buffer was either uncut, partially harvested, or clearcut. Hydrologic characteristics were examined for differences among buffer treatments. One year of pre-harvest data was collected followed by five years of post-harvest data. Regression analysis of water levels indicated that all buffer treatments had significantly higher pond water depth than the uncut control for four years following harvests. The fifth year following harvests showed no difference in water depth between buffer treatments and the uncut control. In the first post-treatment year, the clearcut buffer treatment had the highest mean annual water depth of the three buffer treatments. Changes in evapotranspiration and runoff due to altering upland and riparian vegetation are considered key factors in explaining these hydrological responses. The results of this study indicate that upland harvesting increases water tables in seasonal ponds, and it takes about five years before water tables are similar to predisturbance levels. Our results also suggest that the amount of vegetation harvested within a riparian buffer affects the hydrologic response, especially in the first year following harvest. JF - Transactions of the ASABE AU - Kolka, R K AU - Palik, B J AU - Tersteeg, D P AU - Bell, J C AD - USDA Forest Service Northern Research Station, Grand Rapids, Minnesota, rkolka@fs.fed.us Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 2111 EP - 2116 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Aqualine Abstracts; Water Resources Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Environment Abstracts; Meteorological & Geoastrophysical Abstracts KW - Regression Analysis KW - Forest management KW - Riparian Vegetation KW - buffers KW - Freshwater KW - Ponds KW - Clear cutting KW - Water levels KW - Sulfur dioxide KW - Riparian Land KW - Water Depth KW - Riparian environments KW - Regression analysis KW - Environmental effects KW - Hydrology KW - Seasonal variations KW - Topography KW - Rivers KW - Hydrologic analysis KW - Vegetation KW - Evapotranspiration KW - Water Level KW - Forest Management KW - USA, Minnesota KW - water table KW - water depth KW - Pond Hydrology KW - Riparian vegetation KW - Standards KW - Runoff KW - Harvesting KW - AQ 00001:Water Resources and Supplies KW - SW 0835:Streamflow and runoff KW - Q5 08502:Methods and instruments KW - M2 556.16:Runoff (556.16) KW - ENA 07:General UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954638983?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=EFFECTS+OF+RIPARIAN+BUFFERS+ON+HYDROLOGY+OF+NORTHERN+SEASONAL+PONDS&rft.au=Kolka%2C+R+K%3BPalik%2C+B+J%3BTersteeg%2C+D+P%3BBell%2C+J+C&rft.aulast=Kolka&rft.aufirst=R&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2111&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 36 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Water levels; Rivers; Environmental effects; Riparian vegetation; Hydrology; Evapotranspiration; Harvesting; Runoff; Ponds; Forest management; Hydrologic analysis; Pond Hydrology; Regression analysis; Topography; water table; Sulfur dioxide; water depth; buffers; Riparian environments; Vegetation; Seasonal variations; Clear cutting; Regression Analysis; Riparian Vegetation; Riparian Land; Water Depth; Standards; Water Level; Forest Management; USA, Minnesota; Freshwater ER - TY - JOUR T1 - LONG-TERM HYDROLOGY AND WATER QUALITY OF A DRAINED PINE PLANTATION IN NORTH CAROLINA AN - 954638975; 16416279 AB - Long-term data provide a basis for understanding natural variability, reducing uncertainty in model inputs and parameter estimation, and developing new hypotheses. This article evaluates 21 years (1988-2008) of hydrologic data and 17 years (1988-2005) of water quality data from a drained pine plantation in eastern North Carolina. The plantation age was 14 years at the beginning of the investigation (1988) and 34 years at the end (2008). The 21-year average rainfall of 1517 mm was 9% higher than the 50-year (1951-2000) long-term average of 1391 mm observed at the nearest U.S. Weather Bureau station in Morehead City, North Carolina. Annual rainfall varied from 852 mm in the driest year (2001) to 2331 mm in the wettest year (2003) during the study period and was affected by several hurricanes and tropical storms. The runoff coefficient (ROC; drainage outflow expressed as a fraction of rainfall) varied from 0.05 in the driest year to as high as 0.56 in the wettest year (2003), with an average ROC of 0.32. Annual outflow (runoff) on this watershed was primarily subsurface flow to drainage ditches and was strongly correlated with rainfall (R(2) = 0.81). Outflows were greater, more continuous, and longer in winter than in other seasons. Outflow in winter was 59% of rainfall on average. March was the only month that never produced zero outflow. The lowest mean outflow occurred in the spring and was significantly different from the other three seasons. Consistent with theory for subsurface drainage, outflow from this poorly drained land is dependent on water table elevation and occurs when the water table is within about 1.1 m of the surface. The water table tended to be close to the surface during the winter and early spring with low ET demands, and during summer with hurricanes and tropical storms producing large outflows, but was drawn down to depths much deeper than the drains during long dry periods in summer and fall. As a result, annual outflow and annual average water table depth were only weakly correlated (R(2) = 0.52). There was no relationship (R(2) = 0.01) between the annual average water table depth and the annual average evapotranspiration (ET), calculated as the difference between annual rainfall and outflow. The estimated average annual ET of 1005 mm was close to the Penman-Monteith based average annual potential ET (PET) of 1010 mm for a grass reference. Although nitrogen (N) levels in the drainage water were elevated after fertilization of the stand in late 1988, these elevated levels declined substantially by 1995. Average annual concentrations of total N ranged from 0.51 to 2.23 mg L(-1) with a long-term average of 1.10 mg L(-1). Annual average values for total P ranged from 0.01 to 0.12 mg L(-1) with an average of 0.04 mg L(-1). The highest average annual concentrations for N and P occurred in 1989 (N) and 1990 (P) following fertilization in spring of 1989. The average annual total N and P loadings were 6.5 plus or minus 5.3 kg ha(-1) and 0.17 plus or minus 0.11 kg ha(-1), respectively. Both concentrations and annual loadings were similar to other forested sites in the region. These long-term data should be useful for assessing the effects of land use change and management treatments on the hydrology and water quality of similar lands in the coastal region. JF - Transactions of the ASABE AU - Amatya, D M AU - Skaggs, R W AD - USDA Forest Service, Center for Forested Wetlands Research, Cordesville, South Carolina, damatya@fs.fed.us Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 2087 EP - 2098 PB - American Society of Agricultural Engineers, 2950 Niles Rd. St Joseph MI 49085 United States VL - 54 IS - 6 SN - 2151-0032, 2151-0032 KW - Pollution Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Environment Abstracts; Meteorological & Geoastrophysical Abstracts KW - Water table depth KW - USA, North Carolina KW - water quality KW - Resource management KW - USA, North Carolina, Morehead City KW - Rainfall KW - outflow KW - Water table KW - Subsurface flow KW - Freshwater KW - Water quality KW - Storms KW - Winter KW - plantations KW - Hydrology KW - Seasonal variability KW - ANW, USA, North Carolina KW - Annual rainfall KW - Drainage KW - Tropical depressions KW - Coastal zone management KW - water table KW - Hurricanes KW - winter KW - Water management KW - Runoff KW - Q2 09243:Structure, mechanics and thermodynamics KW - P 2000:FRESHWATER POLLUTION KW - M2 556.16:Runoff (556.16) KW - ENA 19:Water Pollution KW - O 4060:Pollution - Environment UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954638975?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Apollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+of+the+ASABE&rft.atitle=LONG-TERM+HYDROLOGY+AND+WATER+QUALITY+OF+A+DRAINED+PINE+PLANTATION+IN+NORTH+CAROLINA&rft.au=Amatya%2C+D+M%3BSkaggs%2C+R+W&rft.aulast=Amatya&rft.aufirst=D&rft.date=2011-11-01&rft.volume=54&rft.issue=6&rft.spage=2087&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+ASABE&rft.issn=21510032&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 47 N1 - Last updated - 2016-12-22 N1 - SubjectsTermNotLitGenreText - Hurricanes; Resource management; Water management; Hydrology; Water table; Water quality; Tropical depressions; Runoff; Coastal zone management; Water table depth; Annual rainfall; Drainage; Seasonal variability; Subsurface flow; Storms; plantations; water quality; water table; winter; Rainfall; outflow; Winter; USA, North Carolina; ANW, USA, North Carolina; USA, North Carolina, Morehead City; Freshwater ER - TY - JOUR T1 - IMPACT OF TARGETED REMOVAL OF RESIDUE COVER ON WATER QUALITY IN THE SAND CREEK WATERSHED AN - 926905652; 16401528 AB - Conservation tillage methods are recommended by environmental protection agencies to reduce soil erosion and runoff from highly erodible cropland. Consequently, it gained wide acceptance among producers in the Upper Midwest and elsewhere. However, remote sensing based tillage mapping studies have shown that conservation tillage has also been adopted on flatter terrain to reduce farm operation costs. Recent demand for harvests of crop residues cover for biofuel production may present a win-win scenario for producers by decreasing tile drainage volumes while adding an additional income stream. The objectives of this study were to: (1) calibrate the Agricultural Drainage and Pesticide Transport (ADAPT) model for monthly flow, sediment, and nutrient losses; and (2) evaluate the effects of targeted vs. non-targeted removal of crop residue cover for biofuel production on water quality in the Sand Creek watershed located in south-central Minnesota. Comparison of model predictions for the calibration period against measured monthly flow, sediment, nitrate-N and P losses were in good agreement with r super(2) values of 0.75, 0.69, 0.70 and 0.50, respectively. Results indicate that removal of residue cover from all cropland significantly increased average annual sediment losses, with a slight increase in nitrate-N and P losses. Targeted removal of residue cover from flat landscapes had no significant effect on sediment and P losses when compared with non-targeted residue removal on all cropland. Therefore, removal of crop residue on flat lands may lead to increased revenue for producers, without significantly increasing sediment or phosphorus losses to surface waters. JF - Journal of Environmental Hydrology AU - Gowda, PH AU - Westra, J V AU - Petrolia, D AU - Dalzell, B J AU - Mulla, D J AD - USDA-ARS Conservation and Production Research Laboratory, P.O. Drawer 10 Bushland, TX 79012, USA, Prasanna.Gowda@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 PB - International Association for Environmental Hydrology, P.O. Box 35324 San Antonio TX 78235-5324 United States VL - 19 SN - 1058-3912, 1058-3912 KW - Meteorological & Geoastrophysical Abstracts; Pollution Abstracts; Aqualine Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Pesticide transport KW - Remote sensing KW - Soil erosion KW - Watersheds KW - Water quality KW - Streams KW - Crops KW - Agricultural land KW - Hydrologic Models KW - Sand KW - Mapping KW - Topography KW - Sediment pollution KW - crop residues KW - Residues KW - Drainage KW - Water Quality KW - Creek KW - USA, Minnesota KW - Sediments KW - Environmental protection KW - Cropland KW - Stream KW - Agricultural Practices KW - Pesticides KW - Conservation KW - tillage KW - AQ 00001:Water Resources and Supplies KW - SW 5040:Data acquisition KW - Q2 09123:Conservation KW - P 2000:FRESHWATER POLLUTION KW - M2 551.5:General (551.5) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926905652?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Environmental+Hydrology&rft.atitle=IMPACT+OF+TARGETED+REMOVAL+OF+RESIDUE+COVER+ON+WATER+QUALITY+IN+THE+SAND+CREEK+WATERSHED&rft.au=Gowda%2C+PH%3BWestra%2C+J+V%3BPetrolia%2C+D%3BDalzell%2C+B+J%3BMulla%2C+D+J&rft.aulast=Gowda&rft.aufirst=PH&rft.date=2011-11-01&rft.volume=19&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Journal+of+Environmental+Hydrology&rft.issn=10583912&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Sediment pollution; Stream; Pesticides; Remote sensing; Mapping; Water quality; Creek; Watersheds; Environmental protection; Pesticide transport; Drainage; Conservation; Soil erosion; Topography; Agricultural land; crop residues; Residues; Sand; tillage; Cropland; Hydrologic Models; Agricultural Practices; Water Quality; Streams; Sediments; Crops; USA, Minnesota ER - TY - JOUR T1 - Jurassic submarine troglobites: is there any link to the recent submarine cave fauna? AN - 926884050; 16352046 AB - Recent submarine caves are inhabited by endemic faunas adapted to oligotrophism, darkness and a tranquil environment. Many of their representatives are archaic types of animals resembling fossils from very early times in evolution. This article compares fossil fauna from Jurassic neptunian dykes (originally sea bed clefts) from the Western Carpathians with the Recent cave-dwelling fauna. The ostracods Pokornyopsis feifeli are particularly important. In the Western Carpathians, these were exclusively found in the Middle/Late Jurassic fissure fillings, but in the non-Tethyan Germanic Jurassic this species was found in deep-marine claystones. They are phylogenetic forerunners of the recent genus Danielopolina inhabiting both anchialine caves and deep seas. This indicates a Jurassic migration of deep-marine fauna to cryptic habitats. Other examples of cryptic communities include the Upper Jurassic cavity-dwelling fauna dominated by serpulids and scleractinian corals. Associated suspension feeders include thecideidine brachiopods, oysters, bryozoans, sponges, crinoids and sessile foraminifers. Serpulid-dominated bioconstructions have recent analogies in the Mediterranean and Carribean seas. Different type of dyke communities represent the Late Jurassic fauna of small sized ammonites which originated from both Tethyan and Boreal paleobioprovinces. It has not been established whether these amonites were juvenile, dwarfed specimens adapted to limited cave space or size-sorted adult specimens. JF - Hydrobiologia AU - Aubrecht, Roman AU - Schlogl, Jan AD - Department of Geology and Paleontology, Faculty of Natural Sciences, Comenius University, Mlynska dolina-G, 842 15, Bratislava, Slovakia, Aubrecht@fns.uniba.sk Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 3 EP - 14 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 677 IS - 1 SN - 0018-8158, 0018-8158 KW - Ecology Abstracts; Oceanic Abstracts; ASFA 1: Biological Sciences & Living Resources KW - Cavernicolous species KW - Animal fossils KW - Palaeo studies KW - Ostracoda KW - Migration KW - Foraminifera KW - Endemic species KW - Fossils KW - Brachiopoda KW - Body size KW - Deep sea KW - Corals KW - Suspension feeders KW - Ammonoidea KW - Phylogeny KW - Marine KW - Fossil assemblages KW - Jurassic KW - Habitat KW - Scleractinia KW - MED KW - Caves KW - Evolution KW - O 1080:Multi-disciplinary Studies KW - D 04050:Paleoecology KW - Q1 08187:Palaeontology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926884050?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Hydrobiologia&rft.atitle=Jurassic+submarine+troglobites%3A+is+there+any+link+to+the+recent+submarine+cave+fauna%3F&rft.au=Aubrecht%2C+Roman%3BSchlogl%2C+Jan&rft.aulast=Aubrecht&rft.aufirst=Roman&rft.date=2011-11-01&rft.volume=677&rft.issue=1&rft.spage=3&rft.isbn=&rft.btitle=&rft.title=Hydrobiologia&rft.issn=00188158&rft_id=info:doi/10.1007%2Fs10750-011-0687-3 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2016-09-29 N1 - SubjectsTermNotLitGenreText - Endemic species; Animal fossils; Fossil assemblages; Jurassic; Palaeo studies; Caves; Body size; Evolution; Phylogeny; Cavernicolous species; Fossils; Corals; Deep sea; Habitat; Migration; Suspension feeders; Scleractinia; Foraminifera; Ammonoidea; Brachiopoda; Ostracoda; MED; Marine DO - http://dx.doi.org/10.1007/s10750-011-0687-3 ER - TY - JOUR T1 - The Application of Ultrasound in the Enzymatic Hydrolysis of Switchgrass AN - 926882085; 16354132 AB - In a series of experiments, untreated and ammonium hydroxide pretreated Klenow lowland variety switchgrasses are converted to reducing sugars using low-frequency (20 kHz) ultrasound and commercially available cellulase enzyme. Results from experiments using untreated and pretreated switchgrasses with and without ultrasound are presented and discussed. In untreated switchgrass experiments, the combination of ultrasound and enzymes resulted in an increase of 7.5% in reducing sugars compared to experiments using just enzymes. In experiments using ammonium hydroxide pretreated switchgrass, the combination of ultrasound and enzymes resulted in an increase of 9.3% in reducing sugars compared to experiments using just enzymes. Experimental evidence indicates that there is a synergistic effect from the combination of ultrasound and enzymes which lowers the diffusion-limiting barrier to enzyme/substrate binding and results in an increase in reaction rate. Scanning electron microscopic images provide evidence that ultrasound-induced pitting increases substrate surface area and affects reaction rate and yield. JF - Applied Biochemistry and Biotechnology AU - Easson, Michael W AU - Condon, Brian AU - Dien, Bruce S AU - Iten, Loren AU - Slopek, Ryan AU - Yoshioka-Tarver, Megumi AU - Lambert, Allan AU - Smith, Jade AD - Southern Regional Research Center, 1100 Robert E. Lee Blvd., New Orleans, LA, 70124, USA, Michael.Easson@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 1322 EP - 1331 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 165 IS - 5-6 SN - 0273-2289, 0273-2289 KW - Biotechnology and Bioengineering Abstracts KW - Sugar KW - Ammonium KW - Surface area KW - Enzymes KW - Ultrasound KW - Hydrolysis KW - Cellulase KW - W 30910:Imaging UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926882085?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Biochemistry+and+Biotechnology&rft.atitle=The+Application+of+Ultrasound+in+the+Enzymatic+Hydrolysis+of+Switchgrass&rft.au=Easson%2C+Michael+W%3BCondon%2C+Brian%3BDien%2C+Bruce+S%3BIten%2C+Loren%3BSlopek%2C+Ryan%3BYoshioka-Tarver%2C+Megumi%3BLambert%2C+Allan%3BSmith%2C+Jade&rft.aulast=Easson&rft.aufirst=Michael&rft.date=2011-11-01&rft.volume=165&rft.issue=5-6&rft.spage=1322&rft.isbn=&rft.btitle=&rft.title=Applied+Biochemistry+and+Biotechnology&rft.issn=02732289&rft_id=info:doi/10.1007%2Fs12010-011-9349-1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Ammonium; Sugar; Surface area; Enzymes; Hydrolysis; Ultrasound; Cellulase DO - http://dx.doi.org/10.1007/s12010-011-9349-1 ER - TY - JOUR T1 - Vaccination of sex reversed hybrid tilapia (Oreochromis niloticus O. aureus) with an inactivated Vibrio vulnificus vaccine AN - 918050920; 15964713 AB - Vibrio vulnificus causes disease in economically important aquaculture raised fish and is an opportunistic human pathogen. This study reports on the isolation of V. vulnificus from diseased hybrid tilapia (Oreochromis niloticus O. aureus) cultured in a North American water reuse facility. Our objectives were to characterize the isolate using biochemical and molecular methods, develop a disease challenge model, and determine the ability of a formalin inactivated whole-cell vaccine to protect against V. vulnificus. The V. vulnificus isolate recovered was biotype 1, 16S rRNA type B, vcg type C, and vvhA type 2 and caused disease in tilapia held in static salt water (1.5 g/l sea salt). Fish vaccinated with the formalin inactivated whole-cell vaccine responded to vaccination with titers from vaccinated fish ranging from 32 to 64 and titers from non-vaccinated fish ranging from 4 to 8. In two trials, vaccinated tilapia exhibited relative percent survival (RPS) of 73 and 60% following homologous isolate challenge. In two additional trials, vaccinated tilapia exhibited RPS values of up to 88% following challenge with a heterologous isolate; the use of a mineral oil adjuvant enhanced protection. This vaccine may provide an effective means of preventing infections caused by biochemically and genetically diverse V. vulnificus. JF - Biologicals AU - Shoemaker, Craig A AU - LaFrentz, Benjamin R AU - Klesius, Phillip H AD - United States Department of Agriculture-Agricultural Research Service, Aquatic Animal Health Research Unit, 990 Wire Road, Auburn, AL 36832-4352, USA, craig.shoemaker@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 424 EP - 429 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 39 IS - 6 SN - 1045-1056, 1045-1056 KW - ASFA 1: Biological Sciences & Living Resources; ASFA Aquaculture Abstracts; Microbiology Abstracts B: Bacteriology KW - Vibrio vulnificus KW - Vaccine KW - Tilapia KW - Aquaculture KW - Molecular modelling KW - mineral oil KW - Human diseases KW - Biotypes KW - Disease control KW - Survival KW - Formaldehyde KW - Adjuvants KW - Infection KW - Public health KW - Hybrids KW - Fish culture KW - Sex KW - North America KW - Pathogenic bacteria KW - Pathogens KW - Vaccination KW - Opportunist infection KW - Aquaculture economics KW - Salts KW - Hybrid culture KW - Fish diseases KW - Vaccines KW - rRNA 16S KW - Oreochromis niloticus KW - Q1 08485:Species interactions: pests and control KW - J 02350:Immunology KW - Q3 08587:Diseases of Cultured Organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/918050920?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biologicals&rft.atitle=Vaccination+of+sex+reversed+hybrid+tilapia+%28Oreochromis+niloticus+O.+aureus%29+with+an+inactivated+Vibrio+vulnificus+vaccine&rft.au=Shoemaker%2C+Craig+A%3BLaFrentz%2C+Benjamin+R%3BKlesius%2C+Phillip+H&rft.aulast=Shoemaker&rft.aufirst=Craig&rft.date=2011-11-01&rft.volume=39&rft.issue=6&rft.spage=424&rft.isbn=&rft.btitle=&rft.title=Biologicals&rft.issn=10451056&rft_id=info:doi/10.1016%2Fj.biologicals.2011.08.004 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Last updated - 2014-09-18 N1 - SubjectsTermNotLitGenreText - Aquaculture economics; Human diseases; Pathogenic bacteria; Fish diseases; Hybrid culture; Disease control; Vaccines; Fish culture; Public health; mineral oil; Molecular modelling; Biotypes; Formaldehyde; Survival; Pathogens; Adjuvants; Infection; Vaccination; Aquaculture; Opportunist infection; Salts; Hybrids; rRNA 16S; Sex; Vibrio vulnificus; Oreochromis niloticus; North America DO - http://dx.doi.org/10.1016/j.biologicals.2011.08.004 ER - TY - JOUR T1 - Effects of dietary supplementation of a purified nucleotide mixture on immune function and disease and stress resistance in channel catfish, Ictalurus punctatus AN - 915483386; 16096053 AB - Juvenile channel catfish (14.4g average initial weight) were fed diets supplemented with a purified nucleotide mixture for 8 weeks. The mixture consisted of five nucleotides supplied on an equal basis as disodium salts at combined concentrations of 0 (control), 0.1%, 0.3%, 0.9% or 2.7% of diet. Addition of nucleotides to diet produced a dose-dependent reduction in survival of channel catfish to Edwardsiella ictaluri. Although the reasons are unclear, the high levels of nucleotides supplemented in this study may have contributed to the decrease in disease resistance, and this decrease appeared to be unrelated to the innate immune (unaffected) and specific antibody (enhanced) responses. Stress resistance increased with a corresponding amelioration of the immunosuppressive effects of the stress response on non-specific immunity (lysozyme and bactericidal activity) as nucleotides increased in diet. Use of exogenous nucleotides as a prophylactic treatment before culture-related stress exposure may prove beneficial by decreasing the immunosuppressive effects of stress but not in prevention of ESC. JF - Aquaculture Research AU - Welker, Thomas L AU - Lim, Chhorn AU - Yildirim-Aksoy, Mediha AU - Klesius, Phillip H AD - Aquatic Animal Health Research Laboratory, United States Department of Agriculture, Agricultural Research Service, Auburn, AL, USA Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1878 EP - 1889 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 42 IS - 12 SN - 1355-557X, 1355-557X KW - Biochemistry Abstracts 2: Nucleic Acids; Immunology Abstracts; Environment Abstracts; ASFA Aquaculture Abstracts; ASFA 1: Biological Sciences & Living Resources KW - disease resistance KW - Lysozyme KW - Edwardsiella ictaluri KW - Survival KW - Disease resistance KW - Freshwater KW - Freshwater fish KW - Aquaculture KW - Ictalurus punctatus KW - Feed composition KW - prevention KW - Bactericidal activity KW - Fish culture KW - Diets KW - Stress KW - Immunity KW - Nucleotides KW - Salts KW - Antibodies KW - Fish diseases KW - Dietary supplements KW - Feeding experiments KW - Immune response KW - survival KW - Immunosuppression KW - N 14840:Antisense, Nucleotide Analogs KW - Q1 08485:Species interactions: pests and control KW - F 06940:Fish Immunity KW - Q3 08587:Diseases of Cultured Organisms KW - ENA 02:Toxicology & Environmental Safety UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/915483386?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aquaculture+Research&rft.atitle=Effects+of+dietary+supplementation+of+a+purified+nucleotide+mixture+on+immune+function+and+disease+and+stress+resistance+in+channel+catfish%2C+Ictalurus+punctatus&rft.au=Welker%2C+Thomas+L%3BLim%2C+Chhorn%3BYildirim-Aksoy%2C+Mediha%3BKlesius%2C+Phillip+H&rft.aulast=Welker&rft.aufirst=Thomas&rft.date=2011-11-01&rft.volume=42&rft.issue=12&rft.spage=1878&rft.isbn=&rft.btitle=&rft.title=Aquaculture+Research&rft.issn=1355557X&rft_id=info:doi/10.1111%2Fj.1365-2109.2010.02794.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Document feature - figure 5 N1 - Last updated - 2014-09-18 N1 - SubjectsTermNotLitGenreText - Diets; Antibodies; Fish diseases; Feeding experiments; Disease resistance; Freshwater fish; Fish culture; Nucleotides; Feed composition; Lysozyme; Salts; Dietary supplements; Survival; Stress; Immunity; Immune response; Bactericidal activity; Immunosuppression; disease resistance; prevention; survival; Aquaculture; Edwardsiella ictaluri; Ictalurus punctatus; Freshwater DO - http://dx.doi.org/10.1111/j.1365-2109.2010.02794.x ER - TY - JOUR T1 - Nanotechnologies in agriculture: New tools for sustainable development AN - 912921880; 16073499 AB - Nanoscale science and nanotechnology have been demonstrated to have great potential in providing novel and improved solutions to many grand challenges facing agriculture and society today and in the future. This review highlights some of the most promising and important nanotechnology applications in agriculture; and recommends several strategies for advancing the best scientific and technological knowledge presently being examined. In addition, implications for human and environmental health, and technical, financial and capacity-related challenges as they relate to developing countries are identified. Finally, some suggested mechanisms for partnerships and collaborations are also identified and suggested. JF - Trends in Food Science & Technology AU - Chen, Hongda AU - Yada, Rickey AD - National Institute of Food and Agriculture, U.S. Department of Agriculture, 1400 Independence Avenue, MS 2220, SW Washington, DC 20250-2220, USA, hchen@nifa.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 585 EP - 594 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 22 IS - 11 SN - 0924-2244, 0924-2244 KW - Sustainability Science Abstracts KW - Reviews KW - agriculture KW - Sustainable development KW - Environmental health KW - Developing countries KW - nanotechnology KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/912921880?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Trends+in+Food+Science+%26+Technology&rft.atitle=Nanotechnologies+in+agriculture%3A+New+tools+for+sustainable+development&rft.au=Chen%2C+Hongda%3BYada%2C+Rickey&rft.aulast=Chen&rft.aufirst=Hongda&rft.date=2011-11-01&rft.volume=22&rft.issue=11&rft.spage=585&rft.isbn=&rft.btitle=&rft.title=Trends+in+Food+Science+%26+Technology&rft.issn=09242244&rft_id=info:doi/10.1016%2Fj.tifs.2011.09.004 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2015-04-09 N1 - SubjectsTermNotLitGenreText - Reviews; agriculture; Environmental health; Sustainable development; Developing countries; nanotechnology DO - http://dx.doi.org/10.1016/j.tifs.2011.09.004 ER - TY - JOUR T1 - Development and Evaluation of an Enzyme-Linked Immunosorbent Assay for Use in the Detection of Bovine Tuberculosis in Cattle AN - 911162751; 16062945 AB - As a consequence of continued spillover of Mycobacterium bovis into cattle from wildlife reservoirs and increased globalization of cattle trade with associated transmission risks, new approaches such as vaccination and novel testing algorithms are seriously being considered by regulatory agencies for the control of bovine tuberculosis. Serologic tests offer opportunities for identification of M. bovis-infected animals not afforded by current diagnostic techniques. The present study describes assay development and field assessment of a new commercial enzyme-linked immunosorbent assay (ELISA) that detects antibody to M. bovis antigens MPB83 and MPB70 in infected cattle. Pertinent findings include the following: specific antibody responses were detected at 90 to 100 days after experimental M. bovis challenge, minimal cross-reactive responses were elicited by infection/sensitization with nontuberculous Mycobacterium spp., and the apparent sensitivity and specificity of the ELISA with naturally infected cattle were 63% and 98%, respectively, with sensitivity improving as disease severity increased. The ELISA also detected infected animals missed by the routine tuberculin skin test, and antibody was detectable in bulk tank milk samples from M. bovis-infected dairy herds. A high-throughput ELISA could be adapted as a movement, border, or slaughter surveillance test, as well as a supplemental test to tuberculin skin testing. JF - Clinical and Vaccine Immunology AU - Waters, W R AU - Buddle, B M AU - Vordermeier, H M AU - Gormley, E AU - Palmer, M V AU - Thacker, T C AU - Bannantine, J P AU - Stabel, J R AU - Linscott, R AU - Martel, E AD - National Animal Disease Center, Agricultural Research Service, U.S. Department of Agriculture, Ames, Iowa, ray.waters@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1882 PB - American Society for Microbiology, 1752 N Street N.W. Washington, DC 20036 United States VL - 18 IS - 11 SN - 1556-679X, 1556-679X KW - Microbiology Abstracts B: Bacteriology; Immunology Abstracts KW - Enzyme-linked immunosorbent assay KW - Milk KW - Wildlife KW - Algorithms KW - Mycobacterium bovis KW - Infection KW - Vaccination KW - Skin tests KW - Antibodies KW - Dairies KW - Tuberculosis KW - Tuberculin KW - Slaughter KW - F 06905:Vaccines KW - J 02300:Methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911162751?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Clinical+and+Vaccine+Immunology&rft.atitle=Development+and+Evaluation+of+an+Enzyme-Linked+Immunosorbent+Assay+for+Use+in+the+Detection+of+Bovine+Tuberculosis+in+Cattle&rft.au=Waters%2C+W+R%3BBuddle%2C+B+M%3BVordermeier%2C+H+M%3BGormley%2C+E%3BPalmer%2C+M+V%3BThacker%2C+T+C%3BBannantine%2C+J+P%3BStabel%2C+J+R%3BLinscott%2C+R%3BMartel%2C+E&rft.aulast=Waters&rft.aufirst=W&rft.date=2011-11-01&rft.volume=18&rft.issue=11&rft.spage=1882&rft.isbn=&rft.btitle=&rft.title=Clinical+and+Vaccine+Immunology&rft.issn=1556679X&rft_id=info:doi/10.1128%2FCVI.05343-11 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2012-03-29 N1 - SubjectsTermNotLitGenreText - Dairies; Antibodies; Enzyme-linked immunosorbent assay; Milk; Wildlife; Algorithms; Slaughter; Tuberculin; Tuberculosis; Infection; Vaccination; Skin tests; Mycobacterium bovis DO - http://dx.doi.org/10.1128/CVI.05343-11 ER - TY - JOUR T1 - Comparison of separate hydrolysis and fermentation and simultaneous saccharification and fermentation processes for ethanol production from wheat straw by recombinant Escherichia coli strain FBR5 AN - 911158550; 15946597 AB - Ethanol production by recombinant Escherichia coli strain FBR5 from dilute acid pretreated wheat straw (WS) by separate hydrolysis and fermentation (SHF) and simultaneous saccharification and fermentation (SSF) was studied. The yield of total sugars from dilute acid (0.5% H sub(2)SO sub(4)) pretreated (160 degree C, 10 min) and enzymatically saccharified (pH 5.0, 45 degree C, 72 h) WS (86 g/l) was 50.0+/-1.4 g/l. The hydrolyzate contained 1,184+/-19 mg furfural and 161+/-1 mg hydroxymethyl furfural per liter. The recombinant E. coli FBR5 could not grow at all at pH controlled at 4.5 to 6.5 in the non-abated wheat straw hydrolyzate (WSH) at 35 degree C. However, it produced 21.9+/-0.3 g ethanol from non-abated WSH (total sugars, 44.1+/-0.4 g/l) in 90 h including the lag time of 24 h at controlled pH 7.0 and 35 degree C. The bioabatement of WS was performed by growing Coniochaeta ligniaria NRRL 30616 in the liquid portion of the pretreated WS aerobically at pH 6.5 and 30 degree C for 15 h. The bacterium produced 21.6+/-0.5 g ethanol per liter in 40 h from the bioabated enzymatically saccharified WSH (total sugars, 44.1+/-0.4 g) at pH 6.0. It produced 24.9+/-0.3 g ethanol in 96 h and 26.7+/-0.0 g ethanol in 72 h per liter from bioabated WSH by batch SSF and fed-batch SSF, respectively. SSF offered a distinct advantage over SHF with respect to reducing total time required to produce ethanol from the bioabated WS. Also, fed-batch SSF performed better than the batch SSF with respect to shortening the time requirement and increase in ethanol yield. JF - Applied Microbiology and Biotechnology AU - Saha, Badal C AU - Nichols, Nancy N AU - Qureshi, Nasib AU - Cotta, Michael A AD - Bioenergy Research Unit, National Center for Agricultural Utilization Research, U.S. Department of Agriculture, Agricultural Research Service, Peoria, IL, 61604, USA, Badal.Saha@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 865 EP - 874 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 92 IS - 4 SN - 0175-7598, 0175-7598 KW - Microbiology Abstracts B: Bacteriology; Microbiology Abstracts A: Industrial & Applied Microbiology; Biotechnology and Bioengineering Abstracts KW - Batch culture KW - Coniochaeta KW - Ethanol KW - A:01330 KW - J:02420 KW - W 30945:Fermentation & Cell Culture UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911158550?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Microbiology+and+Biotechnology&rft.atitle=Comparison+of+separate+hydrolysis+and+fermentation+and+simultaneous+saccharification+and+fermentation+processes+for+ethanol+production+from+wheat+straw+by+recombinant+Escherichia+coli+strain+FBR5&rft.au=Saha%2C+Badal+C%3BNichols%2C+Nancy+N%3BQureshi%2C+Nasib%3BCotta%2C+Michael+A&rft.aulast=Saha&rft.aufirst=Badal&rft.date=2011-11-01&rft.volume=92&rft.issue=4&rft.spage=865&rft.isbn=&rft.btitle=&rft.title=Applied+Microbiology+and+Biotechnology&rft.issn=01757598&rft_id=info:doi/10.1007%2Fs00253-011-3600-0 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Ethanol; Coniochaeta DO - http://dx.doi.org/10.1007/s00253-011-3600-0 ER - TY - JOUR T1 - First Report of the Walnut Witches'-Broom Phytoplasma on Japanese and Black Walnut in Iowa AN - 907193350; 16044396 AB - A single Japanese walnut (Juglans ailantifolia Carriere, an ornamental, deciduous tree) with symptoms of witches'-brooms and branch dieback, consistent with those associated with the walnut witches'-broom (WWB) phytoplasma (1), was observed near Ames, IA. No other Japanese walnut trees were present in the planting and the numerous black walnut (Juglans nigra L.) trees were asymptomatic. Leaf samples were collected in September 2009 from witches'-brooms as well as from two asymptomatic branches from the Japanese walnut tree and from three branches each from two nearby (10 m and 100 m away, respectively) black walnut trees. The presence of phytoplasma was tested using DNA extracted (sodium dodecyl sulfate and potassium acetate methods) from the midvein of individual leaves and PCR with universal phytoplasma primers P1 and P7, which amplify from the beginning of the 16S rDNA to the beginning of the 23S rDNA gene (4). Each of the five symptomatic leaves yielded a PCR product, but the two asymptomatic leaves from the sole Japanese walnut tree did not. One of the three asymptomatic leaves from a black walnut tree (100 m away) was also positive. In a subsequent round of PCR, with the nested primers R16F2 and R16R2 (4), three additional asymptomatic leaves from the two black walnut trees were positive. The P1/P7 or R16F2/R16R2 products from each of the three trees were directly sequenced or cloned into a TA vector and sequenced using vector primers. The BLAST searches (v. 2.2.2.4) of these sequences most closely matched the sequences of the WWB phytoplasma and other members of the 16SrIII group (peach X-disease). The closest matches for the full P1/P7 sequence from the Japanese walnut (GenBank Accession No. HQ221553, 1,814 bp) were with those of phytoplasmas associated with WWB from two black walnut trees in Georgia (AF190227, 1,812 of 1,815 bp matching; and AF190226, 1,808 of 1,815 bp matching), spiraea stunt (AF190228, 1,808 of 1,814 bp), and western X (AF533231, 1,807 of 1,814 bp). The iPhy-Classifier restriction fragment length polymorphism similarity coefficient was 0.99 for L33733 (Canadian peach X phytoplasma) and 0.98 for AF190226. Sequence HQ221553 differed by 10 bp from the sequence from the asymptomatic black walnut tree that was 100 m away (HQ221554, 1,815 bp), which matched closest to one of the black walnut samples from Georgia (AF190227, 1,807 of 1,816 bp). A 1,029-bp fragment from the second black walnut tree (10 m away) differed by 1 or 2 bp from the Georgia WWB accessions. To our knowledge, this is the first report of WWB symptoms in Iowa and the first identification of the WWB phytoplasma outside of Georgia (1). The disease, however, is more widely known (Illinois, Indiana, and Ohio) and may cause serious reduction in nut production (1-3). It can be lethal to Juglans spp., especially to exotic species such as Japanese walnut (2,3). The native black walnut is thought to be relatively resistant to tolerant of WWB (2,3) and may only show growth decline with no symptoms, except for broom production from cut surfaces (3). Care should be taken in moving planting stock of black walnut (4) because asymptomatic trees may harbor the phytoplasma. JF - Plant Disease AU - Yun, HY AU - Harrington, T C AD - Systematic Mycology and Microbiology Laboratory, USDA-ARS, Beltsville, MD 20705, USA Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1474 EP - 1475 VL - 95 IS - 11 SN - 0191-2917, 0191-2917 KW - Microbiology Abstracts B: Bacteriology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Plant diseases KW - Dieback KW - Trees KW - Restriction fragment length polymorphism KW - Leaves KW - Phytoplasma KW - Juglans KW - Prunus KW - Stunt KW - Branches KW - Planting KW - Spiraea KW - Juglans nigra KW - potassium acetate KW - Polymerase chain reaction KW - Primers KW - Introduced species KW - rRNA 16S KW - A 01360:Plant Diseases KW - J 02420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907193350?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=First+Report+of+the+Walnut+Witches%27-Broom+Phytoplasma+on+Japanese+and+Black+Walnut+in+Iowa&rft.au=Yun%2C+HY%3BHarrington%2C+T+C&rft.aulast=Yun&rft.aufirst=HY&rft.date=2011-11-01&rft.volume=95&rft.issue=11&rft.spage=1474&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-05-11-0412 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Plant diseases; Dieback; Trees; Leaves; Restriction fragment length polymorphism; Phytoplasma; Stunt; Branches; Planting; Polymerase chain reaction; potassium acetate; Primers; Introduced species; rRNA 16S; Spiraea; Juglans nigra; Juglans; Prunus DO - http://dx.doi.org/10.1094/PDIS-05-11-0412 ER - TY - JOUR T1 - Enhancing predation of a subterranean insect pest: A conservation benefit of winter vegetation in agroecosystems AN - 907181590; 16046671 AB - Generalist predator communities are abundant and diverse in agroecosystems, but pests often persist nevertheless. Winter vegetation (e.g., cover crops) provides an agronomically sound opportunity to conserve predator communities and promote their impact on pests. We evaluate whether winter vegetation increases predation of Diabrotica virgifera, a key subterranean pest of maize. Fields of maize were preceded by a winter cover crop (slender wheatgrass) or a fallow period (bare soil) over two years. Pest populations and root damage were measured in each field, from which the gut contents of predators aspirated from the soil surface, or extracted from the soil column, were analyzed using qPCR and primer sets specific to D. virgifera COI gene sequences. Predation intensity on restrained D. virgifera larvae (sentinels) was observed during the three larval stadia of the pest (n = 400 3rd instars per plot per stadium). A diverse predator community consumed D. virgifera in maize fields, and predation was significantly greater in maize following cover crops (as measured with sentinels, but not gut content analysis). Predation was particularly intense during the 3rd stadium of the pest, especially in the cover-cropped maize. qPCR-based gut content analysis of natural populations functioned well in determining which predators consumed D. virgifera, but was only correlated with their impact on the pest and its damage when the relative frequency of detection, quantity of DNA calculated, and predator abundance were combined into a predation index. In support of these observations, predation intensity on sentinels was negatively correlated with D. virgifera populations and plant damage, but did not provide an accurate picture of the community involved. Cover crops reduced D. virgifera populations by increasing predation levels on this pest, which indicates that conserving predation as an ecosystem service is a mechanism for how this form of habitat diversification functions. Also, we conclude that employing diverse methods provides the best insight into trophic relationships within subterranean systems. Finally, because of the dynamic and diverse interactions between pests and their natural enemy complexes, we advocate conserving diverse predator communities within agroecosystems, rather than targeting conservation efforts at specific key predator taxa. JF - Applied Soil Ecology AU - Lundgren, Jonathan G AU - Fergen, Janet K AD - USDA-ARS, North Central Agricultural Research Laboratory, 2923 Medary Avenue, Brookings, SD 57006, USA, Jonathan.Lundgren@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 9 EP - 16 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 51 SN - 0929-1393, 0929-1393 KW - Ecology Abstracts KW - Natural enemies KW - Predation KW - Abundance KW - Roots KW - Vegetation KW - Cover crops KW - Predators KW - Trophic relationships KW - Habitat KW - Soil KW - Digestive tract KW - Zea mays KW - Diabrotica virgifera KW - Plant communities KW - DNA KW - Sound KW - Conservation KW - Primers KW - COI protein KW - Pests KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907181590?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Soil+Ecology&rft.atitle=Enhancing+predation+of+a+subterranean+insect+pest%3A+A+conservation+benefit+of+winter+vegetation+in+agroecosystems&rft.au=Lundgren%2C+Jonathan+G%3BFergen%2C+Janet+K&rft.aulast=Lundgren&rft.aufirst=Jonathan&rft.date=2011-11-01&rft.volume=51&rft.issue=&rft.spage=9&rft.isbn=&rft.btitle=&rft.title=Applied+Soil+Ecology&rft.issn=09291393&rft_id=info:doi/10.1016%2Fj.apsoil.2011.08.005 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2012-03-29 N1 - SubjectsTermNotLitGenreText - Natural enemies; Abundance; Predation; Vegetation; Roots; Predators; Cover crops; Habitat; Trophic relationships; Soil; Digestive tract; Sound; DNA; Plant communities; Conservation; Primers; Pests; COI protein; Zea mays; Diabrotica virgifera DO - http://dx.doi.org/10.1016/j.apsoil.2011.08.005 ER - TY - JOUR T1 - First Report of Potato mop-top virus on Potatoes in Washington State AN - 907174321; 16044417 AB - In April of 2011, approximately 10% of the tubers of potato (Solatium tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG: PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea. which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States. JF - Plant Disease AU - Crosslin, JM AD - USDA-ARS, Vegetable and Forage Crops Research Unit, Prosser, WA 99350, USA Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1483 VL - 95 IS - 11 SN - 0191-2917, 0191-2917 KW - Virology & AIDS Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Enzyme-linked immunosorbent assay KW - Plant diseases KW - Tobacco rattle virus KW - Pathogens KW - Infection KW - Reverse transcription KW - Spongospora subterranea KW - Solanum tuberosum KW - Tobacco KW - Tubers KW - Polymerase chain reaction KW - Primers KW - Coat protein KW - Potato mop-top virus KW - Brown spot KW - Scab KW - A 01360:Plant Diseases KW - V 22310:Genetics, Taxonomy & Structure UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907174321?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=First+Report+of+Potato+mop-top+virus+on+Potatoes+in+Washington+State&rft.au=Crosslin%2C+JM&rft.aulast=Crosslin&rft.aufirst=JM&rft.date=2011-11-01&rft.volume=95&rft.issue=11&rft.spage=1483&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-06-11-0536 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - Plant diseases; Enzyme-linked immunosorbent assay; Tobacco; Polymerase chain reaction; Tubers; Coat protein; Primers; Pathogens; Infection; Brown spot; Reverse transcription; Scab; Spongospora subterranea; Solanum tuberosum; Tobacco rattle virus; Potato mop-top virus DO - http://dx.doi.org/10.1094/PDIS-06-11-0536 ER - TY - JOUR T1 - A five-year assessment of corn stover harvest in central Iowa, USA AN - 907173261; 15721790 AB - Sustainable feedstock harvest strategies are needed to ensure bioenergy production does not irreversibly degrade soil resources. The objective for this study was to document corn (Zea mays L.) grain and stover fraction yields, plant nutrient removal and replacement costs, feedstock quality, soil-test changes, and soil quality indicator response to four stover harvest strategies for continuous corn and a corn-soybean [Glycine max. (L.) Merr.] rotation. The treatments included collecting (1) all standing plant material above a stubble height of 10 cm (whole plant), (2) the upper-half by height (ear shank upward), (3) the lower-half by height (from the 10 cm stubble height to just below the earshank), or (4) no removal. Collectable biomass from Treatment 2 averaged 3.9 (+/-0.8) Mg ha super(-1 for continuous corn (2005 through 2009), and 4.8 (+/-0.4) Mg ha) super(-)1 for the rotated corn (2005, 2007, and 2009). Compared to harvesting only the grain, collecting stover increased the average N-P-K removal by 29, 3 and 34 kg ha super(-1 for continuous corn and 42, 3, and 34 kg ha) super(-)1 for rotated corn, respectively. Harvesting the lower-half of the corn plant (Treatment 3) required two passes, resulted in frequent plugging of the combine, and provided a feedstock with low quality for conversion to biofuel. Therefore, Treatment 3 was replaced by a 'cobs-only' harvest starting in 2009. Structural sugars glucan and xylan accounted for up to 60% of the chemical composition, while galactan, arabinan, and mannose constituted less than 5% of the harvest fractions collected from 2005 through 2008. Soil-test data from samples collected after the first harvest (2005) revealed low to very low plant-available P and K levels which reduced soybean yield in 2006 after harvesting the whole-plant in 2005. Average continuous corn yields were 21% lower than rotated yields with no significant differences due to stover harvest. Rotated corn yields in 2009 showed some significant differences, presumably because soil-test P was again in the low range. A soil quality analysis using the Soil Management Assessment Framework (SMAF) with six indicators showed that soils at the continuous corn and rotated sites were functioning at an average of 93 and 83% of their inherent potential, respectively. With good crop management practices, including routine soil-testing, adequate fertilization, maintenance of soil organic matter, sustained soil structure, and prevention of wind, water or tillage erosion, a portion of the corn stover being produced in central Iowa, USA can be harvested in a sustainable manner. JF - Soil and Tillage Research AU - Karlen, Douglas L AU - Birell, Stuart J AU - Hess, JRichard Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 47 EP - 55 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 115-116 SN - 0167-1987, 0167-1987 KW - Sustainability Science Abstracts; Environment Abstracts KW - Erosion KW - USA, Iowa KW - Glycine max KW - corn KW - ENA 03:Energy KW - M3:1010 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907173261?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Soil+and+Tillage+Research&rft.atitle=A+five-year+assessment+of+corn+stover+harvest+in+central+Iowa%2C+USA&rft.au=Karlen%2C+Douglas+L%3BBirell%2C+Stuart+J%3BHess%2C+JRichard&rft.aulast=Karlen&rft.aufirst=Douglas&rft.date=2011-11-01&rft.volume=115-116&rft.issue=&rft.spage=47&rft.isbn=&rft.btitle=&rft.title=Soil+and+Tillage+Research&rft.issn=01671987&rft_id=info:doi/10.1016%2Fj.still.2011.06.006 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - corn; Glycine max; USA, Iowa DO - http://dx.doi.org/10.1016/j.still.2011.06.006 ER - TY - JOUR T1 - Association Study of Resistance to Soilborne wheat mosaic virus in U.S. Winter Wheat AN - 907170405; 16074139 AB - Soilborne wheat mosaic virus (SBWMV) is one of the most important winter wheat pathogens worldwide. To identify genes for resistance to the virus in U.S. winter wheat, association study was conducted using a selected panel of 205 elite experimental lines and cultivars from U.S. hard and soft winter wheat breeding programs. Virus symptoms were evaluated twice in virus-infected fields for the panel at Manhattan, KS in spring 2010 and 2011 and for a subpanel of 137 hard winter wheat accessions at Stillwater, OK in spring 2008. At the two locations, 69.8 and 79.5% of cultivars were resistant or moderately resistant to the disease, respectively. After 282 simple-sequence repeat markers covering all wheat chromosome arms were scanned for association in the panel, marker Xgwm469 on the long arm of chromosome 5D (5DL) showed a significant association with the disease rating. Three alleles (Xgwm469-165bp, -167bp, and -169bp) were associated with resistance and the null allele was associated with susceptibility. Correlations between the marker and the disease rating were highly significant (0.80 in Manhattan at P < 0.0001 and 0.63 in Stillwater at P < 0.0001). The alleles Xgwm469-165bp and Xgwm469-169bp were present mainly in the hard winter wheat group, whereas allele Xgwm469-167bp was predominant in the soft winter wheat. The 169 bp allele can be traced back to 'Newton', and the 165 bp allele to Aegilops tauschii. In addition, a novel locus on the short arm of chromosome 4D (4DS) was also identified to associate with the disease rating. Marker Xgwm469-5DL is closely linked to SBWMV resistance and highly polymorphic across the winter wheat accessions sampled in the study and, thus, should be useful in marker-assisted selection in U.S. winter wheat. JF - Phytopathology AU - Zhang, D AU - Bai, G AU - Hunger, R M AU - Bockus, W W AU - Yu, J AU - Carver, B F AU - Brown-Guedira, G AD - United States Department of Agriculture-Agricultural Research Service (USDA-ARS) Hard Winter Wheat Genetics Research Unit, Manhattan, KS 66506, USA, guihua.bai@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 1322 EP - 1329 VL - 101 IS - 11 SN - 0031-949X, 0031-949X KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Virology & AIDS Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Triticum aestivum KW - Chromosomes KW - Aegilops tauschii KW - Plant breeding KW - Disease resistance KW - Pathogens KW - marker-assisted selection KW - A 01360:Plant Diseases KW - V 22310:Genetics, Taxonomy & Structure KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907170405?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Phytopathology&rft.atitle=Association+Study+of+Resistance+to+Soilborne+wheat+mosaic+virus+in+U.S.+Winter+Wheat&rft.au=Zhang%2C+D%3BBai%2C+G%3BHunger%2C+R+M%3BBockus%2C+W+W%3BYu%2C+J%3BCarver%2C+B+F%3BBrown-Guedira%2C+G&rft.aulast=Zhang&rft.aufirst=D&rft.date=2011-11-01&rft.volume=101&rft.issue=11&rft.spage=1322&rft.isbn=&rft.btitle=&rft.title=Phytopathology&rft.issn=0031949X&rft_id=info:doi/10.1094%2FPHYTO-02-11-0041 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Chromosomes; Plant breeding; Pathogens; Disease resistance; marker-assisted selection; Triticum aestivum; Aegilops tauschii DO - http://dx.doi.org/10.1094/PHYTO-02-11-0041 ER - TY - JOUR T1 - Detection and Classification of SPLCV Isolates in the U.S. Sweetpotato Germplasm Collection via a Real-Time PCR Assay and Phylogenetic Analysis AN - 907170020; 16044382 AB - The United States Department of Agriculture-Agricultural Research Service sweetpotato (Ipomoea batatas) germplasm collection contains accessions that were initially collected from various countries worldwide. These materials have been maintained and distributed as in vitro plantlets since the mid-1980s. The status of viral infection by the emerging Sweet potato leaf curl virus (SPLCV) and other Begomovirus spp. in this germplasm has yet to be determined. In order to minimize the potential distribution of virus-infected clones, all accessions in the collection were tested for SPLCV using a real-time polymerase chain reaction assay. In total, 47 of 701 accessions of in vitro plantlets tested positive for SPLCV. The presence of SPLCV detected in these materials was confirmed via biological indexing using the indicator plants I. nil and I. muricata. Symptoms appeared more rapidly on I. muricata than on I. nil. Nucleotide polymorphisms among the isolates were evaluated by sequencing the AV1 coat protein gene from 24 SPLCV-infected accessions. The results revealed that the SPLCV isolates shared high sequence identity. Ten nucleotide substitutions were identified, most of which were synonymous changes. Phylogenetic analysis was conducted on those 24 SPLCV isolates in combination with six described SPLCV species and various SPLCV strains from GenBank to evaluate the relationships among viral species or strains. The results from this analysis indicated that most of the AV1 genes derived from previously classified SPLCV species clustered together, some of which formed well-supported monophyletic clades, further supporting the current taxonomy. Overall, identification of SPLCV-infected germplasm will allow approaches to be employed to eliminate the virus from the collection and limit the distribution of infected materials. JF - Plant Disease AU - Barkley, NA AU - Pinnow, D L AU - Wane, M L AU - Ling, K S AU - Jarret, R L AD - United States Department of Agriculture-Agricultural Research Service (USDA-ARS), Plant Genetic Resources Conservation Unit, Griffin, GA 30223, USA, Elle.Barkley@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1385 EP - 1391 VL - 95 IS - 11 SN - 0191-2917, 0191-2917 KW - Microbiology Abstracts A: Industrial & Applied Microbiology KW - Begomovirus KW - Phylogeny KW - Ipomoea batatas KW - Plant diseases KW - Gene polymorphism KW - Nucleotide sequence KW - Leaves KW - Infection KW - Nucleotides KW - Plantlets KW - Solanum tuberosum KW - Germplasm KW - Polymerase chain reaction KW - Coat protein KW - Taxonomy KW - A 01360:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907170020?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Disease&rft.atitle=Detection+and+Classification+of+SPLCV+Isolates+in+the+U.S.+Sweetpotato+Germplasm+Collection+via+a+Real-Time+PCR+Assay+and+Phylogenetic+Analysis&rft.au=Barkley%2C+NA%3BPinnow%2C+D+L%3BWane%2C+M+L%3BLing%2C+K+S%3BJarret%2C+R+L&rft.aulast=Barkley&rft.aufirst=NA&rft.date=2011-11-01&rft.volume=95&rft.issue=11&rft.spage=1385&rft.isbn=&rft.btitle=&rft.title=Plant+Disease&rft.issn=01912917&rft_id=info:doi/10.1094%2FPDIS-01-11-0012 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-04-17 N1 - SubjectsTermNotLitGenreText - Phylogeny; Plantlets; Plant diseases; Nucleotide sequence; Gene polymorphism; Germplasm; Leaves; Polymerase chain reaction; Taxonomy; Coat protein; Infection; Nucleotides; Begomovirus; Ipomoea batatas; Solanum tuberosum DO - http://dx.doi.org/10.1094/PDIS-01-11-0012 ER - TY - JOUR T1 - Engineering lower inhibitor affinities in β-D-xylosidase of Selenomonas ruminantium by site-directed mutagenesis of Trp145. AN - 900631102; 21528413 AB - β-D-Xylosidase/α-L-arabinofuranosidase from Selenomonas ruminantium is the most active enzyme reported for catalyzing hydrolysis of 1,4-β-D-xylooligosaccharides to D-xylose. One property that could use improvement is its relatively high affinities for D-glucose and D-xylose (K (i) ~ 10 mM), which would impede its performance as a catalyst in the saccharification of lignocellulosic biomass for the production of biofuels and other value-added products. Previously, we discovered that the W145G variant expresses K(i)(D-glucose) and K(i)(D-xylose) twofold and threefold those of the wild-type enzyme. However, in comparison to the wild type, the variant expresses 11% lower k(cat)(D-xylobiose) and much lower stabilities to temperature and pH. Here, we performed saturation mutagenesis of W145 and discovered that the variants express K (i) values that are 1.5-2.7-fold (D-glucose) and 1.9-4.6-fold (D-xylose) those of wild-type enzyme. W145F, W145L, and W145Y express good stability and, respectively, 11, 6, and 1% higher k(cat)(D-xylobiose) than that of the wild type. At 0.1 M D-xylobiose and 0.1 M D-xylose, kinetic parameters indicate that W145F, W145L, and W145Y catalytic activities are respectively 46, 71, and 48% greater than that of the wild-type enzyme. JF - Journal of industrial microbiology & biotechnology AU - Jordan, Douglas B AU - Wagschal, Kurt AU - Fan, Zhanmin AU - Yuan, Ling AU - Braker, Jay D AU - Heng, Chamroeun AD - National Center for Agricultural Utilization Research, USDA Agricultural Research Service, 1815 N. University Street, Peoria, IL 61604, USA. douglas.jordan@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 1821 EP - 1835 VL - 38 IS - 11 KW - Tryptophan KW - 8DUH1N11BX KW - Xylose KW - A1TA934AKO KW - Glycoside Hydrolases KW - EC 3.2.1.- KW - Xylosidases KW - exo-1,4-beta-D-xylosidase KW - EC 3.2.1.37 KW - alpha-N-arabinofuranosidase KW - EC 3.2.1.55 KW - Glucose KW - IY9XDZ35W2 KW - Index Medicus KW - Mutagenesis, Site-Directed KW - Glycoside Hydrolases -- metabolism KW - Kinetics KW - Glucose -- metabolism KW - Enzyme Stability KW - Xylose -- metabolism KW - Hydrolysis KW - Tryptophan -- genetics KW - Biocatalysis KW - Xylosidases -- chemistry KW - Selenomonas -- enzymology KW - Xylosidases -- metabolism KW - Xylosidases -- genetics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/900631102?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+industrial+microbiology+%26+biotechnology&rft.atitle=Engineering+lower+inhibitor+affinities+in+%CE%B2-D-xylosidase+of+Selenomonas+ruminantium+by+site-directed+mutagenesis+of+Trp145.&rft.au=Jordan%2C+Douglas+B%3BWagschal%2C+Kurt%3BFan%2C+Zhanmin%3BYuan%2C+Ling%3BBraker%2C+Jay+D%3BHeng%2C+Chamroeun&rft.aulast=Jordan&rft.aufirst=Douglas&rft.date=2011-11-01&rft.volume=38&rft.issue=11&rft.spage=1821&rft.isbn=&rft.btitle=&rft.title=Journal+of+industrial+microbiology+%26+biotechnology&rft.issn=1476-5535&rft_id=info:doi/10.1007%2Fs10295-011-0971-2 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2012-09-21 N1 - Date created - 2011-10-21 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1007/s10295-011-0971-2 ER - TY - JOUR T1 - Predicted fates of ground-nesting bees in soil heated by wildfire: Thermal tolerances of life stages and a survey of nesting depths AN - 899161499; 15707954 AB - Periodic wildfire defines plant community composition and dynamics in many of the world's semi-arid biomes, whose climates and floras also favor wild bee diversity. Invasive flammable grasses, deforestation, historical fire suppression and human ignition are increasing fire frequency and intensifying its severity, as well as introducing fire to previously fireproof biomes. In many of these habitats, bees are key pollinators. Many, often most of the solitary bee species and individuals in these biomes nest underground (so-called "mining" bees). To evaluate their susceptibility to fire, we tested heat tolerances of bees' four life stages using an experimental design that mimicked heat conduction dynamics of natural soils. All life stages survived heating of up to 45 degree C for 27min, but none survived heating at 54 degree C for 9min; the pupal stage survived best. At near-lethal temperatures, more prolonged heating caused more mortality. These data were related to published studies of heat penetration depths in soil during fire and an exhaustive compilation of published nesting depths reported for mining bees. We conclude that a small fraction (9%) of the shallowest-nesting mining bee species is likely to die from soil heating by wildfire. Among these, ground-nesting megachilids (Osmia, Megachile) will be most vulnerable, owing to their shallow horizontal nests. Because mining bees prevail in most biomes of the temperate zone, any vegetation rehabilitation efforts should therefore expect that bee communities will largely survive the immediate effects of wildfire, and therefore will need pollen and nectar resources in the year(s) after fire. JF - Biological Conservation AU - Cane, James H AU - Neff, John L Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 2631 EP - 2636 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 144 IS - 11 SN - 0006-3207, 0006-3207 KW - Entomology Abstracts; Sustainability Science Abstracts; Ecology Abstracts KW - Apiformes KW - Apoidea KW - Pollinator KW - Fire KW - wildfire KW - Grasses KW - nests KW - Megachile KW - Nests KW - Soil KW - pollen KW - Pollinators KW - Conduction KW - Temperature effects KW - Mortality KW - Fires KW - Data processing KW - Rehabilitation KW - Osmia KW - Climate KW - Temperature KW - Vegetation KW - Developmental stages KW - Nectar KW - Habitat KW - Pollen KW - Wildfire KW - Plant communities KW - Conservation KW - Mining KW - Deforestation KW - Z 05340:Ecology and Behavior KW - M3 1010:Issues in Sustainable Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/899161499?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biological+Conservation&rft.atitle=Predicted+fates+of+ground-nesting+bees+in+soil+heated+by+wildfire%3A+Thermal+tolerances+of+life+stages+and+a+survey+of+nesting+depths&rft.au=Cane%2C+James+H%3BNeff%2C+John+L&rft.aulast=Cane&rft.aufirst=James&rft.date=2011-11-01&rft.volume=144&rft.issue=11&rft.spage=2631&rft.isbn=&rft.btitle=&rft.title=Biological+Conservation&rft.issn=00063207&rft_id=info:doi/10.1016%2Fj.biocon.2011.07.019 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Temperature effects; Fires; Mortality; Data processing; Rehabilitation; Grasses; Climate; Developmental stages; Vegetation; Nectar; Habitat; Nests; Pollen; Soil; Wildfire; Pollinators; Plant communities; Conservation; Conduction; Deforestation; wildfire; pollen; Temperature; nests; Mining; Osmia; Megachile DO - http://dx.doi.org/10.1016/j.biocon.2011.07.019 ER - TY - JOUR T1 - Nearshore Restoration in Puget Sound: Understanding Stakeholder Values and Potential Coalitions AN - 899147733; 15716758 AB - Restoration of nearshore ecosystems presents many challenges for stakeholder involvement. Using surveys and interviews we examined stakeholder values, preferences, and potential coalitions surrounding nearshore restoration in the Whidbey sub-basin of Puget Sound. Most stakeholders in our study believe that Puget Sound nearshore problems are severe and urgent, and that it is worth investing in restoration. They do not agree on the causes of nearshore degradation, yet support stronger regulatory enforcement and increased public ownership as possible solutions to nearshore problems. Five potential stakeholder coalitions were identified based on shared values. These values reflect a varied spectrum of support for public sector solutions to nearshore problems and were labeled: No Government Intervention, Property Rights, Private Land Stewardship, Protect Undeveloped Areas, and Large Scale Restoration. The potential coalitions identified confirm the Advocacy Coalition Framework hypothesis that coalition members who share values do not necessarily share stakeholder demographics or preferences. This study demonstrates one method for understanding local stakeholders, and will help managers direct project resources, planning, and management, through reliance on both stakeholder and scientific input. In addition, managers can use information about stakeholder values and potential coalitions to more effectively frame communication products and stakeholder involvement activities. JF - Coastal Management AU - Lipsky, Rachel S AU - Ryan, Clare M AD - Forest Restoration Strategy Team Leader, USDA Forest Service, Okanogan-Wenatchee National Forest, Wenatchee, Washington, USA Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 577 EP - 597 PB - Taylor & Francis Group Ltd., 2 Park Square Oxford OX14 4RN United Kingdom VL - 39 IS - 6 SN - 0892-0753, 0892-0753 KW - Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Environment Abstracts; Sustainability Science Abstracts KW - advocacy coalition framework KW - coastal restoration KW - restoration planning KW - stakeholder coalitions KW - stakeholder involvement KW - demography KW - Resource management KW - Ecosystems KW - Coastal waters KW - Environmental protection KW - Restoration KW - Coastal zone management KW - Communications KW - intervention KW - coastal zone management KW - Property rights KW - INE, USA, Washington, Puget Sound KW - public sector KW - stakeholders KW - property rights KW - Legislation KW - National planning KW - Private lands KW - Reef fish KW - Q2 09123:Conservation KW - O 4090:Conservation and Environmental Protection KW - M3 1010:Issues in Sustainable Development KW - ENA 12:Oceans & Estuaries UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/899147733?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Coastal+Management&rft.atitle=Nearshore+Restoration+in+Puget+Sound%3A+Understanding+Stakeholder+Values+and+Potential+Coalitions&rft.au=Lipsky%2C+Rachel+S%3BRyan%2C+Clare+M&rft.aulast=Lipsky&rft.aufirst=Rachel&rft.date=2011-11-01&rft.volume=39&rft.issue=6&rft.spage=577&rft.isbn=&rft.btitle=&rft.title=Coastal+Management&rft.issn=08920753&rft_id=info:doi/10.1080%2F08920753.2011.600241 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Resource management; Property rights; Coastal waters; Environmental protection; National planning; Legislation; Coastal zone management; Reef fish; Restoration; demography; Communications; Ecosystems; intervention; coastal zone management; public sector; stakeholders; property rights; Private lands; INE, USA, Washington, Puget Sound DO - http://dx.doi.org/10.1080/08920753.2011.600241 ER - TY - JOUR T1 - Nutrient loss with runoff from fairway turf: an evaluation of core cultivation practices and their environmental impact. AN - 898840966; 21898559 AB - The presence of excess nutrients in surface waters can result in undesirable environmental and economic consequences, including nuisance algal blooms and eutrophication. Fertilizer use in highly managed turf systems has raised questions concerning the contribution of nutrients to surrounding surface waters. Experiments were designed to quantify phosphorus and nitrogen transport with runoff from turf plots maintained as a golf course fairway to identify which cultural practice, solid tine (ST) or hollow tine (HT) core cultivation, maximized phosphorus and nitrogen retention at the site of fertilizer application. Simulated precipitation and collection of resulting runoff were completed 26 ± 13 h following granular fertilizer application (18-3-18: N-P₂O₅-K₂O) and 63 d and 2 d following core cultivation. Runoff volumes were reduced in fairway turf plots aerated with HT relative to ST (63 d: 10%, 2 d: 55% reduction). Analysis of the runoff revealed a reduction in soluble phosphorus, ammonium nitrogen, and nitrate nitrogen losses with runoff from plots managed with HT; a 5 to 27% reduction after 63 d; and a 39 to 77% reduction at 2 d. Golf course runoff-to-surface water scenarios were used to calculate estimated environmental concentrations (EECs) of nitrogen and phosphorus in surface water receiving runoff from turf managed with ST or HT core cultivation. Surface water concentrations of phosphorus remained above the U.S. Environmental Protection Agency's water quality criteria to limit eutrophication, with the exception of concentrations associated with HT core cultivation at 2 d. Regardless of management practice (ST or HT) and time between core cultivation and runoff (63 d or 2 d), all EECs of nitrogen were below levels associated with increased algal growth. Understanding nutrient transport with runoff and identifying strategies that reduce off-site transport will increase their effectiveness at intended sites of application and minimize undesirable effects to surrounding surface water resources. Copyright © 2011 SETAC. JF - Environmental toxicology and chemistry AU - Rice, Pamela J AU - Horgan, Brian P AD - Agricultural Research Service, U.S. Department of Agriculture, St. Paul, Minnesota, USA. pamela.rice@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 2473 EP - 2480 VL - 30 IS - 11 KW - Fertilizers KW - 0 KW - Nitrates KW - Water Pollutants, Chemical KW - Phosphorus KW - 27YLU75U4W KW - Nitrogen KW - N762921K75 KW - Index Medicus KW - Environmental Monitoring KW - Water Pollutants, Chemical -- analysis KW - Eutrophication KW - Poaceae KW - Water Quality KW - Water Pollution -- prevention & control KW - Golf KW - Nitrates -- analysis KW - Environment KW - Fertilizers -- analysis KW - Water Movements KW - Nitrogen -- analysis KW - Rain KW - Phosphorus -- analysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/898840966?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+toxicology+and+chemistry&rft.atitle=Nutrient+loss+with+runoff+from+fairway+turf%3A+an+evaluation+of+core+cultivation+practices+and+their+environmental+impact.&rft.au=Rice%2C+Pamela+J%3BHorgan%2C+Brian+P&rft.aulast=Rice&rft.aufirst=Pamela&rft.date=2011-11-01&rft.volume=30&rft.issue=11&rft.spage=2473&rft.isbn=&rft.btitle=&rft.title=Environmental+toxicology+and+chemistry&rft.issn=1552-8618&rft_id=info:doi/10.1002%2Fetc.659 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2012-01-09 N1 - Date created - 2011-10-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1002/etc.659 ER - TY - JOUR T1 - Natural-product-based chromenes as a novel class of potential termiticides. AN - 898206780; 21560225 AB - Among the termite infestations in the United States, the Formosan subterranean termite, Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae), is considered to be the most devastating termite pest. This pest most likely invaded North America as a result of the disembarkation of wooden military cargo at the port of New Orleans that arrived from Asia during and after World War II. It has now spread over other states, including Texas, Florida, South Carolina and California. Devastation caused by C. formosanus in North America has been estimated to cost $ US 1 billion a year. Over the past decades, organochlorines and organophosphates, the two prominent classes of termite control agents, have been banned owing to environmental and human health concerns. At the present time, phenylpyrazoles, pyrethroids, chloronicotinyls and pyrroles are being used as termite control agents. Mammalian toxicity and seeping of these compounds into groundwater are some of the drawbacks associated with these treatments. The instruction for the application of these termiticides indicate ground water advisory. Hence, with the increasing spread of termite infestation there is an increased need to discover effective, environmentally friendly and safe termite control agents with minimal mammalian toxicity. Chromene analogs derived from a natural-product-based chromene amide isolated from Amyris texana were tested in a collaborative discovery program for effective, environmentally friendly termite control agents. Several chromene derivatives were synthesized and characterized as a novel class of potential termiticides, followed by bioassays. These compounds exhibited significantly higher mortalities compared with untreated controls in laboratory bioassays. Chromene derivatives have been shown to be a potential novel class of termiticides against Formosan subterranean termites. Copyright © 2011 Society of Chemical Industry. JF - Pest management science AU - Meepagala, Kumudini M AU - Osbrink, Weste AU - Burandt, Charles AU - Lax, Alan AU - Duke, Stephen O AD - USDA-ARS, Natural Products Utilization Research Unit, University, MS 38677, USA. kmeepaga@olemiss.edu Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 1446 EP - 1450 VL - 67 IS - 11 KW - Benzopyrans KW - 0 KW - Insecticides KW - Index Medicus KW - Animals KW - Insecticides -- toxicity KW - Rutaceae -- chemistry KW - Insecticides -- chemistry KW - Insecticides -- isolation & purification KW - Benzopyrans -- chemistry KW - Benzopyrans -- toxicity KW - Isoptera -- drug effects KW - Benzopyrans -- isolation & purification UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/898206780?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Pest+management+science&rft.atitle=Natural-product-based+chromenes+as+a+novel+class+of+potential+termiticides.&rft.au=Meepagala%2C+Kumudini+M%3BOsbrink%2C+Weste%3BBurandt%2C+Charles%3BLax%2C+Alan%3BDuke%2C+Stephen+O&rft.aulast=Meepagala&rft.aufirst=Kumudini&rft.date=2011-11-01&rft.volume=67&rft.issue=11&rft.spage=1446&rft.isbn=&rft.btitle=&rft.title=Pest+management+science&rft.issn=1526-4998&rft_id=info:doi/10.1002%2Fps.2196 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2012-02-08 N1 - Date created - 2011-10-12 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1002/ps.2196 ER - TY - JOUR T1 - Longevity of multiple species of tephritid (Diptera) fruit fly parasitoids (Hymenoptera: Braconidae: Opiinae) provided exotic and sympatric-fruit based diets. AN - 895852571; 21839085 AB - While adult parasitic Hymenoptera in general feed on floral and extrafloral nectars, hemipteran-honeydews and fluids from punctured hosts, Diachasmimorpha longicaudata (Ashmead), an Old World opiine braconid introduced to tropical/subtropical America for the biological control of Anastrepha spp. (Tephritidae), can survive on fruit juices as they seep from injured fruit. An ability to exploit fruit juice would allow such a parasitoid to efficiently forage for hosts and food sources simultaneously. Two New World opiines, Doryctobracon areolatus (Szepligeti) and Utetes anastrephae (Viereck), are also prominent Anastrepha parasitoids and are roughly sympatric. All three species were provided with: (1) pulp and juice diets derived from a highly domesticated Old World fruit (orange, Citrus sinensis L.) that is only recently sympatric with the Mexican flies and parasitoids and so offered little opportunity for the evolution of feeding-adaptations and (2) a less-domesticated New World fruit (guava, Psidium guajava L.), sympatric over evolutionary time with D. areolatus and U. anastrephae. Both sexes of D. longicaudata died when provided guava pulp or juice at a rate similar to a water-only control. D. areolatus and U. anastrephae, presumably adapted to the nutrient/chemical constituents of guava, also died at a similar rate. Survival of all three species on orange pulp and juice was greater than on water, and often equaled that obtained on a honey and water solution. In confirmatory experiments in Mexico, D. areolatus and U. anastrephae, as well as other tephritid parasitoids Doryctobracon crawfordi (Viereck) and Opius hirtus (Fisher), all died at a significantly higher rates when provided guava in comparison to a honey and water diet. Such a result is likely due to guavas being repellent, innutritious or toxic. D. longicaudata clearly consumed guava juice tagged with a colored dye. Dilutions of orange and guava juice resulted in shorter lifespans than dilutions of orange juice and water demonstrating that there while diluted orange juice provided nutrition the addition of guava created toxicity. Given the differences in fruit-food quality, adult opiine food sources would not be obtainable at all oviposition sites and in the case of guava, more additional sites and foraging for food than previously postulated may be required. Published by Elsevier Ltd. JF - Journal of insect physiology AU - Stuhl, Charles AU - Cicero, Lizette AU - Sivinski, John AU - Teal, Peter AU - Lapointe, Stephen AU - Paranhos, Beatriz Jordão AU - Aluja, Martín AD - Entomology and Nematology Department, University of Florida, Gainesville, FL, USA. charles.stuhl@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 1463 EP - 1470 VL - 57 IS - 11 KW - Mannose KW - PHA4727WTP KW - Index Medicus KW - Psidium KW - Citrus sinensis KW - Animals KW - Mexico KW - Mannose -- toxicity KW - Male KW - Honey KW - Female KW - Tephritidae -- parasitology KW - Wasps -- physiology KW - Fruit KW - Diet KW - Longevity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/895852571?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+insect+physiology&rft.atitle=Longevity+of+multiple+species+of+tephritid+%28Diptera%29+fruit+fly+parasitoids+%28Hymenoptera%3A+Braconidae%3A+Opiinae%29+provided+exotic+and+sympatric-fruit+based+diets.&rft.au=Stuhl%2C+Charles%3BCicero%2C+Lizette%3BSivinski%2C+John%3BTeal%2C+Peter%3BLapointe%2C+Stephen%3BParanhos%2C+Beatriz+Jord%C3%A3o%3BAluja%2C+Mart%C3%ADn&rft.aulast=Stuhl&rft.aufirst=Charles&rft.date=2011-11-01&rft.volume=57&rft.issue=11&rft.spage=1463&rft.isbn=&rft.btitle=&rft.title=Journal+of+insect+physiology&rft.issn=1879-1611&rft_id=info:doi/10.1016%2Fj.jinsphys.2011.07.015 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2011-12-07 N1 - Date created - 2011-09-29 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1016/j.jinsphys.2011.07.015 ER - TY - JOUR T1 - Sediment source identification in a semiarid watershed at soil mapping unit scales AN - 888115489; 15589005 AB - Selective erosion and transport of silt and clay particles from watershed soil surfaces leads to enrichment of suspended sediments by size fractions that are the most effective scavengers of chemical pollutants. Thus, preferential transport of highly reactive size fractions represents a major problem relative to sediment/chemical transport in watersheds, and offsite water quality. The objective of this research was to develop an approach to identify sediment sources at a soil mapping unit scale for the purpose of designing site specific best management practices which affect greater reductions in runoff and erosion losses. Surface soil samples were collected along transects from each of the major 25 mapping units in six subwatersheds of the Walnut Gulch Experimental Watershed. Suspended sediments were collected from supercritical flumes at the mouth of each subwatershed. Laboratory analyses included basic soil/sediment physical and chemical properties, radioisotopes, and stable carbon isotopes, all by standard methods. Aggregation index (AI) values [100 super(. (1 - water dispersible clay / total clay)] were taken as an indicator of relative soil erodibility. Potential sediment yield index (PSYI) values were calculated by multiplying percent relative area for individual soil mapping units times (100 - AI). Particle size results indicated that suspended sediments were enriched in clay, relative to the watershed soils, by an average of 1.28. Clay enrichment ratios (ER) were significantly (P = 0.01) and positively correlated with AI, an indication that these two parameters can be equated with erodibility and sediment yield. The PSYI values for the six subwatersheds ranged from 68.0 to 81.7. The stable carbon isotope data for the suspended sediments gave a C3 (shrubs) to C4 plant (grasses) ratio that ranged from 1.06 to 2.25, indicating greater erosion from the more highly erodible, shrub-dominated subwatersheds which also coincided with the highest PSYI values. Correlation coefficients determined individually for PSYI versus clay ER, C3/C4 plant ratios, and multivariate mixing model results were: 0.962 (P = 0.01), 0.905 (P = 0.01), and 0.816 (P = 0.05), respectively. These statistically significant relationships support the accuracy of a potential sediment yield index approach for identifying suspended sediment sources at soil mapping unit scales.) JF - Catena AU - Rhoton, F E AU - Emmerich, W E AU - Nearing, MA AU - McChesney, D S AU - Ritchie, J C Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 172 EP - 181 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 87 IS - 2 SN - 0341-8162, 0341-8162 KW - Meteorological & Geoastrophysical Abstracts; Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts KW - Enrichment ratios KW - Parent material KW - Stable carbon isotopes KW - Runoff and erosion KW - Suspended sediment KW - Carbon isotopes KW - Pollution dispersion KW - Statistical analysis KW - Correlations KW - Soil erosion KW - Water quality KW - Watersheds KW - Clays KW - Resuspended sediments KW - Carbon KW - Soil erodibility KW - Sediment Yield KW - Sediment yield KW - Soils KW - Sediment transport KW - Mapping KW - Enrichment KW - Sediment Transport KW - Experimental watersheds KW - Sediment chemistry KW - Suspended Sediments KW - Juglans KW - Erosion KW - Sediment sources KW - AQ 00007:Industrial Effluents KW - SW 5080:Evaluation, processing and publication KW - M2 551.5:General (551.5) KW - Q2 09124:Coastal zone management UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/888115489?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Catena&rft.atitle=Sediment+source+identification+in+a+semiarid+watershed+at+soil+mapping+unit+scales&rft.au=Rhoton%2C+F+E%3BEmmerich%2C+W+E%3BNearing%2C+MA%3BMcChesney%2C+D+S%3BRitchie%2C+J+C&rft.aulast=Rhoton&rft.aufirst=F&rft.date=2011-11-01&rft.volume=87&rft.issue=2&rft.spage=172&rft.isbn=&rft.btitle=&rft.title=Catena&rft.issn=03418162&rft_id=info:doi/10.1016%2Fj.catena.2011.05.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-09-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Resuspended sediments; Sediment chemistry; Sediment sources; Pollution dispersion; Carbon isotopes; Soils; Sediment transport; Soil erosion; Watersheds; Experimental watersheds; Erosion; Soil erodibility; Sediment yield; Correlations; Statistical analysis; Runoff and erosion; Water quality; Sediment Transport; Suspended Sediments; Carbon; Sediment Yield; Mapping; Enrichment; Clays; Juglans DO - http://dx.doi.org/10.1016/j.catena.2011.05.002 ER - TY - JOUR T1 - Elevated atmospheric CO2 and drought effects on leaf gas exchange properties of barley AN - 1671564573; 16085723 AB - Atmospheric CO2 concentration (Ca) is rising, predicted to cause global warming, and alter precipitation patterns. During 1994, spring barley (Hordeum vulgareL. cv. Alexis) was grown in a strip-split-plot experimental design to determine the effects that the main plot Ca treatments [A: Ambientat 370 mu mol (CO2) mol-1; E: Enrichedwith free-air CO2 enrichment (FACE) at a arrow right 4550 mu mol (CO2) mol-1] had on several gas exchange properties of fully expanded sunlit primary leaves. The interacting strip-split-plot irrigation treatments were Dryor Wet[50% (D) or 100% (W) replacement of potential evapotranspiration] at ample nitrogen (261kg N ha-1) and phosphorous (29kg P ha-1) fertility. Elevated Ca facilitated drought avoidance by reducing stomatal conductance (gs) by 34% that conserved water and enabled stomata to remain open for a longer period into a drought. This resulted in a 28% reduction in drought-induced midafternoon depression in net assimilation rate (A). Elevated Ca increased Aby 37% under Dryand 23% under Wet. Any reduction in Aunder Wetconditions occurred because of nonstomatal limitations, whereas under Dryit occurred because of stomatal limitations. Elevated Ca increased the diurnal integral of A(A') that resulted in an increase in the seasonal-long integral of A' (A double prime ) for barley leaves by 12% (P=0.14) under both Dryand Wet- 650, 730, 905 and 1020+/-65g (C) m-2y-1 for AD, ED, AW and EW treatments, respectively. Elevated Ca increased season-long average dry weight (DWS; crown, shoots) by 14% (P=0.02), whereas deficit irrigation reduced DWS by 7% (P=0.06), although these values may have been affected by a short but severe pea aphid [Acyrthosiphon pisum (Harris)] infestation. Hence, an elevated-Ca-based improvement in gas exchange properties enhanced growth of a barley crop. JF - Agriculture, Ecosystems & Environment AU - Wall, Gerard W AU - Garcia, Richard L AU - Wechsung, Frank AU - Kimball, Bruce A AD - U.S. Arid-Land Agricultural Research Center, USDA-ARS, 21881 North Cardon Lane, Maricopa, AZ 85238, USA gary.wall@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - November 2011 SP - 390 EP - 404 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 144 IS - 1 SN - 0167-8809, 0167-8809 KW - Environmental Engineering Abstracts (EN); CSA / ASCE Civil Engineering Abstracts (CE) KW - A KW - A max KW - A N KW - A' KW - A double prime KW - AD KW - ANOVA KW - AW KW - df1 KW - df2 KW - C KW - C a KW - C i KW - C i/C a KW - D KW - DAE KW - DWG KW - DWS KW - DWS,B:W KW - DWS,W KW - E KW - ED KW - EW KW - e a KW - e * KW - e a,VPD KW - F KW - FACE KW - g s KW - I KW - IWUE (A/g s) KW - PPFD KW - P alpha KW - S KW - SR KW - SRi KW - T KW - TDR KW - T a KW - T l KW - T a,max KW - T a,min KW - T S KW - T S,max KW - T S,min KW - Delta T KW - u a,avg KW - W KW - WUE (A/E) KW - psi M KW - [thetas] S KW - Carbon dioxide KW - Free-air CO2 enrichment (FACE) KW - Global climate change KW - Growth KW - Net assimilation rate KW - Stomatal conductance KW - Water relations KW - Gas exchange KW - Barley KW - Leaves KW - Atmospherics KW - Enrichment KW - Droughts KW - Elevated UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1671564573?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvironmentalengabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Agriculture%2C+Ecosystems+%26+Environment&rft.atitle=Elevated+atmospheric+CO2+and+drought+effects+on+leaf+gas+exchange+properties+of+barley&rft.au=Wall%2C+Gerard+W%3BGarcia%2C+Richard+L%3BWechsung%2C+Frank%3BKimball%2C+Bruce+A&rft.aulast=Wall&rft.aufirst=Gerard&rft.date=2011-11-01&rft.volume=144&rft.issue=1&rft.spage=390&rft.isbn=&rft.btitle=&rft.title=Agriculture%2C+Ecosystems+%26+Environment&rft.issn=01678809&rft_id=info:doi/10.1016%2Fj.agee.2011.07.006 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Last updated - 2016-05-18 DO - http://dx.doi.org/10.1016/j.agee.2011.07.006 ER - TY - JOUR T1 - Chemical Form of Selenium Affects Its Uptake, Transport, and Glutathione Peroxidase Activity in the Human Intestinal Caco-2 Cell Model AN - 1268654540; 15845685 AB - Determining the effect of selenium (Se) chemical form on uptake, transport, and glutathione peroxidase activity in human intestinal cells is critical to assess Se bioavailability at nutritional doses. In this study, we found that two sources of L-selenomethionine (SeMet) and Se-enriched yeast each increased intracellular Se content more effectively than selenite or methylselenocysteine (SeMSC) in the human intestinal Caco-2 cell model. Interestingly, SeMSC, SeMet, and digested Se-enriched yeast were transported at comparable efficacy from the apical to basolateral sides, each being about 3-fold that of selenite. In addition, these forms of Se, whether before or after traversing from apical side to basolateral side, did not change the potential to support glutathione peroxidase (GPx) activity. Although selenoprotein P has been postulated to be a key Se transport protein, its intracellular expression did not differ when selenite, SeMSC, SeMet, or digested Se-enriched yeast was added to serum-contained media. Taken together, our data show, for the first time, that the chemical form of Se at nutritional doses can affect the absorptive (apical to basolateral side) efficacy and retention of Se by intestinal cells; but that, these effects are not directly correlated to the potential to support GPx activity. JF - Biological Trace Element Research AU - Zeng, Huawei AU - Jackson, Matthew I AU - Cheng, Wen-Hsing AU - Combs, Gerald F AD - US Department of Agriculture, Agricultural Research Service, Grand Forks Human Nutrition Research Center, P.O. Box 9034, Grand Forks, ND, 58203, USA, huawei.zeng@ars.usda.gov huawei.zeng@ars.usda.gov huawei.zeng@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1209 EP - 1218 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 143 IS - 2 SN - 0163-4984, 0163-4984 KW - Toxicology Abstracts KW - Cell culture KW - Data processing KW - Glutathione peroxidase KW - Intestine KW - Media (transport) KW - Protein transport KW - Selenium KW - selenite KW - selenoproteins KW - X 24360:Metals UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1268654540?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biological+Trace+Element+Research&rft.atitle=Chemical+Form+of+Selenium+Affects+Its+Uptake%2C+Transport%2C+and+Glutathione+Peroxidase+Activity+in+the+Human+Intestinal+Caco-2+Cell+Model&rft.au=Zeng%2C+Huawei%3BJackson%2C+Matthew+I%3BCheng%2C+Wen-Hsing%3BCombs%2C+Gerald+F&rft.aulast=Zeng&rft.aufirst=Huawei&rft.date=2011-11-01&rft.volume=143&rft.issue=2&rft.spage=1209&rft.isbn=&rft.btitle=&rft.title=Biological+Trace+Element+Research&rft.issn=01634984&rft_id=info:doi/10.1007%2Fs12011-010-8935-3 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-01-01 N1 - Last updated - 2013-02-08 N1 - SubjectsTermNotLitGenreText - Protein transport; Selenium; Data processing; selenoproteins; Glutathione peroxidase; Media (transport); Intestine; Cell culture; selenite DO - http://dx.doi.org/10.1007/s12011-010-8935-3 ER - TY - JOUR T1 - In Focus: Spotted wing drosophila, Drosophila suzukii, across perspectives AN - 1020853831; 16710125 AB - In August 2008, the first detection of the spotted wing drosophila, Drosophila suzukii, to the North America mainland in California caused great concern, as the fly was found infesting a variety of commercial fruits. Subsequent detections followed in Oregon, Washington, Florida and British Columbia in 2009; in Utah, North Carolina, South Carolina, Michigan, and Louisiana in 2010; and in Virginia, Montana, Wisconsin, Pennsylvania, New Jersey, Maryland and Mexico in 2011. In Europe, it has been detected in Italy and Spain in 2009 and in France in 2010. Economic costs to the grower from D. suzukii include the increased cost of production (increased labor and materials for chemical inputs, monitoring and other management tools) and crop loss. An effective response to the invasion of D. suzukii requires proper taxonomic identification at the initial phase, understanding basic biology and phenology, developing management tools, transferring information and technology quickly to user groups, and evaluating the impact of the research and extension program on an economic, social, and environmental level. As D. suzukii continues to expand its range, steps must be initiated in each new region to educate and inform the public as well as formulate management tactics suitable for the crops and growing conditions in each. JF - Pest Management Science AU - Lee, Jana C AU - Bruck, Denny J AU - Dreves, Amy J AU - Ioriatti, Claudio AU - Vogt, Heidrun AU - Baufeld, Peter AD - USDA-ARS, Horticultural Crops Research Unit, Corvallis, OR, USA, Denny.Bruck@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1349 EP - 1351 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 67 IS - 11 SN - 1526-4998, 1526-4998 KW - Water Resources Abstracts; Aqualine Abstracts KW - Canada, British Columbia KW - Costs KW - AQ 00001:Water Resources and Supplies KW - SW 4020:Evaluation process UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1020853831?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Pest+Management+Science&rft.atitle=In+Focus%3A+Spotted+wing+drosophila%2C+Drosophila+suzukii%2C+across+perspectives&rft.au=Lee%2C+Jana+C%3BBruck%2C+Denny+J%3BDreves%2C+Amy+J%3BIoriatti%2C+Claudio%3BVogt%2C+Heidrun%3BBaufeld%2C+Peter&rft.aulast=Lee&rft.aufirst=Jana&rft.date=2011-11-01&rft.volume=67&rft.issue=11&rft.spage=1349&rft.isbn=&rft.btitle=&rft.title=Pest+Management+Science&rft.issn=15264998&rft_id=info:doi/10.1002%2Fps.2271 L2 - http://onlinelibrary.wiley.com/doi/10.1002/ps.2271/abstract LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-06-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Costs; Canada, British Columbia DO - http://dx.doi.org/10.1002/ps.2271 ER - TY - JOUR T1 - Laboratory and field comparisons of insecticides to reduce infestation of Drosophila suzukii in berry crops AN - 1017973978; 16710129 AB - BACKGROUND: The spotted wing Drosophila, Drosophila suzukii (Matsumura, 1931) (Diptera: Drosophilidae), is an invasive pest of small-fruit crops. Unlike most other Drosophila, this insect is able to oviposit into and damage ripe and ripening fruit, making it unmarketable. Because this is a new pest in the United States, it is necessary to identify registered insecticides to manage this insect effectively in conventional and organic production systems. RESULTS: The present laboratory bioassays and field trials identified a number of insecticides representing various modes of action that are effective in controlling D. suzukii. Products that performed well in the laboratory bioassay also performed well in the field, indicating that screening of new chemistries in the laboratory is a worthy exercise. Field application of pyrethoids, organophosphates or spinosyns provided 5-14 days of residual control of D. suzukii. The efficacy of the neonicotinoids as adulticides was not satisfactory compared with the other contact-mode-of-action chemistries. Based on the zero tolerance by the small-fruit industry and the individual effects mentioned above, neonicotinoids are not currently recommended for D. suzukii management. CONCLUSIONS: There are effective insecticides registered for controlling D. suzukii infestations in susceptible small-fruit crops. JF - Pest Management Science AU - Bruck, Denny J AU - Bolda, Mark AU - Tanigoshi, Lynell AU - Klick, Jimmy AU - Kleiber, Joseph AU - Defrancesco, Joe AU - Gerdeman, Beverly AU - Spitler, Hollis AD - USDA-ARS, Horticultural Crops Research Unit, Corvallis, Oregon, USA, Denny.Bruck@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 1375 EP - 1385 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 67 IS - 11 SN - 1526-4998, 1526-4998 KW - Pollution Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology; Water Resources Abstracts; Entomology Abstracts; Aqualine Abstracts KW - USA KW - Agricultural Chemicals KW - Insecticides KW - Diptera KW - P:9999 KW - Z:05350 KW - SW 3050:Ultimate disposal of wastes KW - A:01380 KW - AQ 00005:Underground Services and Water Use UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1017973978?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Pest+Management+Science&rft.atitle=Laboratory+and+field+comparisons+of+insecticides+to+reduce+infestation+of+Drosophila+suzukii+in+berry+crops&rft.au=Bruck%2C+Denny+J%3BBolda%2C+Mark%3BTanigoshi%2C+Lynell%3BKlick%2C+Jimmy%3BKleiber%2C+Joseph%3BDefrancesco%2C+Joe%3BGerdeman%2C+Beverly%3BSpitler%2C+Hollis&rft.aulast=Bruck&rft.aufirst=Denny&rft.date=2011-11-01&rft.volume=67&rft.issue=11&rft.spage=1375&rft.isbn=&rft.btitle=&rft.title=Pest+Management+Science&rft.issn=15264998&rft_id=info:doi/10.1002%2Fps.2242 L2 - http://onlinelibrary.wiley.com/doi/10.1002/ps.2242/abstract LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-05-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Insecticides; Agricultural Chemicals; Diptera; USA DO - http://dx.doi.org/10.1002/ps.2242 ER - TY - JOUR T1 - Control of common bunt of wheat under field conditions with the biofumigant fungus Muscodor albus AN - 1008840001; 16492225 AB - Field experiments were conducted to evaluate the biological control potential of the fungus Muscodor albus, when applied as a seed treatment or an in furrow soil treatment, for control of common bunt (CB) of wheat caused by Tilletia caries. For seed treatments, dry rye grain culture of M. albus was ground into powder and applied, at a rate of 125 mg/g seed, to wheat seed infested with T. caries teliospores. The culture was also cracked into particles and applied in furrow at the rate of 4 g/m of row, along with teliospore infested seed during planting. Treatments were evaluated during two growing seasons and two planting dates beginning in early spring when soil temperatures were optimal for disease development (5-10 degree C), and then approximately 3 weeks later. In the first year, treatments in the first seeding date reduced CB from 44% diseased spikes in untreated controls to 12% and 9% in seed and in furrow treatments respectively, and from 6% in controls to 0% in both treatments in the second seeding date. In the second year, CB was reduced from 8% in controls to 0.5% and 0.25% for seed and in furrow treatments respectively in the first seeding date, and from 0.75% in controls to 0% in both the treatments in the second seeding date. M. albus may have potential for CB control in organic wheat production where options for managing the disease are very limited. JF - European Journal of Plant Pathology AU - Goates, Blair J AU - Mercier, Julien AD - United States Department of Agriculture, Agricultural Research Service, 1691 S. 2700 W., Aberdeen, ID, 83210, USA, Blair.Goates@ars.usda.gov Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 403 EP - 407 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 131 IS - 3 SN - 0929-1873, 0929-1873 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Biological control KW - Seeds KW - Tilletia caries KW - A 01360:Plant Diseases KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1008840001?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=European+Journal+of+Plant+Pathology&rft.atitle=Control+of+common+bunt+of+wheat+under+field+conditions+with+the+biofumigant+fungus+Muscodor+albus&rft.au=Goates%2C+Blair+J%3BMercier%2C+Julien&rft.aulast=Goates&rft.aufirst=Blair&rft.date=2011-11-01&rft.volume=131&rft.issue=3&rft.spage=403&rft.isbn=&rft.btitle=&rft.title=European+Journal+of+Plant+Pathology&rft.issn=09291873&rft_id=info:doi/10.1007%2Fs10658-011-9817-z LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Last updated - 2014-02-11 N1 - SubjectsTermNotLitGenreText - Seeds; Tilletia caries DO - http://dx.doi.org/10.1007/s10658-011-9817-z ER - TY - JOUR T1 - Ethanol vapor and saprophytic yeast treatments reduce decay and maintain quality of intact and fresh-cut sweet cherries AN - 1008825474; 15706196 AB - The objective of this study was to evaluate the use of an ethanol vapor release pad and a saprophytic yeast Cryptococcus infirmo-miniatum (CIM) to reduce decay and maintain postharvest quality of intact or fresh-cut sweet cherries (Prunus avium) cv. Lapins and Bing. Intact or fresh-cut fruit were packed in perforated clamshells (capacity 454 g) and stored at 1, 10 or 20 degree C for up to 21, 14 and 8 d, respectively. For ethanol treatment, a pad made with silica gel powder containing 10 g ethanol and covered with perforated film, which allows ethanol vapor to diffuse gradually, was attached to the upper lid of the clamshells. Ethanol treatment caused accumulation of ethanol in the packaging headspace, about 10 mu L L super(-1) with little change within 14 d at 1 degree C, 23 mu L L super(-1) at d 1 and decreased to 15 mu L L super(-1) at d 10 at 10 degree C, and 26 mu L L super(-1) at d 1 and decreased to 13 mu L L super(-1) at d 3 at 20 degree C. Ethanol content in fruit was less than 9 mg kg super(-1) in all the control fruit, and increased to 16, 34 and 43 mg kg super(-1) in ethanol-treated fruit at 1, 10 and 20 degree C, respectively. Nonetheless, a sensory taste panel did not perceive any flavor difference from the ethanol treatment. The ethanol treatment retarded softening, darkening, and acid decrease in fruit as well as discoloration of the stems, and extended shelf-life of intact cherries. Ethanol reduced brown rot (Monilinia fructicola) in fresh-cut cherries stored at 20 degree C, but not at 1 and 10 degree C. A pre-packaging dip in CIM completely controlled brown rot in inoculated fresh-cut cherries stored at 1 degree C, and in naturally infected cherries at 20 degree C. JF - Postharvest Biology and Technology AU - Bai, Jinhe AU - Plotto, Anne AU - Spotts, Robert AU - Rattanapanone, Nithiya Y1 - 2011/11// PY - 2011 DA - Nov 2011 SP - 204 EP - 212 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 62 IS - 2 SN - 0925-5214, 0925-5214 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology; Chemoreception Abstracts KW - Brown rot KW - Ethanol KW - Flavor KW - Fruits KW - Headspace KW - Powder KW - Sensory evaluation KW - Shelf life KW - Stems KW - Sweet taste KW - Taste KW - Vapors KW - silica gel KW - Monilinia fructicola KW - Prunus avium KW - Cryptococcus KW - R 18065:Food science KW - A 01330:Food Microbiology KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1008825474?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Postharvest+Biology+and+Technology&rft.atitle=Ethanol+vapor+and+saprophytic+yeast+treatments+reduce+decay+and+maintain+quality+of+intact+and+fresh-cut+sweet+cherries&rft.au=Bai%2C+Jinhe%3BPlotto%2C+Anne%3BSpotts%2C+Robert%3BRattanapanone%2C+Nithiya&rft.aulast=Bai&rft.aufirst=Jinhe&rft.date=2011-11-01&rft.volume=62&rft.issue=2&rft.spage=204&rft.isbn=&rft.btitle=&rft.title=Postharvest+Biology+and+Technology&rft.issn=09255214&rft_id=info:doi/10.1016%2Fj.postharvbio.2011.05.010 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Last updated - 2012-08-10 N1 - SubjectsTermNotLitGenreText - Fruits; Powder; Sweet taste; Flavor; Sensory evaluation; silica gel; Stems; Taste; Shelf life; Vapors; Brown rot; Headspace; Ethanol; Monilinia fructicola; Prunus avium; Cryptococcus DO - http://dx.doi.org/10.1016/j.postharvbio.2011.05.010 ER - TY - JOUR T1 - Relative effects of precipitation variability and warming on tallgrass prairie ecosystem function AN - 1020856227; 16790072 AB - Precipitation and temperature drive many aspects of terrestrial ecosystem function. Climate change scenarios predict increasing precipitation variability and temperature, and long term experiments are required to evaluate the ecosystem consequences of interannual climate variation, increased growing season (intra-annual) rainfall variability, and warming. We present results from an experiment applying increased growing season rainfall variability and year round warming in native tallgrass prairie. During ten years of study, total growing season rainfall varied 2-fold, and we found ~50-200% interannual variability in plant growth and aboveground net primary productivity (ANPP), leaf carbon assimilation (A sub(CO2)), and soil CO sub(2) efflux (J sub(CO2)) despite only ~40% variation in mean volumetric soil water content (0-15 cm, Theta sub(15)). Interannual variation in soil moisture was thus amplified in most measures of ecosystem response. Differences between years in Theta sub(15) explained the greatest portion (14-52%) of the variation in these processes. Experimentally increased intra-annual season rainfall variability doubled the amplitude of intra-annual soil moisture variation and reduced Theta sub(15) by 15%, causing most ecosystem processes to decrease 8-40% in some or all years with increased rainfall variability compared to ambient rainfall timing, suggesting reduced ecosystem rainfall use efficiency. Warming treatments increased soil temperature at 5 cm depth, particularly during spring, fall, and winter. Warming advanced canopy green up in spring, increased winter J sub(CO2), and reduced summer J sub(CO2) and forb ANPP, suggesting that the effects of warming differed in cooler versus warmer parts of the year. We conclude that (1) major ecosystem processes in this grassland may be substantially altered by predicted changes in interannual climate variability, intra-annual rainfall variability, and temperature, (2) interannual climate variation was a larger source of variation in ecosystem function than intra-annual rainfall variability and warming, and (3) effects of increased growing season rainfall variability and warming were small, but ecologically important. The relative effects of these climate drivers are likely to vary for different ecosystem processes and in wetter or drier ecosystems. JF - Biogeosciences AU - Fay, P A AU - Blair, J M AU - Smith, MD AU - Nippert, J B AU - Carlisle, J D AU - Knapp, A K AD - USDA ARS Grassland Soil and Water Research Laboratory, 808 E Blackland Rd., Temple, Texas 76502, USA Y1 - 2011/10/31/ PY - 2011 DA - 2011 Oct 31 SP - 3053 EP - 3068 PB - European Geosciences Union, c/o E.O.S.T. Strasbourg Cedex 67084 France VL - 8 IS - 10 SN - 1726-4170, 1726-4170 KW - Ecology Abstracts; Sustainability Science Abstracts; Meteorological & Geoastrophysical Abstracts KW - Forbs KW - Rainfall KW - Climatic changes KW - Soil temperature KW - Winter KW - Soil KW - Prairies KW - Carbon KW - Climatic variability KW - Climatic variations KW - Seasonal variability KW - Temperature effects KW - Rainfall variability KW - Growing season KW - prairies KW - Climate KW - Temperature KW - Leaves KW - Temperature requirements KW - Precipitation KW - Water content KW - Grasslands KW - Interannual variability KW - Terrestrial ecosystems KW - Precipitation variability KW - Plant growth KW - Carbon dioxide KW - Soil moisture KW - M3 1010:Issues in Sustainable Development KW - D 04040:Ecosystem and Ecology Studies KW - M2 556.14:Infiltration/Soil Moisture (556.14) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1020856227?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biogeosciences&rft.atitle=Relative+effects+of+precipitation+variability+and+warming+on+tallgrass+prairie+ecosystem+function&rft.au=Fay%2C+P+A%3BBlair%2C+J+M%3BSmith%2C+MD%3BNippert%2C+J+B%3BCarlisle%2C+J+D%3BKnapp%2C+A+K&rft.aulast=Fay&rft.aufirst=P&rft.date=2011-10-31&rft.volume=8&rft.issue=10&rft.spage=3053&rft.isbn=&rft.btitle=&rft.title=Biogeosciences&rft.issn=17264170&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-06-01 N1 - Last updated - 2013-07-26 N1 - SubjectsTermNotLitGenreText - Temperature effects; Rainfall; Forbs; Climate; Climatic changes; Temperature requirements; Leaves; Soil temperature; Precipitation; Water content; Prairies; Grasslands; Carbon; Terrestrial ecosystems; Soil moisture; Carbon dioxide; Rainfall variability; Interannual variability; Growing season; Climatic variability; Climatic variations; Precipitation variability; Seasonal variability; Soil; prairies; Temperature; Plant growth; Winter ER - TY - CPAPER T1 - Fast food restaurants and their relationship to body weight: A review of the evidence T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1313018455; 6051494 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Spahn, Joanne AU - Essery, Eve AU - Obbagy, Julie AU - Altman, Jean AU - Nelson, Miriam Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Reviews KW - body weight KW - Food KW - Body weight UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313018455?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Fast+food+restaurants+and+their+relationship+to+body+weight%3A+A+review+of+the+evidence&rft.au=Spahn%2C+Joanne%3BEssery%2C+Eve%3BObbagy%2C+Julie%3BAltman%2C+Jean%3BNelson%2C+Miriam&rft.aulast=Spahn&rft.aufirst=Joanne&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Hold the Salt Please: America's Challenge T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1313012831; 6048353 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Hoy, M Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Salts UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313012831?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Hold+the+Salt+Please%3A+America%27s+Challenge&rft.au=Hoy%2C+M&rft.aulast=Hoy&rft.aufirst=M&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Beverages By The Numbers: What We Drink and How Much T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1313012786; 6048352 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Sebastian, Rhonda Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Beverages UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313012786?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Beverages+By+The+Numbers%3A+What+We+Drink+and+How+Much&rft.au=Sebastian%2C+Rhonda&rft.aulast=Sebastian&rft.aufirst=Rhonda&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Meals or Snacks...Which Is It? T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1313012730; 6048351 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Rhodes, Donna Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Public health KW - Nutrition KW - Sports KW - Fitness UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313012730?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Meals+or+Snacks...Which+Is+It%3F&rft.au=Rhodes%2C+Donna&rft.aulast=Rhodes&rft.aufirst=Donna&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Diet quality of children 2-17 years, as measured by the Healthy Eating Index-2005, differs by age, gender, race/ethnicity, and family income T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1313000057; 6050114 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - O'Connell, Kellie AU - Guenther, Patricia AU - Hiza, Hazel AU - Davis, Carole Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Sex KW - Diets KW - Children KW - Ethnic groups KW - income KW - Age KW - Races KW - Subpopulations UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313000057?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Diet+quality+of+children+2-17+years%2C+as+measured+by+the+Healthy+Eating+Index-2005%2C+differs+by+age%2C+gender%2C+race%2Fethnicity%2C+and+family+income&rft.au=O%27Connell%2C+Kellie%3BGuenther%2C+Patricia%3BHiza%2C+Hazel%3BDavis%2C+Carole&rft.aulast=O%27Connell&rft.aufirst=Kellie&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - How Nutrition Arises as a Focus for USDA Research, Economics, and Education T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1312968717; 6050705 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Woteki, Cathie Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Economics KW - Nutrition KW - Education UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312968717?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=How+Nutrition+Arises+as+a+Focus+for+USDA+Research%2C+Economics%2C+and+Education&rft.au=Woteki%2C+Cathie&rft.aulast=Woteki&rft.aufirst=Cathie&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Embracing new technologies and digital/social media for delivering nutrition education: Evidence analysis, market research, environmental scans, and ethnographic surveys T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1312967318; 6051733 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Spahn, Joanne AU - Blum-Kemelor, Donna AU - Obbagy, Julie AU - Olson, Sara AU - Samuels, Sarah AU - Yoshida, Sallie AU - Boyle, Maria AU - Shen, Ted Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Nutrition KW - Education KW - Technology KW - Market research UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312967318?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Embracing+new+technologies+and+digital%2Fsocial+media+for+delivering+nutrition+education%3A+Evidence+analysis%2C+market+research%2C+environmental+scans%2C+and+ethnographic+surveys&rft.au=Spahn%2C+Joanne%3BBlum-Kemelor%2C+Donna%3BObbagy%2C+Julie%3BOlson%2C+Sara%3BSamuels%2C+Sarah%3BYoshida%2C+Sallie%3BBoyle%2C+Maria%3BShen%2C+Ted&rft.aulast=Spahn&rft.aufirst=Joanne&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Prevention in action: Calorie balance and public health T2 - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AN - 1312926915; 6050604 JF - 139th American Public Health Association Annual Meeting and Exposition (APHA 2011) AU - Spahn, Joanne Y1 - 2011/10/29/ PY - 2011 DA - 2011 Oct 29 KW - Public health KW - prevention KW - Calories UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312926915?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.atitle=Prevention+in+action%3A+Calorie+balance+and+public+health&rft.au=Spahn%2C+Joanne&rft.aulast=Spahn&rft.aufirst=Joanne&rft.date=2011-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=139th+American+Public+Health+Association+Annual+Meeting+and+Exposition+%28APHA+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://apha.confex.com/apha/139am/webprogram/meeting.html LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - JOUR T1 - The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus AN - 918047102; 15935736 AB - Although it is known that oxalic acid provides a selective advantage to the secreting microbe our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal bacterial pathogen, Burkholderia mallei. The discovered gene was named oxalate biosynthetic component (obc)1. Complementation of Burkholderia oxalate defective (Bod)1, a Burkholderia glumae mutant that lacks expression of a functional oxalic acid biosynthetic operon, revealed that the obc1 was able to rescue the no oxalate mutant phenotype. This single gene rescue is in contrast to the situation found in B. glumae which required the expression of two genes, obcA and obcB, to achieve complementation. Enzyme assays showed that even though the two Burkholderia species differed in the number of genes required to encode a functional enzyme, both catalyzed the same acyl-CoA dependent biosynthetic reaction. In addition, mutagenesis studies suggested a similar domain structure of the assembled oxalate biosynthetic enzymes whether encoded by one or two genes. JF - Microbiological Research AU - Nakata, Paul A AD - USDA/ARS Children's Nutrition Research Center, Department of Pediatrics, Baylor College of Medicine, 1100 Bates St., Houston, TX 77030-2600, United States, pnakata@bcm.edu Y1 - 2011/10/20/ PY - 2011 DA - 2011 Oct 20 SP - 531 EP - 538 PB - Elsevier B.V., P.O. Box 100537 Jena D-07705 Germany VL - 166 IS - 7 SN - 0944-5013, 0944-5013 KW - Microbiology Abstracts B: Bacteriology KW - Complementation KW - Burkholderia glumae KW - Burkholderia mallei KW - Enzymes KW - Pathogens KW - Burkholderia KW - Operons KW - Oxalic acid KW - Mutagenesis KW - J 02310:Genetics & Taxonomy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/918047102?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Microbiological+Research&rft.atitle=The+oxalic+acid+biosynthetic+activity+of+Burkholderia+mallei+is+encoded+by+a+single+locus&rft.au=Nakata%2C+Paul+A&rft.aulast=Nakata&rft.aufirst=Paul&rft.date=2011-10-20&rft.volume=166&rft.issue=7&rft.spage=531&rft.isbn=&rft.btitle=&rft.title=Microbiological+Research&rft.issn=09445013&rft_id=info:doi/10.1016%2Fj.micres.2010.11.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Last updated - 2012-03-29 N1 - SubjectsTermNotLitGenreText - Complementation; Enzymes; Pathogens; Operons; Oxalic acid; Mutagenesis; Burkholderia mallei; Burkholderia glumae; Burkholderia DO - http://dx.doi.org/10.1016/j.micres.2010.11.002 ER - TY - JOUR T1 - Development and efficacy of novobiocin and rifampicin-resistant Aeromonas hydrophila as novel vaccines in channel catfish and Nile tilapia AN - 902379781; 15910250 AB - Three attenuated Aeromonas hydrophila vaccines were developed from the virulent 2009 West Alabama isolates through selection for resistance to both novobiocin and rifampicin. When channel catfish (Ictalurus punctatus) were IP injected with 4 x 105 colony-forming unit (CFU) of the mutants, no fish died. However, when the same age and size matched channel catfish were IP injected with similar amount of their virulent parents, 80-100% fish died. Similarly, when Nile tilapia (Oreochromis niloticus) were IP injected with 2 x 108 CFU of the mutants, no fish died. However, when Nile tilapia were IP injected with similar amount of the mutants, all fish died. Vaccination of channel catfish with the mutants at dose of 4 x 105 CFU/fish offered 86-100% protection against their virulent parents at 14 days post vaccination (dpv). Vaccination of Nile tilapia with the mutants at dose of 2 x 108 CFU/fish offered 100% protection against their virulent parents at 14, 28, and 56 dpv. Agglutination assay results suggested that protection elicited by the mutants was partially due to antibody-mediated immunity. Taken together, our results suggest that the three attenuated vaccines might be used to protect channel catfish and Nile tilapia against the highly virulent 2009 West Alabama isolates of A. hydrophila. JF - Vaccine AU - Pridgeon, Julia W AU - Klesius, Phillip H AD - Aquatic Animal Health Research Unit, USDA-ARS, 990 Wire Road, Auburn, AL 36832, USA, Julia.Pridgeon@ars.usda.gov Y1 - 2011/10/19/ PY - 2011 DA - 2011 Oct 19 SP - 7896 EP - 7904 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 29 IS - 45 SN - 0264-410X, 0264-410X KW - ASFA 1: Biological Sciences & Living Resources; Microbiology Abstracts B: Bacteriology; Immunology Abstracts KW - Novobiocin KW - Disease control KW - Brackish KW - Aeromonas hydrophila KW - Immunity KW - Freshwater KW - Freshwater fish KW - Vaccination KW - Ictalurus punctatus KW - USA, Alabama KW - Rifampin KW - Agglutination KW - Colony-forming cells KW - Vaccines KW - Brackishwater fish KW - Oreochromis niloticus KW - Q1 08463:Habitat community studies KW - J 02350:Immunology KW - F 06940:Fish Immunity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902379781?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Vaccine&rft.atitle=Development+and+efficacy+of+novobiocin+and+rifampicin-resistant+Aeromonas+hydrophila+as+novel+vaccines+in+channel+catfish+and+Nile+tilapia&rft.au=Pridgeon%2C+Julia+W%3BKlesius%2C+Phillip+H&rft.aulast=Pridgeon&rft.aufirst=Julia&rft.date=2011-10-19&rft.volume=29&rft.issue=45&rft.spage=7896&rft.isbn=&rft.btitle=&rft.title=Vaccine&rft.issn=0264410X&rft_id=info:doi/10.1016%2Fj.vaccine.2011.08.082 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Disease control; Immunity; Vaccines; Freshwater fish; Brackishwater fish; Vaccination; Rifampin; Agglutination; Colony-forming cells; Novobiocin; Aeromonas hydrophila; Ictalurus punctatus; Oreochromis niloticus; USA, Alabama; Brackish; Freshwater DO - http://dx.doi.org/10.1016/j.vaccine.2011.08.082 ER - TY - CPAPER T1 - High Solid Loading Hydrolyzate-Tolerant Strains of Scheffersomyces (Pichia) Stipitis Exhibiting Reduced Diauxic Lag and Higher Ethanol Productivity T2 - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AN - 1313020101; 6079045 JF - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AU - Slininger, Patricia AU - Balan, Venkatesh AU - da costa Sousa, Leonardo AU - Dale, Bruce AU - Cotta, Michael Y1 - 2011/10/16/ PY - 2011 DA - 2011 Oct 16 KW - Ethanol KW - Strains KW - Pichia stipitis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313020101?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.atitle=High+Solid+Loading+Hydrolyzate-Tolerant+Strains+of+Scheffersomyces+%28Pichia%29+Stipitis+Exhibiting+Reduced+Diauxic+Lag+and+Higher+Ethanol+Productivity&rft.au=Slininger%2C+Patricia%3BBalan%2C+Venkatesh%3Bda+costa+Sousa%2C+Leonardo%3BDale%2C+Bruce%3BCotta%2C+Michael&rft.aulast=Slininger&rft.aufirst=Patricia&rft.date=2011-10-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.aiche.org/conferences/annualmeeting/meetingprogram/2011topical.aspx LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Aging of Biomass Fast Pyrolysis-Oil and Process Strategies to Produce Stable Pyrolysis Oils T2 - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AN - 1313017511; 6079326 JF - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AU - Mullen, Charles AU - Boateng, Akwasi AU - Mihalcik, David Y1 - 2011/10/16/ PY - 2011 DA - 2011 Oct 16 KW - Oil KW - Biomass KW - Aging KW - Pyrolysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313017511?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.atitle=Aging+of+Biomass+Fast+Pyrolysis-Oil+and+Process+Strategies+to+Produce+Stable+Pyrolysis+Oils&rft.au=Mullen%2C+Charles%3BBoateng%2C+Akwasi%3BMihalcik%2C+David&rft.aulast=Mullen&rft.aufirst=Charles&rft.date=2011-10-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.aiche.org/conferences/annualmeeting/meetingprogram/2011topical.aspx LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The Role of Cellulose Accessibility On Enzymatic Saccharification of Lignocelluloses T2 - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AN - 1312986591; 6079330 JF - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AU - Zhu, Junyong AU - Zhu, Zhiguang AU - Zhang, Y.-H. AU - Ni, Yonghao AU - He, ZiBin AU - Xiaolin, Luo Y1 - 2011/10/16/ PY - 2011 DA - 2011 Oct 16 KW - Cellulose KW - lignocellulose UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312986591?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.atitle=The+Role+of+Cellulose+Accessibility+On+Enzymatic+Saccharification+of+Lignocelluloses&rft.au=Zhu%2C+Junyong%3BZhu%2C+Zhiguang%3BZhang%2C+Y.-H.%3BNi%2C+Yonghao%3BHe%2C+ZiBin%3BXiaolin%2C+Luo&rft.aulast=Zhu&rft.aufirst=Junyong&rft.date=2011-10-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.aiche.org/conferences/annualmeeting/meetingprogram/2011topical.aspx LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Catalytic Cracking of Oak Pyrolytic Vapors Via Bench-Scale In-Situ Fixed-Bed Catalysis T2 - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AN - 1312935331; 6079033 JF - 2011 Annual Meeting of the American Institute for Chemical Engineering (AIChE 2011) AU - Mihalcik, David AU - Boateng, Akwasi AU - Mullen, Charles AU - Goldberg, Neil Y1 - 2011/10/16/ PY - 2011 DA - 2011 Oct 16 KW - Catalysis KW - Vapors UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312935331?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.atitle=Catalytic+Cracking+of+Oak+Pyrolytic+Vapors+Via+Bench-Scale+In-Situ+Fixed-Bed+Catalysis&rft.au=Mihalcik%2C+David%3BBoateng%2C+Akwasi%3BMullen%2C+Charles%3BGoldberg%2C+Neil&rft.aulast=Mihalcik&rft.aufirst=David&rft.date=2011-10-16&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Institute+for+Chemical+Engineering+%28AIChE+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.aiche.org/conferences/annualmeeting/meetingprogram/2011topical.aspx LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - JOUR T1 - Trend and uncertainty analysis of simulated climate change impacts with multiple GCMs and emission scenarios AN - 899160793; 15552686 AB - Trends and uncertainty of the climate change impacts on hydrology, soil erosion, and wheat production during 2010-2039 at El Reno in central Oklahoma, USA, were evaluated for 12 climate change scenarios projected by four GCMs (CCSR/NIES, CGCM2, CSIRO-Mk2, and HadCM3) under three emissions scenarios (A2, B2, and GGa). Compared with the present climate, overall t-tests (n=12) show that it is almost certain that mean precipitation will decline by some 6% (>98.5% probability), daily precipitation variance increase by 12% (>99%), and maximum and minimum temperature increase by 1.46 and 1.26 degree C (>99%), respectively. Compared with the present climate under the same tillage systems, it is very likely (>90%) that evapotranpiration and long-term soil water storage will decease, but runoff and soil loss will increase despite the projected declines in precipitation. There will be no significant changes in wheat grain yield. Paired t-tests show that daily precipitation variance projected under GGa is greater than those under A2 and B2 (P=0.1), resulting in greater runoff and soil loss under GGa (P=0.1). HadCM3 projected greater mean annual precipitation than CGCM2 and CSIRO (P=0.1). Consequently, greater runoff, grain yield, transpiration, soil evaporation, and soil water storage were simulated for HadCM3 (P=0.1). The inconsistency among GCMs and differential impact responses between emission scenarios underscore the necessity of using multi-GCMs and multi-emission scenarios for impact assessments. Overall results show that no-till and conservation tillage systems will need to be adopted for better soil and water conservation and environmental protection in the region during the next several decades. JF - Agricultural and Forest Meteorology AU - Zhang, X-C AU - Liu, W-Z AU - Li, Z AU - Chen, J Y1 - 2011/10/15/ PY - 2011 DA - 2011 Oct 15 SP - 1297 EP - 1304 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 151 IS - 10 SN - 0168-1923, 0168-1923 KW - Water Resources Abstracts; Environment Abstracts; Sustainability Science Abstracts; Meteorological & Geoastrophysical Abstracts KW - Climate change KW - Impact assessment KW - Soil erosion KW - Soil hydrology KW - Wheat production KW - Rainfall KW - Water conservation KW - Soil Water KW - USA, Oklahoma KW - Soil KW - Triticum aestivum KW - Yield KW - Emissions KW - Hydrology KW - Daily precipitation KW - Rainfall runoff KW - Mean precipitation KW - Climates KW - Temperature KW - Precipitation KW - Storage KW - General circulation models KW - Conservation KW - tillage KW - Wheat KW - Soil loss KW - Soil moisture KW - Runoff KW - ENA 06:Food & Drugs KW - SW 0810:General KW - M3 1010:Issues in Sustainable Development KW - M2 556.16:Runoff (556.16) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/899160793?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Agricultural+and+Forest+Meteorology&rft.atitle=Trend+and+uncertainty+analysis+of+simulated+climate+change+impacts+with+multiple+GCMs+and+emission+scenarios&rft.au=Zhang%2C+X-C%3BLiu%2C+W-Z%3BLi%2C+Z%3BChen%2C+J&rft.aulast=Zhang&rft.aufirst=X-C&rft.date=2011-10-15&rft.volume=151&rft.issue=10&rft.spage=1297&rft.isbn=&rft.btitle=&rft.title=Agricultural+and+Forest+Meteorology&rft.issn=01681923&rft_id=info:doi/10.1016%2Fj.agrformet.2011.05.010 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2016-09-29 N1 - SubjectsTermNotLitGenreText - Mean precipitation; Rainfall runoff; Water conservation; General circulation models; Climate change; Precipitation; Daily precipitation; Soil moisture; Soil loss; Storage; Soil; Rainfall; Temperature; Emissions; Conservation; Hydrology; tillage; Yield; Climates; Soil Water; Wheat; Runoff; Triticum aestivum; USA, Oklahoma DO - http://dx.doi.org/10.1016/j.agrformet.2011.05.010 ER - TY - JOUR T1 - Sensitivity of the snowcover energetics in a mountain basin to variations in climate AN - 1017967305; 16698595 AB - Snow is an important natural reservoir that holds water on the landscape for release later in the season in western North America and other portions of the world. As air temperature increases with global climate change, the character of the generally established seasonal snowcover will be affected. To study the specific response to variable climate, a carefully collected and processed meteorological data set for the 1984-2008 water years (WYs) was assembled for a snow-dominated headwater mountain catchment. The data were used to force a physically based, distributed energy balance snow model to simulate patterns of snow deposition and melt over the catchment for the 25-year period. This period covers both the highest (1984) and lowest (1992) snow seasons on record and exhibits extreme inter-annual variability. This unique forcing data set captured meteorological conditions that resulted in the range of variability in snowcover accumulation, timing of ablation, and the timing and amount of surface water input (SWI), and discharge during the 25-year study period. SWI is the amount of liquid water delivered to the soil surface from melting snow or from rain that passes through the snowcover or falls directly on the soil. Warm winters, characterized by early- and mid-winter rain, triggered earlier inputs from SWI and response in discharge than cool winters. Cool conditions prolonged the generation of SWI and streamflow out of the basin. Very wet conditions that were warm passed 50% of the SWI 27 days earlier and passed 50% of the discharge 15 days earlier, when compared to very wet conditions that were cool. Warmer conditions produced less snow water equivalent, shortened the melt season, and would be expected to extend the summer drought. JF - Hydrological Processes AU - Reba, Michele L AU - Marks, Danny AU - Winstral, Adam AU - Link, Timothy E AU - Kumar, Mukesh AD - Agricultural Research Service, Northwest Watershed Research Center, Boise, ID 83712, USA, michele.reba@ars.usda.gov Y1 - 2011/10/15/ PY - 2011 DA - 2011 Oct 15 SP - 3312 EP - 3321 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 25 IS - 21 SN - 1099-1085, 1099-1085 KW - Sustainability Science Abstracts; Environment Abstracts; Meteorological & Geoastrophysical Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Aqualine Abstracts; Water Resources Abstracts KW - Catchment area KW - Variability KW - Surface water KW - Climate change KW - Basins KW - Freshwater KW - Air temperature KW - Winter KW - Soil KW - Mountains KW - Catchment basins KW - Meteorology KW - Seasonal variability KW - Reservoirs KW - Ablation KW - Topography KW - Timing KW - Temperature effects KW - North America KW - Hydrologic analysis KW - Snow KW - Climates KW - Catchment Areas KW - River discharge KW - Snow cover KW - Soil Surfaces KW - Stream flow KW - Interannual variability KW - Warm winters KW - Energy balance KW - Ice melting KW - Catchments KW - Rain KW - Accumulation KW - ENA 03:Energy KW - AQ 00001:Water Resources and Supplies KW - M2 551.583:Variations (551.583) KW - M3 1010:Issues in Sustainable Development KW - SW 0835:Streamflow and runoff KW - Q2 09171:Dynamics of lakes and rivers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1017967305?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Hydrological+Processes&rft.atitle=Sensitivity+of+the+snowcover+energetics+in+a+mountain+basin+to+variations+in+climate&rft.au=Reba%2C+Michele+L%3BMarks%2C+Danny%3BWinstral%2C+Adam%3BLink%2C+Timothy+E%3BKumar%2C+Mukesh&rft.aulast=Reba&rft.aufirst=Michele&rft.date=2011-10-15&rft.volume=25&rft.issue=21&rft.spage=3312&rft.isbn=&rft.btitle=&rft.title=Hydrological+Processes&rft.issn=10991085&rft_id=info:doi/10.1002%2Fhyp.8155 L2 - http://onlinelibrary.wiley.com/doi/10.1002/hyp.8155/abstract LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-05-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Temperature effects; Catchment area; Energy balance; Ice melting; Snow; River discharge; Air temperature; Ablation; Stream flow; Interannual variability; Hydrologic analysis; Warm winters; Catchment basins; Climate change; Seasonal variability; Snow cover; Topography; Mountains; Soil; Surface water; Catchments; Basins; Meteorology; Reservoirs; Winter; Timing; Variability; Catchment Areas; Climates; Rain; Accumulation; Soil Surfaces; North America; Freshwater DO - http://dx.doi.org/10.1002/hyp.8155 ER - TY - JOUR T1 - Fiber digestion, VFA production, and microbial population changes during in vitro ruminal fermentations of mixed rations by monensin-adapted and unadapted microbes AN - 904491684; 15706283 AB - Mixed ruminal microbes were incubated for 24 h in vitro with mixed forage and concentrate rations under conditions that differed in starch level (200 or 300 g/kg dry matter (DM)), initial pH (6.3 or 6.7) and corn oil (0 or 10 g/kg DM), in order to determine effects on fermentation (fiber digestibility, volatile fatty acid (VFA) production) and relative population sizes (RPS) of various bacterial taxa (expressed as a percentage of 16S ribosomal RNA gene copies determined by quantitative polymerase chain reaction (qPCR)). Within the range of in vitro conditions tested, monensin-adapted inocula incubated in the presence of monensin did not differ in in vitro fiber digestibility relative to inocula from the same cows prior to adaptation and incubated in the absence of monensin. Although total VFA production did not differ among in vitro treatments, a shift from acetate toward propionate production was generally observed at the higher starch level, lower pH, and presence of corn oil. Surprisingly, monensin cultures displayed slightly decreased proportions of propionate and increased proportions of butyrate and valerate. After 24 h in vitro incubations containing 300 g starch/kg DM and in the absence of monensin, the RPS of 13 of the 16 taxa examined differed (P0.01) from that of the inoculum. In vitro incubation increased the RPS of the Ruminococcus albus, Selenomonas ruminantium, Succinivibrio dextrinisolvens, and Megasphaera elsdenii, and decreased the RPS of the genus Prevotella, and the species P. brevis, P. bryantii, P. ruminicola, Butyrivibrio fibrisolvens, Eubacterium ruminantium, Fibrobacter succinogenes, Ruminococcus flavefaciens, and Streptococcus bovis. The RPS of Ruminobacter amylophilus, the genus Ruminococcus and the Domain Archaea did not change after 24 h in vitro incubation. Shifts in RPS during in vitro incubation were remarkably independent of initial pH or corn oil. The data indicate that in vitro conditions can substantially change the quantitative distribution of ruminal bacterial populations, and that these changes are both inherent in the in vitro method, and distinct from specific differences in divergent in vitro environmental conditions. JF - Animal Feed Science and Technology AU - Weimer, P J AU - Stevenson, D M AU - Mertens AU - Hall, M B Y1 - 2011/10/13/ PY - 2011 DA - 2011 Oct 13 SP - 68 EP - 78 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 169 IS - 1-2 SN - 0377-8401, 0377-8401 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Biotechnology and Bioengineering Abstracts KW - Acetic acid KW - Archaea KW - monensin KW - A:01310 KW - W 30935:Food Biotechnology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/904491684?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Animal+Feed+Science+and+Technology&rft.atitle=Fiber+digestion%2C+VFA+production%2C+and+microbial+population+changes+during+in+vitro+ruminal+fermentations+of+mixed+rations+by+monensin-adapted+and+unadapted+microbes&rft.au=Weimer%2C+P+J%3BStevenson%2C+D+M%3BMertens%3BHall%2C+M+B&rft.aulast=Weimer&rft.aufirst=P&rft.date=2011-10-13&rft.volume=169&rft.issue=1-2&rft.spage=68&rft.isbn=&rft.btitle=&rft.title=Animal+Feed+Science+and+Technology&rft.issn=03778401&rft_id=info:doi/10.1016%2Fj.anifeedsci.2011.06.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - monensin; Archaea DO - http://dx.doi.org/10.1016/j.anifeedsci.2011.06.002 ER - TY - CPAPER T1 - Understanding GxE interaction and cardiovascular disease risk T2 - 61st Annual Meeting of the American Society of Human Genetics and the 12th International Congress of Human Genetics (ICHG 2011) AN - 1312991966; 6056517 JF - 61st Annual Meeting of the American Society of Human Genetics and the 12th International Congress of Human Genetics (ICHG 2011) AU - Lai, C-Q Y1 - 2011/10/11/ PY - 2011 DA - 2011 Oct 11 KW - Cardiovascular diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312991966?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=61st+Annual+Meeting+of+the+American+Society+of+Human+Genetics+and+the+12th+International+Congress+of+Human+Genetics+%28ICHG+2011%29&rft.atitle=Understanding+GxE+interaction+and+cardiovascular+disease+risk&rft.au=Lai%2C+C-Q&rft.aulast=Lai&rft.aufirst=C-Q&rft.date=2011-10-11&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=61st+Annual+Meeting+of+the+American+Society+of+Human+Genetics+and+the+12th+International+Congress+of+Human+Genetics+%28ICHG+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://www.ichg2011.org/program_guide/files/assets/downloads/publication.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - JOUR T1 - Modeling colloid transport and retention in saturated porous media under unfavorable attachment conditions AN - 902382401; 15807458 AB - A mathematical model is presented for colloid transport and retention in saturated porous media under unfavorable attachment conditions. The model accounts for colloid transport in the bulk aqueous phase and adjacent to the solid surface, and rates of colloid collision, interaction, release, and immobilization on the solid phase. Model parameters were estimated using (1) filtration theory; (2) calculated interaction energies in conjunction with the Maxwellian kinetic energy model of diffusion; (3) information about the velocity magnitude and distribution adjacent to the solid phase that was obtained from pore scale water flow simulations; (4) colloid and collector sizes; (5) the balance of applied hydrodynamic and resisting adhesive torques; and (6) time dependent filling of retention locations using a Langmuirian approach. The presented theory constrains the model parameters and output to physically realistic values in many instances, and minimizes the need for parameter optimization. Example simulations demonstrate that our modeling formulation is qualitatively consistent with observed trends for retention with colloid size and concentration, grain size, and velocity for many systems. The model provides a clear conceptual explanation for the causes of hyperexponential, exponential, uniform, and nonmonotonic retention profiles without invoking hypotheses with regard to colloid heterogeneity, aggregation, or multiple deposition rates. Furthermore, the model formulation and research presented herein helps to identify areas where additional research and theory development are still needed. JF - Water Resources Research AU - Bradford, Scott A AU - Torkzaban, Saeed AU - Simunek, Jiri AD - US Salinity Laboratory, USDA, ARS, Riverside, California, USA Y1 - 2011/10/06/ PY - 2011 DA - 2011 Oct 06 PB - American Geophysical Union, 2000 Florida Ave., N.W. Washington DC 20009 United States VL - 47 IS - 10 SN - 0043-1397, 0043-1397 KW - Meteorological & Geoastrophysical Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts; Aqualine Abstracts KW - 1831 Hydrology: Groundwater quality KW - 1832 Hydrology: Groundwater transport KW - 1847 Hydrology: Modeling KW - colloid KW - dual permeability KW - model KW - retention KW - transport KW - Hydrodynamics KW - Colloids KW - Particle Size KW - Water resources KW - Retention KW - Grain size KW - Diffusion KW - Adhesives KW - Heterogeneity KW - Modelling KW - Particle size KW - Mathematical models KW - Porous Media KW - Flow Discharge KW - Velocity KW - Simulation KW - Solids KW - Model Studies KW - Filtration KW - Numerical simulations KW - Kinetics KW - Water resources research KW - Immobilization KW - AQ 00001:Water Resources and Supplies KW - Q2 09390:Search and salvage KW - SW 0810:General KW - M2 556.18:Water Management (556.18) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902382401?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Water+Resources+Research&rft.atitle=Modeling+colloid+transport+and+retention+in+saturated+porous+media+under+unfavorable+attachment+conditions&rft.au=Bradford%2C+Scott+A%3BTorkzaban%2C+Saeed%3BSimunek%2C+Jiri&rft.aulast=Bradford&rft.aufirst=Scott&rft.date=2011-10-06&rft.volume=47&rft.issue=10&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Water+Resources+Research&rft.issn=00431397&rft_id=info:doi/10.1029%2F2011WR010812 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Number of references - 85 N1 - Last updated - 2014-11-12 N1 - SubjectsTermNotLitGenreText - Filtration; Mathematical models; Colloids; Grain size; Water resources; Adhesives; Immobilization; Modelling; Hydrodynamics; Numerical simulations; Water resources research; Particle size; Kinetics; Simulation; Velocity; Diffusion; Porous Media; Particle Size; Flow Discharge; Solids; Retention; Heterogeneity; Model Studies DO - http://dx.doi.org/10.1029/2011WR010812 ER - TY - JOUR T1 - Treatment of an Intramammary Bacterial Infection with 25-Hydroxyvitamin D3 AN - 1014107464; 16207654 AB - Deficiency of serum levels of 25-hydroxyvitamin D3 has been correlated with increased risk of infectious diseases such as tuberculosis and influenza. A plausible reason for this association is that expression of genes encoding important antimicrobial proteins depends on concentrations of 1,25-dihydroxyvitamin D3 produced by activated immune cells at sites of infection, and that synthesis of 1,25-dihydroxyvitamin D3 is dependent on the availability of 25-hydroxyvitamin D3. Thus, increasing the availability of 25(OH)D3 for immune cell synthesis of 1,25-dihydroxyvitamin D3 at sites of infection has been hypothesized to aid in clearance of the infection. This report details the treatment of an acute intramammary infection with infusion of 25-hydroxyvitamin D3 to the site of infection. Ten lactating cows were infected with in one quarter of their mammary glands. Half of the animals were treated intramammary with 25-hydroxyvitamin D3. The 25-hydroxyvitamin D3 treated animal showed significantly lower bacterial counts in milk and showed reduced symptomatic affects of the mastitis. It is significant that treatment with 25-hydroxyvitamin D3 reduced the severity of an acute bacterial infection. This finding suggested a significant non-antibiotic complimentary role for 25-hydroxyvitamin D3 in the treatment of infections in compartments naturally low in 25-hydroxyvitamin D3 such as the mammary gland and by extension, possibly upper respiratory tract infections. JF - PLoS ONE AU - Lippolis, John D AU - Reinhardt, Timothy A AU - Sacco, Randy A AU - Nonnecke, Brian J AU - Nelson, Corwin D AD - Ruminant Diseases and Immunology Research Unit, National Animal Disease Center, Agricultural Research Service (ARS), United States Department of Agriculture (USDA), Ames, Iowa, United States of America Y1 - 2011/10/03/ PY - 2011 DA - 2011 Oct 03 PB - BioMed Central Ltd., Middlesex House London W1T 4LB United Kingdom VL - 6 IS - 0 KW - Microbiology Abstracts B: Bacteriology KW - Antimicrobial agents KW - Calcitriol KW - Infection KW - Infectious diseases KW - Influenza KW - Mammary gland KW - Mastitis KW - Milk KW - Respiratory tract diseases KW - Serum levels KW - Tuberculosis KW - Bacteria KW - Mycobacterium KW - J 02410:Animal Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1014107464?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=PLoS+ONE&rft.atitle=Treatment+of+an+Intramammary+Bacterial+Infection+with+25-Hydroxyvitamin+D3&rft.au=Lippolis%2C+John+D%3BReinhardt%2C+Timothy+A%3BSacco%2C+Randy+A%3BNonnecke%2C+Brian+J%3BNelson%2C+Corwin+D&rft.aulast=Lippolis&rft.aufirst=John&rft.date=2011-10-03&rft.volume=6&rft.issue=0&rft.spage=&rft.isbn=&rft.btitle=&rft.title=PLoS+ONE&rft.issn=1932-6203&rft_id=info:doi/10.1371%2Fjournal.pone.0025479 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-05-01 N1 - Last updated - 2012-05-18 N1 - SubjectsTermNotLitGenreText - Serum levels; Influenza; Respiratory tract diseases; Milk; Infectious diseases; Mammary gland; Tuberculosis; Infection; Mastitis; Antimicrobial agents; Calcitriol; Bacteria; Mycobacterium DO - http://dx.doi.org/10.1371/journal.pone.0025479 ER - TY - JOUR T1 - Cicadomorpha Insects Associated with Bacterial Leaf Scorch Infected Oak in Central New Jersey AN - 954696187; 16387950 AB - Potential insect vectors for transmission of oak leaf scorch caused by Xylella fastidiosa Wells et al., in pin and red oaks in New Jersey were surveyed by placing yellow sticky card traps in tree canopies and fogging with Pyrethrin insecticide during 2002-2006. Thirty-seven Cicadomorpha species were collected from 20 genera in Membracidae, Cicadellidae, Aphrophoridae, and Clastopteridae. Of the 12,880 potential vectors collected, 91.4% were Membracidae, 6.9% were Cicadellidae, and 1.7% were Aphrophoridae and Clastopteridae. Fogging collected more insect species and individuals than sticky card collections. Sticky card sampling, done more frequently and at a larger number of locations provided similar community structure information as fogging. Sticky card collections of the dominant treehopper species, Ophiderma definita Woodruff were male biased when females were gravid. O. definita populations peaked in early June, comprised 68.2% of the total collection, and were more abundant in pin oaks than red oaks. Graphocephala versuta (Say) peaked in mid-July, comprising 6.2% of the total collection. Higher Cicadomorpha populations were observed in asymptomatic oak canopies than in neighboring X. fastidiosa infected oaks. Individual insect specimens collected from oaks were subjected to a X. fastidiosa DNA assay by polymerase chain reaction amplification. The average X. fastidiosa positive rate was 13.89% for all specimens tested. Eleven treehopper species, six leafhopper species, and four spittlebug species tested DNA positive for X. fastidiosa. JF - Environmental Entomology AU - Zhang, Jianxin AU - Lashomb, James AU - Gould, Ann AU - Hamilton, George AD - Department of Entomology, Rutgers University, New Brunswick, NJ 08901., jianxin.zhang@aphis.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1131 EP - 1143 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 5 SN - 0046-225X, 0046-225X KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts B: Bacteriology; Entomology Abstracts; Ecology Abstracts KW - Canopies KW - Community structure KW - DNA KW - Disease transmission KW - Insecticides KW - Leaf scorch KW - Polymerase chain reaction KW - Sampling KW - Traps KW - Trees KW - Vectors KW - canopies KW - insects KW - pyrethrins KW - Cicadellidae KW - USA, New Jersey KW - Graphocephala KW - Bacteria KW - Aphrophoridae KW - Xylella fastidiosa KW - Membracidae KW - J 02410:Animal Diseases KW - D 04040:Ecosystem and Ecology Studies KW - Z 05350:Medical, Veterinary, and Agricultural Entomology KW - A 01390:Forestry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954696187?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Cicadomorpha+Insects+Associated+with+Bacterial+Leaf+Scorch+Infected+Oak+in+Central+New+Jersey&rft.au=Zhang%2C+Jianxin%3BLashomb%2C+James%3BGould%2C+Ann%3BHamilton%2C+George&rft.aulast=Zhang&rft.aufirst=Jianxin&rft.date=2011-10-01&rft.volume=40&rft.issue=5&rft.spage=1131&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN10083 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 58 N1 - Last updated - 2012-06-18 N1 - SubjectsTermNotLitGenreText - Insecticides; Trees; Community structure; Polymerase chain reaction; Traps; Vectors; Sampling; Canopies; Leaf scorch; pyrethrins; Disease transmission; DNA; insects; canopies; Graphocephala; Bacteria; Cicadellidae; Xylella fastidiosa; Aphrophoridae; Membracidae; USA, New Jersey DO - http://dx.doi.org/10.1603/EN10083 ER - TY - JOUR T1 - Analysis of Vertical Distributions and Effective Flight Layers of Insects: Three-Dimensional Simulation of Flying Insects and Catch at Trap Heights AN - 954656153; 16387979 AB - The mean height and standard deviation (SD) of flight is estimated for over 100 insect species from their catches on several trap heights reported in the literature. The iterative equations for calculating mean height and SD are presented. The mean flight height for 95% of the studies varied from 0.17 to 5.40 m, and the SD from 0.12 to 3.83 m. The relationship between SD and mean flight height (X) was SD = 0.711X-0.7849, n = 123, R2 = 0.63. In addition, the vertical trap catches were fit to normal distributions and analyzed for skew and kurtosis. The SD was used to calculate an effective flight layer used in transforming the spherical effective attraction radius (EAR) of pheromone-baited traps into a circular EARc for use in two-dimensional encounter rate models of mass trapping and mating disruption using semiochemicals. The EAR/EARc also serves to reveal the attractive strength and efficacy of putative pheromone blends. To determine the reliability of mean flight height and SD calculations from field trapping data, simulations of flying insects in three dimensions (3D) were performed. The simulations used an algorithm that caused individuals to roam freely at random but such that the population distributed vertically according to a normal distribution of specified mean and SD. Within this 3D arena, spherical traps were placed at various heights to determine the effects on catch and SD. The results indicate that data from previous field studies, when analyzed by the iterative equations, should provide good estimates of the population mean height and SD of flight. JF - Environmental Entomology AU - Byers, John A AD - US Arid-Land Agricultural Research Center, USDA-ARS, 21881 North Cardon Lane, Maricopa, Arizona 85138, john.byers@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1210 EP - 1222 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 5 SN - 0046-225X, 0046-225X KW - Entomology Abstracts; Ecology Abstracts KW - Algorithms KW - Data processing KW - Ear KW - Flight KW - Mathematical models KW - Mating disruption KW - Pheromones KW - Semiochemicals KW - Simulation KW - Standard deviation KW - Trapping KW - Vertical distribution KW - catches KW - insects KW - Z 05340:Ecology and Behavior KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954656153?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Analysis+of+Vertical+Distributions+and+Effective+Flight+Layers+of+Insects%3A+Three-Dimensional+Simulation+of+Flying+Insects+and+Catch+at+Trap+Heights&rft.au=Byers%2C+John+A&rft.aulast=Byers&rft.aufirst=John&rft.date=2011-10-01&rft.volume=40&rft.issue=5&rft.spage=1210&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN11043 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 75 N1 - Last updated - 2013-02-08 N1 - SubjectsTermNotLitGenreText - Mating disruption; Flight; Vertical distribution; Standard deviation; Mathematical models; Data processing; Pheromones; Semiochemicals; Algorithms; Ear; Trapping; catches; Simulation; insects DO - http://dx.doi.org/10.1603/EN11043 ER - TY - JOUR T1 - Sporulation and Survival of Toxoplasma gondii Oocysts in Different Types of Commercial Cat Litter AN - 954656108; 16388086 AB - Toxoplasmagondii oocysts are environmentally resistant and can survive outdoors for many months in dry and cold climates. In the present study, sporulation and survival of T. gondii oocysts was studied in different types of cat litters commercially available in the United States. Oocysts sporulated within 2-3 days in all types of cat litters and occasionally remained viable for 14 days. Results indicate that cat litter should be changed daily to prevent sporulation and infectivity to people. JF - Journal of Parasitology AU - Dubey, J P AU - Ferreira, L R AU - Martins, J AU - Jones, J L Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 751 EP - 754 PB - American Society of Parasitologists VL - 97 IS - 5 SN - 0022-3395, 0022-3395 KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Ecology Abstracts KW - Litter KW - Infectivity KW - Oocysts KW - Toxoplasma gondii KW - Climate KW - Sporulation KW - Survival KW - K 03410:Animal Diseases KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954656108?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Parasitology&rft.atitle=Sporulation+and+Survival+of+Toxoplasma+gondii+Oocysts+in+Different+Types+of+Commercial+Cat+Litter&rft.au=Dubey%2C+J+P%3BFerreira%2C+L+R%3BMartins%2C+J%3BJones%2C+J+L&rft.aulast=Dubey&rft.aufirst=J&rft.date=2011-10-01&rft.volume=97&rft.issue=5&rft.spage=751&rft.isbn=&rft.btitle=&rft.title=Journal+of+Parasitology&rft.issn=00223395&rft_id=info:doi/10.1645%2FGE-2774.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 17 N1 - Last updated - 2012-05-07 N1 - SubjectsTermNotLitGenreText - Infectivity; Litter; Oocysts; Climate; Sporulation; Survival; Toxoplasma gondii DO - http://dx.doi.org/10.1645/GE-2774.1 ER - TY - JOUR T1 - Host Race Evolution in Schizaphis graminum (Hemiptera: Aphididae): Nuclear DNA Sequences AN - 954640531; 16388002 AB - The greenbug aphid, Schizaphis graminum (Rondani) was introduced into the United States in the late 1880s, and quickly was established as a pest of wheat, oat, and barley. Sorghum was also a host, but it was not until 1968 that greenbug became a serious pest of it as well. The most effective control method is the planting of resistant varieties; however, the occurrence of greenbug biotypes has hampered the development and use of plant resistance as a management technique. Until the 1990s, the evolutionary status of greenbug biotypes was obscure. Four mtDNA cytochrome oxidase subunit I (COI) haplotypes were previously identified, suggesting that S. graminum sensu lato was comprised of host-adapted races. To elucidate the current evolutionary and taxonomic status of the greenbug and its biotypes, two nuclear genes and introns were sequenced; cytochrome c (CytC) and elongation factor 1- alpha (EF1- alpha ). Phylogenetic analysis of CytC sequences were in complete agreement with COI sequences and demonstrated three distinct evolutionary lineages in S. graminum. EF1- alpha DNA sequences were in partial agreement with COI and CytC sequences, and demonstrated two distinct evolutionary lineages. Host-adapted races in greenbug are sympatric and appear reproductively isolated. Agricultural biotypes in S. graminum likely arose by genetic recombination via meiosis during sexual reproduction within host-races. The 1968 greenbug outbreak on sorghum was the result of the introduction of a host race adapted to sorghum, and not selection by host resistance genes in crops. JF - Environmental Entomology AU - Shufran, Kevin A AD - USDA-ARS, Wheat, Peanut, and Other Field Crops Research Unit, 1301 N. Western Road, Stillwater, OK 74075, kashufran@aol.com Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1317 EP - 1322 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 5 SN - 0046-225X, 0046-225X KW - Biochemistry Abstracts 2: Nucleic Acids; Sustainability Science Abstracts; Entomology Abstracts; Ecology Abstracts KW - Biotypes KW - USA KW - Aphididae KW - Evolution KW - biotypes KW - Z 05310:Taxonomy, Morphology, Geography, and Fossils KW - M3 1010:Issues in Sustainable Development KW - D 04040:Ecosystem and Ecology Studies KW - N 14810:Methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954640531?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Host+Race+Evolution+in+Schizaphis+graminum+%28Hemiptera%3A+Aphididae%29%3A+Nuclear+DNA+Sequences&rft.au=Shufran%2C+Kevin+A&rft.aulast=Shufran&rft.aufirst=Kevin&rft.date=2011-10-01&rft.volume=40&rft.issue=5&rft.spage=1317&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN11103 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 1 N1 - Last updated - 2014-02-11 N1 - SubjectsTermNotLitGenreText - Evolution; biotypes; Aphididae; USA DO - http://dx.doi.org/10.1603/EN11103 ER - TY - JOUR T1 - Influence of Corn on Stink Bugs (Heteroptera: Pentatomidae) in Subsequent Crops AN - 954640522; 16387959 AB - In southeastern United States farmscapes, corn, Zea mays L., is often closely associated with peanut, (Arachis hypogaea L.), cotton, (Gossypium hirsutum L.), or both. The objective of this 3-yr on-farm study was to examine the influence of corn on stink bugs (Hetcroptera: Pentatomidae), Nezara viridula (L.), and Euschistus servus (Say), in subsequent crops in these farmscapes. Adults of both stink bug species entered corn first, and seasonal occurrence of stink bug eggs, nymphs, and adults indicated that corn was a suitable host plant for adult survival and nymphal development to adults. Stink bug females generally oviposited on cotton or peanut near the interface, or common boundary, of the farmscape before senescence of corn, availability of a new food, or both. Adult stink bugs dispersed from crop to crop at the interface of a farmscape in response to senescence of corn, availability of new food, or both. In corn-cotton farmscapes, adult stink bugs dispersed from senescing corn into cotton to feed on bolls (fruit). In corn-peanut farmscapes, adult stink bugs dispersed from senescing corn into peanut, which apparently played a role in nymphal development in these farmscapes. In the corn-cotton-peanut farmscape, stink bug nymphs and adults dispersed from peanut into cotton in response to newly available food, not senescence of peanut. Stink bug dispersal into cotton resulted in severe boll damage. In conclusion, N. viridula and E. servus are generalist feeders that exhibit edge-mediated dispersal from corn into subsequent adjacent crops in corn-cotton, corn-peanut, and corn-peanut-cotton farmscapes to take advantage of suitable resources available in time and space for oviposition, nymphal development, and adult survival. Management strategies for crops in this region need to be designed to break the cycle of stink bug production, dispersal, and expansion by exploiting their edge-mediated movement and host plant preferences. JF - Environmental Entomology AU - Tillman, P G AD - USDA-ARS, Crop Protection and Management Research Laboratory, Tifton, GA 31793, glynn.tillman@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1159 EP - 1176 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 5 SN - 0046-225X, 0046-225X KW - Entomology Abstracts; Ecology Abstracts KW - Boundaries KW - Cotton KW - Crops KW - Development KW - Dispersal KW - Eggs KW - Food KW - Food availability KW - Fruits KW - Host plants KW - Nuts KW - Oviposition KW - Seasonal variations KW - Senescence KW - Sulfur dioxide KW - Survival KW - corn KW - dispersal KW - senescence KW - survival KW - Arachis hypogaea KW - USA, Southeast KW - Pentatomidae KW - Euschistus servus KW - Nezara viridula KW - Zea mays KW - Gossypium hirsutum KW - Hemiptera KW - D 04040:Ecosystem and Ecology Studies KW - Z 05350:Medical, Veterinary, and Agricultural Entomology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954640522?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Influence+of+Corn+on+Stink+Bugs+%28Heteroptera%3A+Pentatomidae%29+in+Subsequent+Crops&rft.au=Tillman%2C+P+G&rft.aulast=Tillman&rft.aufirst=P&rft.date=2011-10-01&rft.volume=40&rft.issue=5&rft.spage=1159&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN10243 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 45 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Fruits; Food; Nuts; Survival; Food availability; Development; Host plants; Crops; Eggs; Boundaries; Senescence; Dispersal; Oviposition; Sulfur dioxide; Cotton; senescence; survival; Seasonal variations; dispersal; corn; Arachis hypogaea; Nezara viridula; Zea mays; Pentatomidae; Euschistus servus; Hemiptera; Gossypium hirsutum; USA, Southeast DO - http://dx.doi.org/10.1603/EN10243 ER - TY - JOUR T1 - Self-Selection of Two Diet Components by Tenebrio molitor (Coleoptera: Tenebrionidae) Larvae and Its Impact on Fitness AN - 954640520; 16387957 AB - We studied the ability of Tenebrio molitor L. (Coleoptera: Tenebrionidae) to self-select optimal ratios of two dietary components to approach nutritional balance and maximum fitness. Relative consumption of wheat bran and dry potato flakes was determined among larvae feeding on four different ratios of these components (10, 20, 30, and 40% potato). Groups of early instars were provided with a measured amount of food and the consumption of each diet component was measured at the end of 4 wk and again 3 wk later. Consumption of diet components by T. molitor larvae deviated significantly from expected ratios indicating nonrandom self-selection. Mean percentages of dry potato consumed were 11.98, 19.16, 19.02, and 19.27% and 11.89, 20.48, 24.67, and 25.97% during the first and second experimental periods for diets with 10, 20, 30, and 40% potato, respectively. Life table analysis was used to determine the fitness of T. molitor developing in the four diet mixtures in a no-choice experiment. The diets were compared among each other and a control diet of wheat bran only. Doubling time was significantly shorter in groups consuming 10 and 20% potato than the control and longer in groups feeding on 30 and 40% potato. The self-selected ratios of the two diet components approached 20% potato, which was the best ratio for development and second best for population growth. Our findings show dietary self-selection behavior in T. molitor larvae, and these findings may lead to new methods for optimizing dietary supplements for T. molitor. JF - Environmental Entomology AU - Morales-Ramos, JA AU - Rojas, M G AU - Shapiro-Ilan, DI AU - Tedders, W L AD - USDA-ARS National Biological Control Laboratory, Stoneville, MS 38776., juan.moralesramos@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1285 EP - 1294 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 40 IS - 5 SN - 0046-225X, 0046-225X KW - Entomology Abstracts; Ecology Abstracts KW - Dietary supplements KW - Diets KW - Feeding KW - Fitness KW - Food consumption KW - Larvae KW - Life tables KW - Nutrition KW - Population growth KW - dietary supplements KW - feeding KW - population growth KW - Tenebrio molitor KW - Tenebrionidae KW - Triticum aestivum KW - Solanum tuberosum KW - Coleoptera KW - Z 05340:Ecology and Behavior KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954640520?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Entomology&rft.atitle=Self-Selection+of+Two+Diet+Components+by+Tenebrio+molitor+%28Coleoptera%3A+Tenebrionidae%29+Larvae+and+Its+Impact+on+Fitness&rft.au=Morales-Ramos%2C+JA%3BRojas%2C+M+G%3BShapiro-Ilan%2C+DI%3BTedders%2C+W+L&rft.aulast=Morales-Ramos&rft.aufirst=JA&rft.date=2011-10-01&rft.volume=40&rft.issue=5&rft.spage=1285&rft.isbn=&rft.btitle=&rft.title=Environmental+Entomology&rft.issn=0046225X&rft_id=info:doi/10.1603%2FEN10239 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 50 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Diets; Fitness; Food consumption; Feeding; Population growth; Life tables; Dietary supplements; dietary supplements; population growth; feeding; Larvae; Nutrition; Triticum aestivum; Coleoptera; Solanum tuberosum; Tenebrio molitor; Tenebrionidae DO - http://dx.doi.org/10.1603/EN10239 ER - TY - JOUR T1 - Vector Transmission Efficiency of Liberibacter by Bactericera cockerelli (Hemiptera: Triozidae) in Zebra Chip Potato Disease: Effects of Psyllid Life Stage and Inoculation Access Period AN - 954639212; 16387886 AB - Successful transmission of plant pathogens by insects depends on the vector inoculation efficiency and how rapidly the insect can effectively transmit the pathogen to the host plant. The potato psyllid, Bactericera cockerelli (Sulc), has recently been found to transmit "Candidatus Liberibacter solanacearum," a bacterium associated with zebra chip (ZC), an emerging and economically important disease of potato in several parts of the world. Currently, little is known about the epidemiology of ZC and its vector's inoculation capabilities. Studies were conducted in the field and laboratory to 1) assess transmission efficiency of potato psyllid nymphs and adults; 2) determine whether psyllid inoculation access period affects ZC incidence, severity, and potato yield; and 3) determine how fast the psyllid can transmit liberibacter to potato, leading to ZC development. Results showed that adult potato psyllids were highly efficient vectors of liberibacter that causes ZC and that nymphs were less efficient than adults at transmitting this bacterium. It was also determined that inoculation access period had little influence on overall ZC disease incidence, severity, and resulting yield loss. Moreover, results showed that exposure of a plant to 20 adult potato psyllids for a period as short as 1 h resulted in ZC symptom development. Furthermore, it was shown that a single adult potato psyllid was capable of inoculating liberibacter to potato within a period as short as 6 h, thereby inducing development of ZC. This information will help in developing effective management strategies for this serious potato disease. JF - Journal of Economic Entomology AU - Buchman, Jeremy L AU - Sengoda, Venkatesan G AU - Munyaneza, Joseph E AD - Yakima Agricultural Research Laboratory, USDA-ARS, Wapato, WA 98951., joseph.munyaneza@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1486 EP - 1495 PB - Entomological Society of America, 9301 Annapolis Rd. Lanham MD 20706 United States VL - 104 IS - 5 SN - 0022-0493, 0022-0493 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Entomology Abstracts KW - Developmental stages KW - Disease transmission KW - Epidemiology KW - Host plants KW - Inoculation KW - Pathogens KW - Vectors KW - Bacteria KW - Hemiptera KW - Solanum tuberosum KW - Triozidae KW - A 01360:Plant Diseases KW - Z 05350:Medical, Veterinary, and Agricultural Entomology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954639212?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Economic+Entomology&rft.atitle=Vector+Transmission+Efficiency+of+Liberibacter+by+Bactericera+cockerelli+%28Hemiptera%3A+Triozidae%29+in+Zebra+Chip+Potato+Disease%3A+Effects+of+Psyllid+Life+Stage+and+Inoculation+Access+Period&rft.au=Buchman%2C+Jeremy+L%3BSengoda%2C+Venkatesan+G%3BMunyaneza%2C+Joseph+E&rft.aulast=Buchman&rft.aufirst=Jeremy&rft.date=2011-10-01&rft.volume=104&rft.issue=5&rft.spage=1486&rft.isbn=&rft.btitle=&rft.title=Journal+of+Economic+Entomology&rft.issn=00220493&rft_id=info:doi/10.1603%2FEC11123 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Number of references - 30 N1 - Last updated - 2013-05-06 N1 - SubjectsTermNotLitGenreText - Epidemiology; Inoculation; Developmental stages; Vectors; Pathogens; Host plants; Disease transmission; Bacteria; Solanum tuberosum; Triozidae; Hemiptera DO - http://dx.doi.org/10.1603/EC11123 ER - TY - JOUR T1 - Soil quality in a pecan-kura clover alley cropping system in the Midwestern USA AN - 954638631; 16333336 AB - Intercropping alleys in agroforestry provides an income source until the tree crop produces harvestable yields. However, cultivation of annual crops decreases soil organic matter and increases soil erosion potential, especially on sloping landscapes. Perennial crops maintain a continuous soil cover, increase water infiltration, reduce soil erosion, and improve overall soil quality. The objective of this on-farm study was to assess the effects of a perennial legume, kura clover (Trifolium ambiguum M. Bieb.), on soil quality in a recently established pecan (Carya illinoinensis Wangenh. C. Koch) orchard. The pecan-kura clover agroforestry practice was established on deep loess soils of the Missouri River hills landscape. These silt loams are on 2-20% slopes and can be highly erosive. Kura clover, introduced as the alley crop 5 years after pecan planting, was selected based on its perennial growth habit, nitrogen-fixing ability, winter hardiness, high forage quality, and soil conservation properties. Kura clover was seeded in 2001 and harvested for hay annually beginning 2003. Soil quality indicators of total organic C, total N, water-stable aggregates, and selected soil enzymes were determined on surface soil samples collected annually after kura clover establishment. Soil organic C and activities of soil enzymes increased compared with cultivated and grass pasture control soils by the eighth year of establishment. Water-stable aggregation improved by 50% and surface soil shear strength improved significantly (P < 0.05) in alleys compared with control sites. Results illustrate that kura clover as the alley-cropped component improved soil fertility and biological activity through increased organic matter and improved soil structure, and yielded high quality forage valuable for the cattle-feeding operation. Kura clover maintained or improved soil quality, reduced soil erosion potential, and benefited pecan growth by providing a source of soil nitrogen and improving soil structure for adequate water infiltration and aeration. JF - Agroforestry Systems AU - Kremer, Robert J AU - Kussman, Robert D AD - USDA, Agricultural Research Service, Cropping Systems and Water Quality Research Unit, University of Missouri, 302 Natural Resources Bldg., Columbia, MO, 65211, USA, Bob.Kremer@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 213 EP - 223 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 83 IS - 2 SN - 0167-4366, 0167-4366 KW - Sustainability Science Abstracts KW - Crops KW - Enzymes KW - Infiltration KW - Organic matter KW - Soil KW - Soil erosion KW - agroforestry KW - forage KW - soil structure KW - Carya KW - USA, Missouri R. KW - Trifolium ambiguum KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/954638631?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Agroforestry+Systems&rft.atitle=Soil+quality+in+a+pecan-kura+clover+alley+cropping+system+in+the+Midwestern+USA&rft.au=Kremer%2C+Robert+J%3BKussman%2C+Robert+D&rft.aulast=Kremer&rft.aufirst=Robert&rft.date=2011-10-01&rft.volume=83&rft.issue=2&rft.spage=213&rft.isbn=&rft.btitle=&rft.title=Agroforestry+Systems&rft.issn=01674366&rft_id=info:doi/10.1007%2Fs10457-011-9370-y LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2012-12-14 N1 - SubjectsTermNotLitGenreText - Soil; soil structure; Organic matter; forage; Infiltration; Enzymes; Soil erosion; Crops; agroforestry; Carya; Trifolium ambiguum; USA, Missouri R. DO - http://dx.doi.org/10.1007/s10457-011-9370-y ER - TY - JOUR T1 - Scale-up of Ethanol Production from Winter Barley by the EDGE (Enhanced Dry Grind Enzymatic) Process in Fermentors up to 300 l AN - 926884414; 16334142 AB - A fermentation process, which was designated the enhanced dry grind enzymatic (EDGE) process, has recently been developed for barley ethanol production. In the EDGE process, in addition to the enzymes normally required for starch hydrolysis, commercial beta -glucanases were used to hydrolyze (1,3)(1,4)- beta -d-glucans to smaller molecules, thus reducing the viscosity of the mash to levels sufficiently low to allow transport and mixing in commercial equipment. Another enzyme, a developmental beta -glucosidase, then was used to hydrolyze the resulting oligomers to glucose, which subsequently was fermented to produce additional ethanol. The EDGE process was developed with Thoroughbred, a winter hulled barley, using a shake flask model. To move toward commercialization, it is necessary to prove that the developed process would be applicable to other barley varieties and also to demonstrate its scalability. Experiments were performed in 7.5, 70, and 300-l fermentors using Thoroughbred and Eve, a winter hull-less barley. It was shown that the process was scalable for both barley varieties. Low levels of glucose throughout the course of the fermentations demonstrated the high efficiency of the simultaneous saccharification and fermentation process. Final ethanol concentrations of 14% (v/v) were achieved for initial total solids of 28.5-30% (w/w), which gave an ethanol yield of 83-87% of the theoretical values. The distillers dried grains with solubles co-products contained very low levels of beta -glucans and thus were suitable for use in feed formulations for all animal species. JF - Applied Biochemistry and Biotechnology AU - Nghiem, Nhuan P AU - Taylor, Frank AU - Johnston, David B AU - Shetty, Jay K AU - Hicks, Kevin B AD - Eastern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 600 East Mermaid Lane, Wyndmoor, PA, 19038, USA, John.Nghiem@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 870 EP - 882 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 165 IS - 3-4 SN - 0273-2289, 0273-2289 KW - Biotechnology and Bioengineering Abstracts KW - Hordeum vulgare KW - beta -Glucanase KW - Fermentation KW - Glucose KW - Enzymes KW - Cell culture KW - Starch KW - Hydrolysis KW - Models KW - beta -Glucan KW - Viscosity KW - Grain KW - beta -Glucosidase KW - Ethanol KW - W 30935:Food Biotechnology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/926884414?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Biochemistry+and+Biotechnology&rft.atitle=Scale-up+of+Ethanol+Production+from+Winter+Barley+by+the+EDGE+%28Enhanced+Dry+Grind+Enzymatic%29+Process+in+Fermentors+up+to+300+l&rft.au=Nghiem%2C+Nhuan+P%3BTaylor%2C+Frank%3BJohnston%2C+David+B%3BShetty%2C+Jay+K%3BHicks%2C+Kevin+B&rft.aulast=Nghiem&rft.aufirst=Nhuan&rft.date=2011-10-01&rft.volume=165&rft.issue=3-4&rft.spage=870&rft.isbn=&rft.btitle=&rft.title=Applied+Biochemistry+and+Biotechnology&rft.issn=02732289&rft_id=info:doi/10.1007%2Fs12010-011-9304-1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-03-01 N1 - Last updated - 2013-12-04 N1 - SubjectsTermNotLitGenreText - beta -Glucanase; Fermentation; Glucose; Enzymes; Cell culture; Starch; Hydrolysis; Models; beta -Glucan; Viscosity; Grain; beta -Glucosidase; Ethanol; Hordeum vulgare DO - http://dx.doi.org/10.1007/s12010-011-9304-1 ER - TY - JOUR T1 - Impacts of urbanization on ground water quality and recharge in a semi-arid alluvial basin AN - 921717473; 2012-024166 AB - The management of groundwater resources is paramount in semi-arid regions experiencing urban development. In the southwestern United States, enhancing recharge of urban storm runoff has been identified as a strategy for augmenting groundwater resources. An understanding of how urbanization may impact the timing of groundwater recharge and its quality is a prerequisite for mitigating water scarcity and identifying vulnerability to contamination. We sampled groundwater wells along the Rillito Creek in southern Arizona that had been previously analyzed for tritium in the late 1980s to early 1990s and analyzed samples for tritium ( (super 3) H) and helium-3 ( (super 3) H/ (super 3) He) to evaluate changes in (super 3) H and age date groundwaters. Groundwater samples were also analyzed for chlorofluorocarbons (CFCs) and basic water quality metrics. Substantial changes in (super 3) H values from waters sampled in the early 1990s compared to 2009 were identified after accounting for radioactive decay and indicate areas of rapid recharge. (super 3) H- (super 3) He groundwater ages ranged from 22 years before 2009 to modern recharge. CFC-11, -12 and -113 concentrations were anomalously high across the basin, and non-point source pollution in runoff and/or leaky infrastructure was identified as the most plausible source of this contamination. CFCs were strongly and positively correlated to nitrate (r (super 2) = 0.77) and a mobile trace metal, nickel (r (super 2) = 0.71), suggesting that solutes were derived from a similar source. Findings from this study suggest new waters from urban non-point sources are contributing to groundwater recharge and adversely affecting water quality. Reducing delivery of contaminants to areas of focused recharge will be critical to protect future groundwater resources. JF - Journal of Hydrology AU - Carlson, Mark A AU - Lohse, Kathleen A AU - McIntosh, J C AU - McLain, Jean E T Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 196 EP - 211 PB - Elsevier, Amsterdam VL - 409 IS - 1-2 SN - 0022-1694, 0022-1694 KW - gauging KW - water quality KW - terrestrial environment KW - unsaturated zone KW - hydrogeology KW - tritium KW - southern Arizona KW - urbanization KW - Tucson Basin KW - drainage basins KW - sewage KW - pollutants KW - human activity KW - nitrates KW - recharge KW - organic compounds KW - mobilization KW - waste disposal KW - water resources KW - United States KW - isotopes KW - landfills KW - semi-arid environment KW - water management KW - environmental analysis KW - environmental effects KW - chlorofluorocarbons KW - urban environment KW - irrigation KW - ground water KW - mitigation KW - radioactive isotopes KW - Rillito Creek KW - noble gases KW - halogenated hydrocarbons KW - helium KW - water pollution KW - Pima County Arizona KW - geochemistry KW - pollution KW - hydrochemistry KW - aquifers KW - metals KW - hydrogen KW - runoff KW - bacteria KW - Arizona KW - land use KW - 21:Hydrogeology KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/921717473?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Hydrology&rft.atitle=Impacts+of+urbanization+on+ground+water+quality+and+recharge+in+a+semi-arid+alluvial+basin&rft.au=Carlson%2C+Mark+A%3BLohse%2C+Kathleen+A%3BMcIntosh%2C+J+C%3BMcLain%2C+Jean+E+T&rft.aulast=Carlson&rft.aufirst=Mark&rft.date=2011-10-01&rft.volume=409&rft.issue=1-2&rft.spage=196&rft.isbn=&rft.btitle=&rft.title=Journal+of+Hydrology&rft.issn=00221694&rft_id=info:doi/10.1016%2Fj.jhydrol.2011.08.020 L2 - http://www.sciencedirect.com/science/journal/00221694 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2012-01-01 N1 - Number of references - 120 N1 - Document feature - illus. incl. 6 tables, sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - JHYDA7 N1 - SubjectsTermNotLitGenreText - aquifers; Arizona; bacteria; chlorofluorocarbons; drainage basins; environmental analysis; environmental effects; gauging; geochemistry; ground water; halogenated hydrocarbons; helium; human activity; hydrochemistry; hydrogen; hydrogeology; irrigation; isotopes; land use; landfills; metals; mitigation; mobilization; nitrates; noble gases; organic compounds; Pima County Arizona; pollutants; pollution; radioactive isotopes; recharge; Rillito Creek; runoff; semi-arid environment; sewage; southern Arizona; terrestrial environment; tritium; Tucson Basin; United States; unsaturated zone; urban environment; urbanization; waste disposal; water management; water pollution; water quality; water resources DO - http://dx.doi.org/10.1016/j.jhydrol.2011.08.020 ER - TY - JOUR T1 - "Population Dynamics of Crustaceans": Introduction to the Symposium AN - 918049121; 16129248 AB - Crustaceans are a globally-distributed faunal group, found across all habitats from the equator to the poles. They are an ideal focal assemblage for assessment of the impacts of climatic change and anthropogenic disturbance on nonmodel systems, such as how sea currents influence the movements of zooplankton communities in the open ocean, or how ecosystem processes affect phytoplanktonic species with restricted geographic distributions across a cluster of island lakes that could be a new model system for studies of speciation. This symposium introduced early-career researchers working in the fields of phylogeography, ecogenomics, fisheries management, and ecosystem processes with the aim of highlighting the different genetic and ecological approaches to the study of population dynamics of freshwater, estuarine, and marine crustacean species. JF - Integrative and Comparative Biology AU - Buhay, Jennifer E AD - USDA-ARS, Corn Insects and Crop Genetics Ressearch Unit, Genetics Laboratory Building, Iowa State University, Ames, IA 50011, USA, jennifer.buhay@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 577 EP - 579 PB - Society for Integrative and Comparative Biology, Great Clarendon Street Oxford OX2 6DP United Kingdom VL - 51 IS - 4 SN - 1540-7063, 1540-7063 KW - Oceanic Abstracts; ASFA 1: Biological Sciences & Living Resources; Ecology Abstracts; Sustainability Science Abstracts KW - Speciation KW - Geographical distribution KW - Climatic changes KW - Climate change KW - Freshwater KW - Population dynamics KW - Lakes KW - Islands KW - Fishery management KW - Freshwater crustaceans KW - Brackishwater environment KW - Marine crustaceans KW - Marine KW - disturbance KW - Conferences KW - Freshwater environments KW - Zooplankton KW - Estuaries KW - Brackish KW - marine crustaceans KW - Habitat KW - Ecosystem disturbance KW - crustaceans KW - Oceans KW - M3 1010:Issues in Sustainable Development KW - D 04040:Ecosystem and Ecology Studies KW - Q1 08604:Stock assessment and management KW - O 4060:Pollution - Environment UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/918049121?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Integrative+and+Comparative+Biology&rft.atitle=%22Population+Dynamics+of+Crustaceans%22%3A+Introduction+to+the+Symposium&rft.au=Buhay%2C+Jennifer+E&rft.aulast=Buhay&rft.aufirst=Jennifer&rft.date=2011-10-01&rft.volume=51&rft.issue=4&rft.spage=577&rft.isbn=&rft.btitle=&rft.title=Integrative+and+Comparative+Biology&rft.issn=15407063&rft_id=info:doi/10.1093%2Ficb%2Ficr100 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Last updated - 2016-07-07 N1 - SubjectsTermNotLitGenreText - Geographical distribution; Conferences; Climate change; Estuaries; Freshwater crustaceans; Brackishwater environment; Population dynamics; Marine crustaceans; Ecosystem disturbance; Speciation; Lakes; Islands; Fishery management; Freshwater environments; Oceans; Climatic changes; Zooplankton; Habitat; disturbance; crustaceans; marine crustaceans; Marine; Brackish; Freshwater DO - http://dx.doi.org/10.1093/icb/icr100 ER - TY - JOUR T1 - Response of two sweet potato cultivars to weed interference AN - 918045578; 15589064 AB - Field experiments were conducted at the U.S. Vegetable Laboratory, Charleston, SC, U.S.A in 2000, 2001, and 2004 to assess the effect of different durations of weed interference on two sweet potato cultivars with different shoot growth habits. The cultivars were Beauregard, which has a spreading growth habit that is typical of U.S. sweet potato cultivars and Carolina Bunch, with an erect growth habit. Weed interference treatments included control plots that were maintained weed free throughout the growing season and plots that were maintained weed free for 0, 10, 20, and 30 days after transplanting. In general, Carolina Bunch was more tolerant of weed interference than was Beauregard. In two of three years Carolina Bunch storage root yields were higher than Beauregard yields in plots that received no weeding; whereas, yields of the two cultivars in weed free plots were not different. Weed interference affected shoot growth to a greater extent than it affected storage root production. At the end of the growing season, Carolina Bunch shoot biomass was greater than Beauregard shoot biomass in plots receiving no weeding and in plots that were maintained weed free for 10 days in all three years. Shoot biomasses of the two cultivars were not different in weed-free plots. Weed shoot biomasses were greater in Beauregard plots than in Carolina Bunch plots in several instances. These results demonstrate that sweet potato cultivars with a vigorous, erect shoot growth habit (with shorter stems, greater branching, and a denser and taller canopy early in the growing season) may be less susceptible to weed interference than cultivars with spreading shoot growth. This study also confirmed previous observations that sweet potato productivity is not greatly affected by moderate weed interference; thus, it may not require intense weed management to produce high yields. JF - Crop Protection AU - Harrison, Howard F AU - Jackson, DMichael Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1291 EP - 1296 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 30 IS - 10 SN - 0261-2194, 0261-2194 KW - Environment Abstracts KW - Biomass KW - USA KW - Solanum tuberosum KW - weeds KW - ENA 06:Food & Drugs UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/918045578?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Crop+Protection&rft.atitle=Response+of+two+sweet+potato+cultivars+to+weed+interference&rft.au=Harrison%2C+Howard+F%3BJackson%2C+DMichael&rft.aulast=Harrison&rft.aufirst=Howard&rft.date=2011-10-01&rft.volume=30&rft.issue=10&rft.spage=1291&rft.isbn=&rft.btitle=&rft.title=Crop+Protection&rft.issn=02612194&rft_id=info:doi/10.1016%2Fj.cropro.2011.05.002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - weeds; Solanum tuberosum; USA DO - http://dx.doi.org/10.1016/j.cropro.2011.05.002 ER - TY - JOUR T1 - Soil characteristic response times and pedogenic thresholds during the 1000-year evolution of a paddy soil chronosequence AN - 916840292; 2012-014086 AB - A paddy soil chronosequence consisting of five profiles derived from calcareous marine sediments with cultivation history from 0 to 1000 yr was studied to assess the dynamic changes in soil properties and major elemental mass balance during soil evolution and to understand the response rates of soil properties at different time scales. The threshold concept was applied to increase ear understanding of paddy soil genesis processes. Results showed that 50 yr of paddy cultivation induced measurable accumulation of soil organic C (SOC) in the surface horizon and marked reduction of magnetic susceptibility (MS), soft isothermal remanent magnetization (IRM (sub s) ), and Ca, Mg, and Na elemental concentrations. Complete removal of C (sub 2) CO (sub 3) from profiles, measurable profile differentiation of free Fe oxide (Fe (sub d) ) and total Fe, clay illuviation, reduction of hard isothermal remanent magnetization IRM (sub 3) ) and net losses of elemental P and Mn occurred during the 300- to 700-yr time period. Soil clay mineral composition and Sl, Al, and K elemental concentrations showed little change in 1000 yr. The rapid changes in SOC, MS, IRMM (sub s) , Ca, Na, and Mg within 50 yr primarily resulted from anthropogenic activities, which are extrinsic thresholds. The noticeable changes in horizon differentiation of Fe (sub d) clay illuviation, and the decrease in IRM (sub h) during the 300- to 700-yr time period indicate threshold values for carbonate, which is an intrinsic threshold. In conclusion, our data demonstrate that different soil components and properties have different transformation processes and associated rates influenced by anthropogenic activities and the soil carbonate status of the original soil. JF - Soil Science Society of America Journal AU - Chen, Liumei AU - Zhang, Ganlin AU - Effland, William R Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 1807 EP - 1820 PB - Soil Science Society of America, Madison, WI VL - 75 IS - 5 SN - 0361-5995, 0361-5995 KW - silicates KW - soil dynamics KW - Far East KW - iron oxides KW - X-ray diffraction data KW - magnetization KW - magnetic properties KW - paddy soils KW - remanent magnetization KW - mass balance KW - chronosequences KW - chemical properties KW - oxides KW - ecology KW - calcium carbonate KW - Cixi China KW - chemical composition KW - Asia KW - China KW - soils KW - concentration KW - pedogenesis KW - Zhejiang China KW - soil profiles KW - micromorphology KW - isothermal remanent magnetization KW - human activity KW - agriculture KW - paleomagnetism KW - clay minerals KW - saturation KW - magnetic susceptibility KW - soil quality KW - sheet silicates KW - leaching KW - pore water KW - land use KW - soil management KW - 25:Soils UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/916840292?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Soil+Science+Society+of+America+Journal&rft.atitle=Soil+characteristic+response+times+and+pedogenic+thresholds+during+the+1000-year+evolution+of+a+paddy+soil+chronosequence&rft.au=Chen%2C+Liumei%3BZhang%2C+Ganlin%3BEffland%2C+William+R&rft.aulast=Chen&rft.aufirst=Liumei&rft.date=2011-10-01&rft.volume=75&rft.issue=5&rft.spage=1807&rft.isbn=&rft.btitle=&rft.title=Soil+Science+Society+of+America+Journal&rft.issn=03615995&rft_id=info:doi/10.2136%2Fsssaj2011.0006 L2 - http://soil.scijournals.org/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2012-01-01 N1 - Number of references - 63 N1 - PubXState - WI N1 - Document feature - illus. incl. 2 tables, sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - SSSJD4 N1 - SubjectsTermNotLitGenreText - agriculture; Asia; calcium carbonate; chemical composition; chemical properties; China; chronosequences; Cixi China; clay minerals; concentration; ecology; Far East; human activity; iron oxides; isothermal remanent magnetization; land use; leaching; magnetic properties; magnetic susceptibility; magnetization; mass balance; micromorphology; oxides; paddy soils; paleomagnetism; pedogenesis; pore water; remanent magnetization; saturation; sheet silicates; silicates; soil dynamics; soil management; soil profiles; soil quality; soils; X-ray diffraction data; Zhejiang China DO - http://dx.doi.org/10.2136/sssaj2011.0006 ER - TY - JOUR T1 - Qualitative analysis of volatile organic compounds on biochar AN - 912922837; 16001846 AB - Qualitative identification of sorbed volatile organic compounds (VOCs) on biochar was conducted by headspace thermal desorption coupled to capillary gas chromatographic-mass spectrometry. VOCs may have a mechanistic role influencing plant and microbial responses to biochar amendments, since VOCs can directly inhibit/stimulate microbial and plant processes. Over 70 biochars encompassing a variety of parent feedstocks and manufacturing processes were evaluated and were observed to possess diverse sorbed VOC composition. There were over 140 individual chemical compounds thermally desorbed from some biochars, with hydrothermal carbonization (HTC) and fast pyrolysis biochars typically possessing the greatest number of sorbed volatiles. In contrast, gasification, thermal or chemical processed biochars, soil kiln mound, and open pit biochars possessed low to non-detectable levels of VOCs. Slow pyrolysis biochars were highly variable in terms of their sorbed VOC content. There were no clear feedstock dependencies to the sorbed VOC composition, suggesting a stronger linkage with biochar production conditions coupled to post-production handling and processing. Lower pyrolytic temperatures (a[copy1/2350 degree C) produced biochars with sorbed VOCs consisting of short carbon chain aldehydes, furans and ketones; elevated temperature biochars (>350 degree C) typically were dominated by sorbed aromatic compounds and longer carbon chain hydrocarbons. The presence of oxygen during pyrolysis also reduced sorbed VOCs. These compositional results suggest that sorbed VOCs are highly variable and that their chemical dissimilarity could play a role in the wide variety of plant and soil microbial responses to biochar soil amendment noted in the literature. This variability in VOC composition may argue for VOC characterization before land application to predict possible agroecosystem effects. JF - Chemosphere AU - Spokas, Kurt A AU - Novak, Jeffrey M AU - Stewart, Catherine E AU - Cantrell, Keri B AU - Uchimiya, Minori AU - DuSaire, Martin G AU - Ro, Kyoung S AD - United States Department of Agriculture, Agricultural Research Service, Soil and Water Management Unit, Saint Paul, MN, USA, kurt.spokas@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 869 EP - 882 PB - Elsevier B.V., P.O. Box 800 Kidlington Oxford OX5 1DX United Kingdom VL - 85 IS - 5 SN - 0045-6535, 0045-6535 KW - Environment Abstracts; Meteorological & Geoastrophysical Abstracts KW - Carbon KW - Black carbon KW - Sorption KW - GRACEnet KW - Production conditions KW - Charcoal KW - Desorption KW - Temperature KW - Volatile organic compound emission from vegetation KW - Spectrometry KW - Pyrolysis KW - Soil KW - Aromatic compounds KW - Volatile organic compound emission by motor vehicles KW - soil amendment KW - Aldehydes KW - Volatile organic compounds KW - gasification KW - M2 551.510.42:Air Pollution (551.510.42) KW - ENA 15:Renewable Resources-Terrestrial UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/912922837?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Chemosphere&rft.atitle=Qualitative+analysis+of+volatile+organic+compounds+on+biochar&rft.au=Spokas%2C+Kurt+A%3BNovak%2C+Jeffrey+M%3BStewart%2C+Catherine+E%3BCantrell%2C+Keri+B%3BUchimiya%2C+Minori%3BDuSaire%2C+Martin+G%3BRo%2C+Kyoung+S&rft.aulast=Spokas&rft.aufirst=Kurt&rft.date=2011-10-01&rft.volume=85&rft.issue=5&rft.spage=869&rft.isbn=&rft.btitle=&rft.title=Chemosphere&rft.issn=00456535&rft_id=info:doi/10.1016%2Fj.chemosphere.2011.06.108 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2015-04-09 N1 - SubjectsTermNotLitGenreText - Volatile organic compound emission by motor vehicles; Volatile organic compound emission from vegetation; Spectrometry; Soil; Pyrolysis; Desorption; Aromatic compounds; soil amendment; Temperature; Aldehydes; gasification; Volatile organic compounds DO - http://dx.doi.org/10.1016/j.chemosphere.2011.06.108 ER - TY - JOUR T1 - Isolation and characterisation of the first microsatellite markers for Cyperus rotundus AN - 912919392; 15995894 AB - Arias RS, Molin WT, Ray JD, Peel MD & Scheffler BE (2011). Isolation and characterisation of the first microsatellite markers for Cyperus rotundus. Weed Research51, 451-460. This is the first report of microsatellite markers for Cyperus rotundus. A total of 191 sequence-specific microsatellite markers were isolated and used to screen 12 accessions of C.rotundus and one accession of Cyperus esculentus collected from 10 different countries. Polymorphisms were observed in 49% of the markers tested, 22% of the markers were monomorphic and 29% had weak or no amplification. The best 57 markers are reported, and cluster analysis was used to analyse their resolving power. BLASTx screening of the contig sequences was also performed. Multiallelic loci over all samples ranged from 24% to 60%. The maximum number of alleles detected by the markers suggests a polyploidy nature of all C. rotundus accessions tested, except for the sample N25-Brazil. Chromosome number was determined for N12-Taiwan and used as an internal flow cytometry standard to estimate the amount of DNA within haploid nuclei of the remaining material. Chromosome numbers estimated for C. rotundus were 16 and 24. The markers identified in this study can be used for the identification of biotypes and detection of potential crosses of C. rotundus, to implement management practices for the effective control of this weed. JF - Weed Research AU - Arias, R S AU - Molin, W T AU - Ray, J D AU - Peel, M D AU - Scheffler, B E AD - Genomics and Bioinformatics Research Unit, USDA-ARS, Stoneville, MS, USA Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 451 EP - 460 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 51 IS - 5 SN - 0043-1737, 0043-1737 KW - Sustainability Science Abstracts KW - Chromosomes KW - DNA KW - biotypes KW - weeds KW - Cyperus esculentus KW - Cyperus rotundus KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/912919392?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Weed+Research&rft.atitle=Isolation+and+characterisation+of+the+first+microsatellite+markers+for+Cyperus+rotundus&rft.au=Arias%2C+R+S%3BMolin%2C+W+T%3BRay%2C+J+D%3BPeel%2C+M+D%3BScheffler%2C+B+E&rft.aulast=Arias&rft.aufirst=R&rft.date=2011-10-01&rft.volume=51&rft.issue=5&rft.spage=451&rft.isbn=&rft.btitle=&rft.title=Weed+Research&rft.issn=00431737&rft_id=info:doi/10.1111%2Fj.1365-3180.2011.00861.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Document feature - figure 1 N1 - Last updated - 2012-06-18 N1 - SubjectsTermNotLitGenreText - Chromosomes; DNA; weeds; biotypes; Cyperus rotundus; Cyperus esculentus DO - http://dx.doi.org/10.1111/j.1365-3180.2011.00861.x ER - TY - JOUR T1 - Distribution of canker lesions on the surface of diseased grapefruit AN - 911166320; 15995566 AB - The objective of this study was to describe and quantify the distribution of citrus canker lesions (caused by Xanthomonas citri subsp. citri) on the surface of grapefruits, and provide evidence for splash-driven infection of fruit. Based on fruit diameter, each fruit was sliced in four by taking three horizontal planes across the vertical axis such that each horizontal zone (Z1-Z4, from peduncle to flower scar) had the same vertical height. Each zone had equal surface area. Lesion number was counted on each zone of the fruit. Although lesion number among fruits was variable, both lesion number and percentage of total lesions showed a decline from the uppermost zone (lesion number: 10.5, 7.0, 3.4 and 2.4; percentage: 44.6, 30.5, 14.4 and 10.5 on Z1-Z4, respectively). General linear modelling (GLM) using a Poisson distribution with a log-link function demonstrated a significant effect of zone and cultivar on lesion number, and significant differences between all zones and both cultivars. An analysis of covariance showed no effect of lesion number on fruit size, although cultivars differed in total lesion count. Canker-susceptible citrus fruit is susceptible for a prolonged period after fruit set and minimizing inoculum and reducing wind speed and splash, and use of copper sprays during that period, will help reduce disease on fruit, particularly on the upper surfaces that appear to be more prone to infection. JF - Plant Pathology AU - Bock, CH AU - Gottwald, T R AU - Parker, P E AD - SEFTNRL-USDA-ARS, 21 Dunbar Road, Byron, GA 31008 Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 986 EP - 991 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 60 IS - 5 SN - 0032-0862, 0032-0862 KW - Microbiology Abstracts A: Industrial & Applied Microbiology KW - Canker KW - Copper KW - Flowers KW - Fruit set KW - Fruits KW - Infection KW - Inoculum KW - Surface area KW - Wind KW - Citrus KW - Xanthomonas KW - A 01360:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911166320?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Plant+Pathology&rft.atitle=Distribution+of+canker+lesions+on+the+surface+of+diseased+grapefruit&rft.au=Bock%2C+CH%3BGottwald%2C+T+R%3BParker%2C+P+E&rft.aulast=Bock&rft.aufirst=CH&rft.date=2011-10-01&rft.volume=60&rft.issue=5&rft.spage=986&rft.isbn=&rft.btitle=&rft.title=Plant+Pathology&rft.issn=00320862&rft_id=info:doi/10.1111%2Fj.1365-3059.2011.02444.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Document feature - figure 2 N1 - Last updated - 2012-06-18 N1 - SubjectsTermNotLitGenreText - Canker; Fruits; Flowers; Fruit set; Surface area; Inoculum; Copper; Infection; Wind; Citrus; Xanthomonas DO - http://dx.doi.org/10.1111/j.1365-3059.2011.02444.x ER - TY - JOUR T1 - Development of a Real-time RT-PCR Assay for Squash Mosaic Virus Useful for Broad Spectrum Detection of Various Serotypes and its Incorporation into a Multiplex Seed Health Assay AN - 911161592; 15994518 AB - Seed-borne pathogens pose a serious threat to modern agricultural cropping systems, as they can be disseminated to many geographical regions around the world. With trends of increasing global seed production and trade, seed-health testing is an important quality control step to prevent the introduction of harmful pathogens into agricultural production systems. An effective seed-health assay depends on a test that can provide timely, sensitive and broad-spectrum detection of all genetic variants of a pathogen, or in some cases, of several different pathogens. Previously, we developed a real-time PCR (qPCR) assay that would permit the simultaneous detection of two major seed-borne pathogens of cucurbits, the bacterium Acidovorax avenae subsp. citrulli (AAC, the causal agent of bacterial fruit blotch) and a fungus Didymella bryoniae (DB, the causal agent of gummy stem blight). The objective of the present study was to develop a sensitive, reverse transcriptase (RT)-based, qRT-PCR for broad spectrum detection of both serotypes of Squash mosaic virus (SqMV), that could be incorporated into a simultaneous detection of three pathogen types in a single PCR reaction. Converting SqMV RNA to cDNA prior to multiplexing stabilized the viral template that was then mixed with two other DNA templates (AAC and DB). To facilitate seed health testing, a generic plant nucleic acid extraction method was developed for cucurbit seeds. Using this method, nucleic acids extracted from seeds yielded strong signals for each target pathogen in multiplex qPCR. The ability to use a general nucleic acid extraction technique with subsequent PCR to detect bacterial, fungal and viral plant pathogens lends itself to a universal system for cucurbit seed health testing. JF - Journal of Phytopathology AU - Ling, Kai-Shu AU - Wechter, WPatrick AU - Walcott, Ronald R AU - Keinath, Anthony P AD - Authors' addresses: U.S. Vegetable Laboratory, United States Department of Agriculture-Agricultural Research Service, 2700 Savannah Highway, Charleston, SC 29414, USA Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 649 EP - 656 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 159 IS - 10 SN - 0931-1785, 0931-1785 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts C: Algology, Mycology & Protozoology; Virology & AIDS Abstracts KW - Blotch KW - Acidovorax KW - Pathogens KW - A 01360:Plant Diseases KW - V 22420:Plant Diseases KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911161592?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Phytopathology&rft.atitle=Development+of+a+Real-time+RT-PCR+Assay+for+Squash+Mosaic+Virus+Useful+for+Broad+Spectrum+Detection+of+Various+Serotypes+and+its+Incorporation+into+a+Multiplex+Seed+Health+Assay&rft.au=Ling%2C+Kai-Shu%3BWechter%2C+WPatrick%3BWalcott%2C+Ronald+R%3BKeinath%2C+Anthony+P&rft.aulast=Ling&rft.aufirst=Kai-Shu&rft.date=2011-10-01&rft.volume=159&rft.issue=10&rft.spage=649&rft.isbn=&rft.btitle=&rft.title=Journal+of+Phytopathology&rft.issn=09311785&rft_id=info:doi/10.1111%2Fj.1439-0434.2011.01814.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Document feature - figure 2 N1 - Last updated - 2014-03-20 N1 - SubjectsTermNotLitGenreText - Pathogens; Acidovorax DO - http://dx.doi.org/10.1111/j.1439-0434.2011.01814.x ER - TY - JOUR T1 - Selective inhibition of Erwinia amylovora by the herbicidally active germination-arrest factor (GAF) produced by Pseudomonas bacteria AN - 911150830; 15993869 AB - Aims: The germination-arrest factor (GAF) produced by Pseudomonas fluorescens WH6, and identified as 4-formylaminooxyvinylglycine, specifically inhibits the germination of a wide range of grassy weeds. This study was undertaken to determine whether GAF has antimicrobial activity in addition to its inhibitory effects on grass seed germination. Methods and Results: Culture filtrate from Ps. fluorescens WH6 had little or no effect on 17 species of bacteria grown in Petri dish lawns, but the in vitro growth of Erwinia amylovora, the causal agent of the disease of orchard crops known as fire blight, was strongly inhibited by the filtrate. The anti-Erwinia activity of WH6 culture filtrate was shown to be due to its GAF content, and a commercially available oxyvinylglycine, 4-aminoethoxyvinylglycine (AVG), exhibited anti-Erwinia activity similar to that of GAF. The effects of GAF on Erwinia were reversed by particular amino acids. Conclusions: The biological properties of GAF include a rather specific antimicrobial activity against Erw. amylovora. This may be a general property of oxyvinylglycines as AVG exhibited similar activity. The ability of particular amino acids to reverse GAF inhibition is consistent with a potential effect of this compound on the activity of aminotransferases. Significance and Impact of the Study: The results presented here demonstrate a novel antimicrobial activity of oxyvinylglycines and suggest that GAF and/or GAF-producing bacteria may have potential for the control of fire blight. JF - Journal of Applied Microbiology AU - Halgren, A AU - Azevedo, M AU - Mills, D AU - Armstrong, D AU - Thimmaiah, M AU - McPhail, K AU - Banowetz, G AD - USDA-ARS National Forage Seed Production Research Center, Corvallis, OR, USA Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 949 EP - 959 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 111 IS - 4 SN - 1364-5072, 1364-5072 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Microbiology Abstracts B: Bacteriology KW - Germination KW - Fires KW - Weeds KW - Antimicrobial activity KW - Amino acids KW - Grasses KW - Pseudomonas KW - Orchards KW - Crops KW - Pseudomonas fluorescens KW - Blight KW - Seed germination KW - Erwinia KW - Erwinia amylovora KW - A 01380:Plant Protection, Fungicides & Seed Treatments KW - J 02320:Cell Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911150830?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Applied+Microbiology&rft.atitle=Selective+inhibition+of+Erwinia+amylovora+by+the+herbicidally+active+germination-arrest+factor+%28GAF%29+produced+by+Pseudomonas+bacteria&rft.au=Halgren%2C+A%3BAzevedo%2C+M%3BMills%2C+D%3BArmstrong%2C+D%3BThimmaiah%2C+M%3BMcPhail%2C+K%3BBanowetz%2C+G&rft.aulast=Halgren&rft.aufirst=A&rft.date=2011-10-01&rft.volume=111&rft.issue=4&rft.spage=949&rft.isbn=&rft.btitle=&rft.title=Journal+of+Applied+Microbiology&rft.issn=13645072&rft_id=info:doi/10.1111%2Fj.1365-2672.2011.05098.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Document feature - figure 4 N1 - Last updated - 2016-03-30 N1 - SubjectsTermNotLitGenreText - Germination; Weeds; Fires; Antimicrobial activity; Amino acids; Grasses; Blight; Seed germination; Orchards; Crops; Pseudomonas fluorescens; Pseudomonas; Erwinia; Erwinia amylovora DO - http://dx.doi.org/10.1111/j.1365-2672.2011.05098.x ER - TY - JOUR T1 - Long-term preservation of anammox bacteria AN - 910790706; 15714287 AB - Deposit of useful microorganisms in culture collections requires long-term preservation and successful reactivation techniques. The goal of this study was to develop a simple preservation protocol for the long-term storage and reactivation of the anammox biomass. To achieve this, anammox biomass was frozen or lyophilized at two different freezing temperatures (-60 degree C and in liquid nitrogen (-200 degree C)) in skim milk media (with and without glycerol), and the reactivation of anammox activity was monitored after a 4-month storage period. Of the different preservation treatments tested, only anammox biomass preserved via freezing in liquid nitrogen followed by lyophilization in skim milk media without glycerol achieved stoichiometric ratios for the anammox reaction similar to the biomass in both the parent bioreactor and in the freshly harvested control treatment. A freezing temperature of -60 degree C alone, or in conjunction with lyophilization, resulted in the partial recovery of the anammox bacteria, with an equal mixture of anammox and nitrifying bacteria in the reactivated biomass. To our knowledge, this is the first report of the successful reactivation of anammox biomass preserved via sub-zero freezing and/or lyophilization. The simple preservation protocol developed from this study could be beneficial to accelerate the integration of anammox-based processes into current treatment systems through a highly efficient starting anammox biomass. JF - Applied Microbiology and Biotechnology AU - Rothrock, Michael J AU - Vanotti, Matias B AU - Szögi, Ariel A AU - Gonzalez, Maria Cruz Garcia AU - Fujii, Takao AD - USDA-ARS New England Plant, Soil, & Water Laboratory, Orono, ME, 04469, USA, michael.rothrock@ars.usda.gov michael.rothrock@ars.usda.gov michael.rothrock@ars.usda.gov michael.rothrock@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 147 EP - 157 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 92 IS - 1 SN - 0175-7598, 0175-7598 KW - Microbiology Abstracts B: Bacteriology; Microbiology Abstracts A: Industrial & Applied Microbiology; Biotechnology and Bioengineering Abstracts KW - Biomass KW - J:02300 KW - A:01360 KW - W 30950:Waste Treatment & Pollution Clean-up UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/910790706?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Microbiology+and+Biotechnology&rft.atitle=Long-term+preservation+of+anammox+bacteria&rft.au=Rothrock%2C+Michael+J%3BVanotti%2C+Matias+B%3BSz%26amp%3Boumlgi%2C+Ariel+A%3BGonzalez%2C+Maria+Cruz+Garcia%3BFujii%2C+Takao&rft.aulast=Rothrock&rft.aufirst=Michael&rft.date=2011-10-01&rft.volume=92&rft.issue=1&rft.spage=147&rft.isbn=&rft.btitle=&rft.title=Applied+Microbiology+and+Biotechnology&rft.issn=01757598&rft_id=info:doi/10.1007%2Fs00253-011-3316-1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Biomass DO - http://dx.doi.org/10.1007/s00253-011-3316-1 ER - TY - JOUR T1 - Assessing phytoremediation potentials of selected tropical plants for acrylamide AN - 910652865; 15714402 AB - Purpose: Environmentally hazardous and health risk substances in animals and humans in the environment have increased as a result of continuing anthropogenic activities. Examples of these activities are food processing, laboratory, food production, industrial, and other relative activities that use various forms of acrylamide. All acrylamide in the environment are manmade. It is the building block for the polymer, polyacrylamide, which is considered to be a nontoxic additive. However, if the polymerization process is not perfect and complete, the polyacrylamide may still contain acrylamide which is toxic and may pose risks and hazards to the environment. Another form of acrylamide that may pose danger as well in the environment is the acrylamide monomer, which is also a very toxic organic substance that could affect the central nervous system of humans and is likely to be carcinogenic. Phytoremediation could be a tool to somehow absorb this neurotoxic agent and lessen the contamination in the soil. This technology could lessen the soil and water contamination by acrylamide thereby limiting the exposure of animals and humans. This study may also help solve the problem of disposing contaminated acrylamide waste materials. This study was conducted to achieve the following objectives: (1) to evaluate phytoremediation potentials of some selected tropical plants in acrylamide-contaminated soil, (2) to compare the performance of tropical plants in absorbing acrylamide through accumulation in their roots and shoots, and (3) to determine the outcome of acrylamide in the soil after treatment using the test plants with phytoremediation potentials. Materials and methods: Soil was collected from 40 sampling points (2,000 g of soil per sampling points) in a half-hectare rice field in the Philippine Rice Research Institute, Central Experiment Station, Science City of Munoz, Nueva Ecija, Philippines. This study used Mustard (Brassica juncea L.), petchay (Brassica chinensis L.), vetiver grass (Vetiveria zizanioides L.), hog weeds (Portulaca oleracea L.), snake plant (Sanseviera trifasciata Prain), and common sword fern (Nephrolepsis cordifolia L.). These plants were selected to determine their capability of removing acrylamide residues from soil with unstable polyacrylamide gel. Analysis of acrylamide concentrations in soil and plant parts were done using a gas chromatograph equipped with flame ionization detector at the Training, Research and Development, Adamson University, Manila. This study was laid out using the completely randomized design with three replications. Data were analyzed with a one-way ANOVA using PROC GLM. Duncan's multiple range test (p less than or equal to 0.05) was followed for the mean treatment separation and comparison. Results and discussion: Among the plants tested, the highest concentration of acrylamide was absorbed by the whole plant of mustard (6,512.8 mg kg super(-1)) compared with pechay (3,482.7 mg kg super(-1)), fern (2,015.4 mg kg super(-1)), hogweeds (1,805.3 mg kg super(-1)), vetiver grass (1,385.4 mg kg super(-1)), and snake plants (887.5 mg kg super(-1)). Results of the study regarding the acrylamide absorption of the whole plants of mustard and pechay conformed to previous findings of other studies. Two members of the Brassica family, B. juncea L. (mustard) and B. chinensis L. (pechay) were found to be effective in removing wide ranges of contaminants. Likewise, mustard obtained the highest acrylamide concentrations (mg kg super(-1)) in the roots (2,372.9) and shoots (4,081.1) among the six test plants. Earlier studies showed the capability of mustard in absorbing metals. Mustard plant is known to remove large quantities of chromium, lead, copper, and nickel in soil and ethidium bromide in soil. This could be attributed to its well-developed root system. Plants with active growth of roots in soils bring more contact with the fresh areas of the soil and ions, thus, creating more likelihood of further absorption and uptake. Moreover, mustard, pechay, and fern plants had 60% survival rate while hogweeds had 80% survival rate. Snake plant and vetiver grass had 100% survival rate. All the test plants planted in soil without acrylamide had survival rate of 100%. The 100% survival rate of vetiver grass and snake plant was due to the tolerance of these plants to acrylamide. Among the six test plants, vetiver grass and snake plant had the greatest uptake of acrylamide from the soil (30.6 kg ha super(-1)) and (29.4 kg ha super(-1)), respectively. These plants exhibited great number and longer roots which are characteristics of excellent phytoremediator plants. Thus, vetiver grass can absorb more acrylamide due to its root's growth characteristics. These findings could be attributed to the extraordinary features of vetiver grass such as its massive and deep root system and heavy biomass including its high tolerance to extreme soil conditions like heavy metal toxicities and high metal concentration. Conclusions: Results of our study proved that all the test plants are potential phytoremediators of acrylamide. However, mustard and pechay were the most effective as they absorbed the highest acrylamide concentrations in their roots, shoots, and the whole plants. On the other hand, vetiver grass and snake plant had the highest uptake of acrylamide even though these plants did not absorb the highest acrylamide concentration. Therefore, these two plants can be considered as the best phytoremediator of acrylamide because they are perennial plants with heavier biomass with long, dense and extended root system. As such, these plants are capable of absorbing acrylamide in the soil for a long period of time. As preventive measures and for application purposes, vetiver grass and snake plants could be planted along and around the wastewater treatment ponds of laboratories using polyacrylamide gel. These plants can prevent further migration of pollutants to the environment aside from making the ponds more resistant to soil erosion. Further studies are suggested to evaluate acrylamide contaminations from laboratory washing, primary treatment pond, and seepage ponds that have earth dikes. Vetiver grass and snake plants are recommended for further phytoremediation studies for longer period of time to test the reduction of acrylamide in soil. Moreover, the outcome of acrylamide accumulation in the plants is also recommended for further study in conjunction with labeled-carbon tracer to determine its effects on the plants. JF - Journal of Soils and Sediments AU - Paz-Alberto, Annie Melinda AU - Dios, MaJohanna J AU - Alberto, Ronaldo T AU - Sigua, Gilbert C AD - Environmental Management Institute and Environmental Management Department, Institute of Graduate Studies, Central Luzon State University, Science City of Munoz, Nueva Ecija, 3120, Philippines, gilbert.sigua@ars.usda.gov gilbert.sigua@ars.usda.gov gilbert.sigua@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 1190 EP - 1198 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 11 IS - 7 SN - 1439-0108, 1439-0108 KW - Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; ASFA 1: Biological Sciences & Living Resources; Toxicology Abstracts; Biotechnology and Bioengineering Abstracts KW - Vetiveria zizanioides KW - Food processing KW - Weeds KW - Bioremediation KW - Polymerization KW - Contamination KW - Grasses KW - Heavy metals KW - Survival KW - Roots KW - Copper KW - Ponds KW - Brassica juncea KW - Soil KW - Hazards KW - Brassica chinensis KW - Tracers KW - Growth KW - ISEW, Philippines KW - Soils KW - Philippines, Luzon I., Nueva Ecija, Munoz KW - Portulaca oleracea KW - Absorption KW - Sampling KW - phytoremediation KW - Ions KW - Soil Contamination KW - Oryza sativa KW - Toxicity KW - Biomass KW - Food contamination KW - Inland water environment KW - Philippines, Luzon I., Manila KW - Soil pollution KW - Shoots KW - Ferns KW - Acrylamide KW - Water Pollution Effects KW - Neurotoxicity KW - Q2 09102:Institutes and organizations KW - W 30950:Waste Treatment & Pollution Clean-up KW - Q1 08626:Food technology KW - SW 0810:General KW - X 24320:Food Additives & Contaminants UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/910652865?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soils+and+Sediments&rft.atitle=Assessing+phytoremediation+potentials+of+selected+tropical+plants+for+acrylamide&rft.au=Paz-Alberto%2C+Annie+Melinda%3BDios%2C+MaJohanna+J%3BAlberto%2C+Ronaldo+T%3BSigua%2C+Gilbert+C&rft.aulast=Paz-Alberto&rft.aufirst=Annie&rft.date=2011-10-01&rft.volume=11&rft.issue=7&rft.spage=1190&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soils+and+Sediments&rft.issn=14390108&rft_id=info:doi/10.1007%2Fs11368-011-0390-z LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2016-09-29 N1 - SubjectsTermNotLitGenreText - Hazards; Growth; Polymerization; Bioremediation; Contamination; Heavy metals; Soils; Roots; Inland water environment; Ponds; Food processing; Weeds; Ions; Grasses; Survival; Copper; Food contamination; Biomass; Soil; Shoots; Soil pollution; Tracers; Acrylamide; Neurotoxicity; Sampling; phytoremediation; Ferns; Soil Contamination; Water Pollution Effects; Absorption; Toxicity; Vetiveria zizanioides; Brassica juncea; Brassica chinensis; Portulaca oleracea; Oryza sativa; ISEW, Philippines; Philippines, Luzon I., Nueva Ecija, Munoz; Philippines, Luzon I., Manila DO - http://dx.doi.org/10.1007/s11368-011-0390-z ER - TY - JOUR T1 - Combining hygrothermal and corrosion models to predict corrosion of metal fasteners embedded in wood AN - 907931905; 15161799 AB - A combined heat, moisture, and corrosion model is presented and used to simulate the corrosion of metal fasteners embedded in solid wood exposed to the exterior environment. First, the moisture content and temperature at the wood/fastener interface is determined at each time step. Then, the amount of corrosion is determined spatially using an empirical corrosion rate model and the inputs of the first step. The result is a corrosion profile along the length of the fastener generated by summing the corrosion depths determined at each time step. We apply the combined model to predict the annual corrosion depth along a metal fastener in wood decks situated in nine different US cities. Corrosion profiles are found to exhibit the same general shape independently of climatic load, with the largest amount of corrosion occurring at 1-5 mm from the wood surface with corrosion depths ranging from 5 mu m in Phoenix, Arizona to 45 mu m in Hilo, Hawaii. Corrosion is confined to the first 7-20 mm of the fastener below the wood surface. By varying the climatic loads, we find that although there is a definite relation between total annual rain and total annual corrosion, under the same rain loads corrosion is higher for a climate with more evenly distributed rain events. The proposed combined model is able to capture corrosion behavior under varying loading. A sensitivity analysis gives guidelines for future corrosion modeling work for fasteners in wood. JF - Building and Environment AU - Zelinka, Samuel L AU - Derome, Dominique AU - Glass, Samuel V AD - USDA Forest Products Laboratory, One Gifford Pinchot Drive, Madison, WI 53726, USA Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 2060 EP - 2068 PB - Elsevier B.V., P.O. Box 800 Kidlington Oxford OX5 1DX United Kingdom VL - 46 IS - 10 SN - 0360-1323, 0360-1323 KW - Environment Abstracts KW - Corrosion KW - Hygrothermal modeling KW - Decks KW - Wood preservatives KW - Metals KW - USA, Hawaii KW - Climate KW - Temperature KW - Wood KW - guidelines KW - sensitivity analysis KW - USA, Arizona KW - USA, Hawaii, Hawaii I., Hilo KW - USA, Arizona, Phoenix KW - Urban areas KW - ENA 19:Water Pollution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907931905?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvabstractsmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Building+and+Environment&rft.atitle=Combining+hygrothermal+and+corrosion+models+to+predict+corrosion+of+metal+fasteners+embedded+in+wood&rft.au=Zelinka%2C+Samuel+L%3BDerome%2C+Dominique%3BGlass%2C+Samuel+V&rft.aulast=Zelinka&rft.aufirst=Samuel&rft.date=2011-10-01&rft.volume=46&rft.issue=10&rft.spage=2060&rft.isbn=&rft.btitle=&rft.title=Building+and+Environment&rft.issn=03601323&rft_id=info:doi/10.1016%2Fj.buildenv.2011.04.017 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-01-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Metals; guidelines; sensitivity analysis; Climate; Temperature; Corrosion; Wood; Urban areas; USA, Hawaii; USA, Arizona; USA, Hawaii, Hawaii I., Hilo; USA, Arizona, Phoenix DO - http://dx.doi.org/10.1016/j.buildenv.2011.04.017 ER - TY - JOUR T1 - Structure of the has Operon Promoter and the Effect of Mutations on the has Promoter Strength in Streptococcus equi subsp. zooepidemicus AN - 904491271; 15714779 AB - The purpose of this study is to determine the effect of the corresponding nucleotides from Streptococcus pyogenes on the has promoter strength in highly encapsulated strain S. equi subsp. zooepidemicus (SEZ) and detect an empowering mutations in SEZ. Eight different strains of SEZ carrying nucleotide mutations in the -73 to -38 region upstream of the has promoter were constructed. The significant activity decrease to 36-1% was observed after the introduction of mutations in the promoter region from -44 to -38 site. The exception was observed in mutation in -49 site when no significant decrease was observed. When nucleotides TTT were used in positions -73 the promoter became weaker, whereas no significant effect was observed after using nucleotides CCC (96%). Unfortunately, introduction of these mutations into chromosome SEZ has no empowering effect. Six strains, which carried nucleotide sequences of different lengths upstream from the transcription start of hasA promoter, were constructed to determine the minimum upstream region required for the maximum transcription efficiency of the has operon. No change of the activity of the has promoter constructs containing as few as 101 nucleotides upstream from the transcription start point was observed. JF - Molecular Biotechnology AU - Krahulec, Jan AU - Tlusta, Marcela AU - Stuchlik, Stanislav AU - Tura, Jan AD - CPN spol. s r.o., Dolni Dobrouc 401, Czech Republic, krahulec@fns.uniba.sk krahulec@fns.uniba.sk krahulec@fns.uniba.sk Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 166 EP - 175 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 49 IS - 2 SN - 1073-6085, 1073-6085 KW - Biochemistry Abstracts 2: Nucleic Acids; Microbiology Abstracts B: Bacteriology; Biotechnology and Bioengineering Abstracts KW - Chromosomes KW - Mutation KW - Nucleotides KW - Operons KW - Promoters KW - Transcription KW - Streptococcus equi KW - Streptococcus pyogenes KW - J 02310:Genetics & Taxonomy KW - N 14830:RNA KW - W 30965:Miscellaneous, Reviews UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/904491271?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Molecular+Biotechnology&rft.atitle=Structure+of+the+has+Operon+Promoter+and+the+Effect+of+Mutations+on+the+has+Promoter+Strength+in+Streptococcus+equi+subsp.+zooepidemicus&rft.au=Krahulec%2C+Jan%3BTlusta%2C+Marcela%3BStuchlik%2C+Stanislav%3BTura%2C+Jan&rft.aulast=Krahulec&rft.aufirst=Jan&rft.date=2011-10-01&rft.volume=49&rft.issue=2&rft.spage=166&rft.isbn=&rft.btitle=&rft.title=Molecular+Biotechnology&rft.issn=10736085&rft_id=info:doi/10.1007%2Fs12033-011-9388-4 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2012-08-10 N1 - SubjectsTermNotLitGenreText - Promoters; Chromosomes; Transcription; Operons; Mutation; Nucleotides; Streptococcus equi; Streptococcus pyogenes DO - http://dx.doi.org/10.1007/s12033-011-9388-4 ER - TY - JOUR T1 - Reproductive ecology of predaceous Heteroptera AN - 904478694; 15913779 AB - Reproductive ecology entails relating the physiology and behavior of an organism to its environment and the community in which it lives. Terrestrial predatory Heteroptera (including Anthocoridae, Geocoridae, Miridae, Nabidae, Pentatomidae, Phymatidae, and Reduviidae) display a wide range of reproductive ecologies. But in spite of this variability, a review of the literature reveals certain underlying trends that are useful in understanding how generalist predators function within their environments. First, the reproductive ecology of predatory bugs is inherently coupled to the physiology of the female and her eggs. Second, three population parameters are directly tied to reproduction (maturation rates, realized fecundity, and reproductive diapause) have great bearing on the rate of population increase and reproductive success of a predatory bug, but these three parameters fluctuate widely within and among species. The variables that affect these processes include the physiological status of the mother (mating status, age and size, and nutritional status), the abiotic environment in which she and her eggs live (temperature, photoperiod, water availability), and natural enemies that attack eggs and reproductive females. A final trend observed in the literature involves the hierarchy of events that must occur before a female finds a suitable oviposition site. Females all must locate preferred habitats, plants/substrates, and microsites in which to insert or deposit an egg, but they use a variety of tactics and cues in order to accomplish this, depending on their life history traits. Examining the factors that constrain and promote the reproductive potential of predatory Heteroptera will make biological control programs that center on them more reliable and sustainable. JF - Biological Control AU - Lundgren, Jonathan G AD - USDA-ARS, North Central Agricultural Research Laboratory, 2923 Medary Avenue, Brookings, SD 57006, USA, Jonathan.Lundgren@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 37 EP - 52 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 59 IS - 1 SN - 1049-9644, 1049-9644 KW - ASFA 1: Biological Sciences & Living Resources; Entomology Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Biological control KW - Age KW - Natural enemies KW - Photoperiods KW - Phymatidae KW - Predators KW - Miridae KW - Pentatomidae KW - Reduviidae KW - Water availability KW - Nutrition KW - Eggs KW - Mating KW - Substrate preferences KW - Reproductive behaviour KW - Diapause KW - Geocoridae KW - Nutritional status KW - Deposits KW - Nabidae KW - Water temperature KW - Spawning KW - Habitat KW - Hemiptera KW - Life history KW - Fecundity KW - Reviews KW - Reproduction KW - Anthocoridae KW - Oviposition KW - Breeding success KW - A 01370:Biological Control KW - Q1 08423:Behaviour KW - Z 05330:Reproduction and Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/904478694?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biological+Control&rft.atitle=Reproductive+ecology+of+predaceous+Heteroptera&rft.au=Lundgren%2C+Jonathan+G&rft.aulast=Lundgren&rft.aufirst=Jonathan&rft.date=2011-10-01&rft.volume=59&rft.issue=1&rft.spage=37&rft.isbn=&rft.btitle=&rft.title=Biological+Control&rft.issn=10499644&rft_id=info:doi/10.1016%2Fj.biocontrol.2011.02.009 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Biological control; Fecundity; Substrate preferences; Photoperiods; Reproduction; Reproductive behaviour; Spawning; Diapause; Nutrition; Nutritional status; Deposits; Age; Natural enemies; Predators; Water temperature; Habitat; Water availability; Eggs; Mating; Life history; Reviews; Oviposition; Breeding success; Nabidae; Phymatidae; Miridae; Anthocoridae; Pentatomidae; Reduviidae; Geocoridae; Hemiptera DO - http://dx.doi.org/10.1016/j.biocontrol.2011.02.009 ER - TY - JOUR T1 - Colonization of Citrus Seed Coats by 'Candidates Liberibacter asiaticus': Implications for Seed Transmission of the Bacterium AN - 902368161; 15892302 AB - Huanglongbing is an economically damaging disease of citrus associated with infection by 'Candidatus Liberibacter asiaticus'. Transmission of the organism via infection of seeds has not been demonstrated but is a concern since some citrus varieties, particularly those used as rootstocks in commercial plantings are propagated from seed. We compared the incidence of detection of 'Ca. Liberibacter asiaticus' DNA in individual fruit peduncles, seed coats, seeds, and in germinated seedlings from 'Sanguenelli' sweet orange and 'Conners' grapefruit fruits sampled from infected trees. Using real-time quantitative PCR (qPCR) we detected pathogen DNA in nucleic acid extracts of 36 and 100% of peduncles from 'Sanguenelli' and from 'Conners' fruits, respectively. We also detected pathogen DNA in extracts of 37 and 98% of seed coats and in 1.6 and 4% of extracts from the corresponding seeds of 'Sanguenelli' and 'Conners', respectively. Small amounts of pathogen DNA were detected in 10% of 'Sanguenelli' seedlings grown in the greenhouse, but in none of 204 extracts from 'Conners' seedlings. Pathogen DNA was detected in 4.9% and in 89% of seed coats peeled from seeds of 'Sanguenelli' and 'Conners' which were germinated on agar, and in 5% of 'Sanguenelli' but in none of 164 'Conners' seedlings which grew from these seeds on agar. No pathogen DNA was detected in 'Ridge Pineapple' tissue at 3 months post-grafting onto 'Sanguenelli' seedlings, even when pathogen DNA had been detected initially in the 'Sanguenelli' seedling. Though the apparent colonization of 'Conners' seeds was more extensive and nearly uniform compared with 'Sanguenelli' seeds, no pathogen DNA was detected in 'Conners' seedlings grown from these seeds. For either variety, no association was established between the presence of pathogen DNA in fruit peduncles and seed coats and in seedlings. JF - Phytopathology AU - Hilf, ME AD - U.S. Department of Agriculture, Agricultural Research Service, United States Horticultural Research Laboratory, 2001 South Rock Road, Fort Pierce, FL 34945, USA, mark.hilf@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 1242 EP - 1250 VL - 101 IS - 10 SN - 0031-949X, 0031-949X KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Citrus KW - Bacteria KW - Fruits KW - Agar KW - Seeds KW - Trees KW - Rootstocks KW - Pathogens KW - Infection KW - Greenhouses KW - Citrus sinensis KW - Colonization KW - nucleic acids KW - Polymerase chain reaction KW - Seedlings KW - A 01360:Plant Diseases KW - K 03310:Genetics & Taxonomy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902368161?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Phytopathology&rft.atitle=Colonization+of+Citrus+Seed+Coats+by+%27Candidates+Liberibacter+asiaticus%27%3A+Implications+for+Seed+Transmission+of+the+Bacterium&rft.au=Hilf%2C+ME&rft.aulast=Hilf&rft.aufirst=ME&rft.date=2011-10-01&rft.volume=101&rft.issue=10&rft.spage=1242&rft.isbn=&rft.btitle=&rft.title=Phytopathology&rft.issn=0031949X&rft_id=info:doi/10.1094%2FPHYTO-11-10-0323 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Agar; Colonization; Fruits; Seeds; nucleic acids; Trees; Rootstocks; Polymerase chain reaction; Seedlings; Pathogens; Infection; Greenhouses; Citrus; Citrus sinensis; Bacteria DO - http://dx.doi.org/10.1094/PHYTO-11-10-0323 ER - TY - JOUR T1 - Antibiosis Activity of Pantoea agglomerans Biocontrol Strain E325 Against Erwinia amylovora on Apple Flower Stigmas AN - 902368150; 15892301 AB - Pantoea agglomerans E325, the active ingredient in a commercial product for fire blight control, was previously shown in vitro to produce a unique alkaline- and phosphate-sensitive antibiotic specific to Erwinia amylovora. Antibiosis was evaluated as a mode of antagonism on flower stigmas using two antibiosis-deficient mutants. On King's medium B, mutants E325ad1 and E325ad2 have stable smooth-butyrous or hypermucoid colony morphologies, respectively, and the parental strain E325 exhibits phenotypic plasticity with predominantly hypermucoid colonies accompanied by slower-growing, smooth-butyrous colonies. Mutants were tested against E. amylovora on stigmas of detached flowers of crab apple (Malus mandshurica) in growth chambers and apple (Malm domestica) in the orchard. Epiphytic fitness of the antibiosis-negative mutants was similar or greater than the parental strain as determined by relative area under the population curve (RAUPC). In laboratory and orchard trials, both mutants had significantly lower inhibitory activity against the pathogen (i.e., less reduction of E. amylovora RAUPC) compared with the parental strain. E325 and the mutants caused similar decreases in pH in a broth medium, indicating that acidification, which was previously reported as a possible mechanism of pathogen inhibition on stigmas, is not directly related to antibiosis. In this study we provide the first evidence for E325 antibiosis involved in E. amylovora growth suppression on apple flower stigmas. JF - Phytopathology AU - Pusey, P L AU - Stockwell, VO AU - Reardon, CL AU - Smits, THM AU - Duffy, B AD - U.S. Department of Agriculture, Agricultural Research Service, Tree Fruit Research Laboratory, Wenatchee, WA 98801, USA, Larry.Pusey@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 1234 EP - 1241 VL - 101 IS - 10 SN - 0031-949X, 0031-949X KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Microbiology Abstracts B: Bacteriology; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Fitness KW - Biological control KW - Fires KW - Flowers KW - Pantoea agglomerans KW - phenotypic plasticity KW - Antibiosis KW - Antibiotics KW - Pathogens KW - Antagonism KW - Orchards KW - Stigma KW - Colonies KW - Blight KW - Malus KW - Acidification KW - Erwinia amylovora KW - pH effects KW - A 01360:Plant Diseases KW - J 02430:Symbiosis, Antibiosis & Phages KW - K 03420:Plant Diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902368150?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Phytopathology&rft.atitle=Antibiosis+Activity+of+Pantoea+agglomerans+Biocontrol+Strain+E325+Against+Erwinia+amylovora+on+Apple+Flower+Stigmas&rft.au=Pusey%2C+P+L%3BStockwell%2C+VO%3BReardon%2C+CL%3BSmits%2C+THM%3BDuffy%2C+B&rft.aulast=Pusey&rft.aufirst=P&rft.date=2011-10-01&rft.volume=101&rft.issue=10&rft.spage=1234&rft.isbn=&rft.btitle=&rft.title=Phytopathology&rft.issn=0031949X&rft_id=info:doi/10.1094%2FPHYTO-09-10-0253 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Biological control; Fitness; Fires; Flowers; phenotypic plasticity; Antibiosis; Antibiotics; Antagonism; Pathogens; Stigma; Orchards; Colonies; Blight; Acidification; pH effects; Pantoea agglomerans; Malus; Erwinia amylovora DO - http://dx.doi.org/10.1094/PHYTO-09-10-0253 ER - TY - JOUR T1 - How much more do growers receive for Fair Trade-organic coffee? AN - 902365373; 15701146 AB - I use a representative sample of coffee growing households in southern Mexico to estimate the price premium and gross income gain from participating in Fair Trade-organic markets through grower cooperatives. For the 2004-2005 season, FT-organic growers received an average premium of 12.8 cents per pound, yielding a gross income gain of 5% of total household income or about 26 dollars per household member. The gain is net of the costs of cooperative participation but not of other costs incurred to become certified and suggests that price premiums alone have a limited potential to increase household returns from growing coffee. More broadly speaking, the finding raises questions about the persistence of substantial price premiums associated with social or environmental labeling initiatives. JF - Food Policy AU - Weber, Jeremy G Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 677 EP - 684 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 36 IS - 5 SN - 0306-9192, 0306-9192 KW - Environment Abstracts; Sustainability Science Abstracts KW - Environmental incentives KW - households KW - Mexico KW - ENA 07:General KW - M3:1010 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902365373?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Food+Policy&rft.atitle=How+much+more+do+growers+receive+for+Fair+Trade-organic+coffee%3F&rft.au=Weber%2C+Jeremy+G&rft.aulast=Weber&rft.aufirst=Jeremy&rft.date=2011-10-01&rft.volume=36&rft.issue=5&rft.spage=677&rft.isbn=&rft.btitle=&rft.title=Food+Policy&rft.issn=03069192&rft_id=info:doi/10.1016%2Fj.foodpol.2011.05.007 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - households; Mexico DO - http://dx.doi.org/10.1016/j.foodpol.2011.05.007 ER - TY - JOUR T1 - Pastureland Conservation Effects Assessment Project: Status and expected outcomes AN - 902358930; 15848025 AB - The Conservation Effects Assessment Project (CEAP) is a multiagency scientific effort to quantify environmental outcomes of conservation practices applied to private agricultural lands. The program is anticipated to help shape future conservation policies, programs, and practices. The integrated landscape approach will focus on enhanced ecological resilience and sustainable agricultural production, both of which are essential to maintaining livelihoods and meeting global food needs (Nowak and Sclmepf 2010). JF - Journal of Soil and Water Conservation AU - Sanderson, MA AU - Franzluebbers, A AU - Goslee, S AU - Kiniry, J AU - Owens, L AU - Spaeth, K AU - Steiner, J AU - Veith, T AD - USDA Agricultural Research Service (ARS), Mandan, North Dakota, USA Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 148A EP - 153A VL - 66 IS - 5 SN - 0022-4561, 0022-4561 KW - Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Sustainability Science Abstracts; Environment Abstracts; Water Resources Abstracts KW - Agricultural production KW - Water conservation KW - Landscape KW - Sustainable development KW - agricultural land KW - Water Conservation KW - Environmental factors KW - Shape KW - Foods KW - Assessments KW - Conservation KW - Soil conservation KW - Environment management KW - AQ 00001:Water Resources and Supplies KW - ENA 06:Food & Drugs KW - SW 0845:Water in soils KW - Q2 09123:Conservation KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902358930?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soil+and+Water+Conservation&rft.atitle=Pastureland+Conservation+Effects+Assessment+Project%3A+Status+and+expected+outcomes&rft.au=Sanderson%2C+MA%3BFranzluebbers%2C+A%3BGoslee%2C+S%3BKiniry%2C+J%3BOwens%2C+L%3BSpaeth%2C+K%3BSteiner%2C+J%3BVeith%2C+T&rft.aulast=Sanderson&rft.aufirst=MA&rft.date=2011-10-01&rft.volume=66&rft.issue=5&rft.spage=148A&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soil+and+Water+Conservation&rft.issn=00224561&rft_id=info:doi/10.2489%2Fjswc.66.5.148A LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Water conservation; Environment management; Environmental factors; Agricultural production; Landscape; Soil conservation; Sustainable development; Conservation; agricultural land; Shape; Foods; Assessments; Water Conservation DO - http://dx.doi.org/10.2489/jswc.66.5.148A ER - TY - JOUR T1 - Ethanol yields and cell wall properties in divergently bred switchgrass genotypes AN - 902357135; 15721420 AB - Genetic modification of herbaceous plant cell walls to increase biofuels yields is a primary bioenergy research goal. Using two switchgrass populations developed by divergent breeding for ruminant digestibility, the contributions of several wall-related factors to ethanol yields was evaluated. Field grown low lignin plants significantly out yielded high lignin plants for conversion to ethanol by 39.1% and extraction of xylans by 12%. However, across all plants analyzed, greater than 50% of the variation in ethanol yields was attributable to changes in tissue and cell wall architecture, and responses of stem biomass to dilute-acid pretreatment. Although lignin levels were lower in the most efficiently converted genotypes, no apparent correlation were seen in the lignin monomer G/S ratios. Plants with higher ethanol yields were associated with an apparent decrease in the lignification of the cortical sclerenchyma, and a marked decrease in the granularity of the cell walls following dilute-acid pretreatment. JF - Bioresource Technology AU - Sarath, Gautam AU - Dien, Bruce AU - Saathoff, Aaron J AU - Vogel, Kenneth P AU - Mitchell, Robert B AU - Chen, Han Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 9579 EP - 9585 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 102 IS - 20 SN - 0960-8524, 0960-8524 KW - Biotechnology and Bioengineering Abstracts KW - Biofuels KW - Ruminantia KW - Ethanol KW - W 30945:Fermentation & Cell Culture UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902357135?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Bioresource+Technology&rft.atitle=Ethanol+yields+and+cell+wall+properties+in+divergently+bred+switchgrass+genotypes&rft.au=Sarath%2C+Gautam%3BDien%2C+Bruce%3BSaathoff%2C+Aaron+J%3BVogel%2C+Kenneth+P%3BMitchell%2C+Robert+B%3BChen%2C+Han&rft.aulast=Sarath&rft.aufirst=Gautam&rft.date=2011-10-01&rft.volume=102&rft.issue=20&rft.spage=9579&rft.isbn=&rft.btitle=&rft.title=Bioresource+Technology&rft.issn=09608524&rft_id=info:doi/10.1016%2Fj.biortech.2011.07.086 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Ethanol; Ruminantia DO - http://dx.doi.org/10.1016/j.biortech.2011.07.086 ER - TY - JOUR T1 - Using lake sedimentation rates to quantify the effectiveness of erosion control in watersheds AN - 902348476; 15848030 AB - The effectiveness of erosion control methods is difficult to measure, hampering the development of management practices and preventing accurate assessment of the value of erosion control structures over time. Surface erosion can vary widely over an area, particularly if gully erosion is present, and the use of sediments transported in streams for quantifying erosion is hindered by the highly variable nature of fluvial sediment loads. When a watershed drains into a lake, accumulated sediments have the potential to yield information about historic rates of sedimentation that can be used to evaluate the effectiveness of previous erosion control measures. In the present study, sediments from five natural oxbow cutoff lakes in the Mississippi River alluvial floodplain were dated using lead-210 decay rates and bomb-pulse derived cesium-137 with the goal of relating trends in sedimentation rate to reductions in erosion due to management practices. It was found that the radioisotope dating methods were best used in concert with known dates for implementation of management practices. Changes in sedimentation rate over time frames as short as 12 years were detectable. Larger lakes showed smaller changes in sedimentation rate relative to smaller lakes. JF - Journal of Soil and Water Conservation AU - Wren, D G AU - Davidson, G R AD - USDA Agricultural Research Servici National Sedimentation Laboratory in Oxford Mississippi, USA Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 313 EP - 322 VL - 66 IS - 5 SN - 0022-4561, 0022-4561 KW - Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Environment Abstracts; Meteorological & Geoastrophysical Abstracts; Water Resources Abstracts KW - Settling rate KW - Fluvial Sediments KW - Water conservation KW - Soil erosion KW - Freshwater KW - Watersheds KW - Streams KW - Lakes KW - Erosion Control KW - Soils KW - Decay KW - Sedimentation KW - Erosion control KW - Sedimentation Rates KW - Water Conservation KW - Sediments KW - North America, Mississippi R. KW - Erosion KW - Flood plains KW - Fluvial sediments KW - erosion control KW - Soil conservation KW - Lake sedimentation KW - AQ 00001:Water Resources and Supplies KW - M2 556:General (556) KW - Q2 09123:Conservation KW - SW 2080:Watershed protection KW - ENA 15:Renewable Resources-Terrestrial UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902348476?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soil+and+Water+Conservation&rft.atitle=Using+lake+sedimentation+rates+to+quantify+the+effectiveness+of+erosion+control+in+watersheds&rft.au=Wren%2C+D+G%3BDavidson%2C+G+R&rft.aulast=Wren&rft.aufirst=D&rft.date=2011-10-01&rft.volume=66&rft.issue=5&rft.spage=313&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soil+and+Water+Conservation&rft.issn=00224561&rft_id=info:doi/10.2489%2Fjswc.66.5.313 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Erosion; Lakes; Flood plains; Settling rate; Soils; Soil erosion; Watersheds; Sedimentation; Erosion control; Fluvial sediments; Water conservation; Lake sedimentation; erosion control; Soil conservation; Decay; Sediments; Sedimentation Rates; Erosion Control; Fluvial Sediments; Water Conservation; Streams; North America, Mississippi R.; Freshwater DO - http://dx.doi.org/10.2489/jswc.66.5.313 ER - TY - JOUR T1 - Techniques for assessing the environmental outcomes of conservation practices applied to rangeland watersheds AN - 902348460; 15848026 AB - Grazing lands are the most dominant land cover type in the United States, with approximately 311.7 Mha being defined as rangelands (Mitchell 2000). Approximately 53% (166.2 Mha) of the nation's rangelands (USDA 2009) are owned and managed by the private sector, while approximately 43% are managed by the federal government (USDA NRCS 2011 a). The remaining rangelands are owned and managed by tribal, state, and local governments. Information on the type, extent, and spatial location of land degradation on rangelands is needed to inform policy and management decisions on rangelands; however, there is no systematic or coordinated national dataset on status or condition of rangelands for the United States to make informed policy decisions (NRC 1994; Herrick et al. 2010). Rangelands in the west are sparsely populated, and assessments of rangeland conditions have historically not been uniformly conducted across all land ownership classes in any systematic monitoring program. Therefore, it is difficult to assess the current health of rangelands and which areas could benefit from targeted conservation as USDA Natural Resources Conservation Service (NRCS) has recently done for cropland within the Upper Mississippi River Basin (USDA NRCS 2010) and the Chesapeake Bay (USDA NRCS 2011b) through the Conservation Effects Assessment Project (CEAP). JF - Journal of Soil and Water Conservation AU - Weltz, MA AU - Jolley, L AU - Goodrich, D AU - Boykin, K AU - Nearing, M AU - Stone, J AU - Guertin, P AU - Hernandez, M AU - Spaeth, K AU - Pierson, F AU - Morris, C AU - Kepner, B AD - USDA Agricultural Research Service, Reno, Nevada, USA Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 154A EP - 162A VL - 66 IS - 5 SN - 0022-4561, 0022-4561 KW - Meteorological & Geoastrophysical Abstracts; Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Sustainability Science Abstracts; Environment Abstracts; Water Resources Abstracts KW - Environmental degradation KW - River Basins KW - Land degradation KW - Water conservation KW - Watersheds KW - Natural Resources KW - Assessments KW - Brackishwater environment KW - Policies KW - Land Tenure KW - Resource conservation KW - Environmental assessment KW - Grazing KW - Brackish KW - agricultural land KW - River basins KW - USA, Mississippi R. basin KW - Systematics KW - ANW, USA, Chesapeake Bay KW - Land use KW - Cropland KW - Rangelands KW - Natural resources KW - Soil conservation KW - Conservation KW - Governments KW - Monitoring KW - Environmental conditions KW - AQ 00007:Industrial Effluents KW - Q2 09123:Conservation KW - M3 1010:Issues in Sustainable Development KW - ENA 12:Oceans & Estuaries KW - M2 551.5:General (551.5) KW - SW 4050:Water law and institutions UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/902348460?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Soil+and+Water+Conservation&rft.atitle=Techniques+for+assessing+the+environmental+outcomes+of+conservation+practices+applied+to+rangeland+watersheds&rft.au=Weltz%2C+MA%3BJolley%2C+L%3BGoodrich%2C+D%3BBoykin%2C+K%3BNearing%2C+M%3BStone%2C+J%3BGuertin%2C+P%3BHernandez%2C+M%3BSpaeth%2C+K%3BPierson%2C+F%3BMorris%2C+C%3BKepner%2C+B&rft.aulast=Weltz&rft.aufirst=MA&rft.date=2011-10-01&rft.volume=66&rft.issue=5&rft.spage=154A&rft.isbn=&rft.btitle=&rft.title=Journal+of+Soil+and+Water+Conservation&rft.issn=00224561&rft_id=info:doi/10.2A89%2Fjswc.66.5.154A LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2016-02-04 N1 - SubjectsTermNotLitGenreText - Policies; Grazing; Environmental assessment; Resource conservation; Water conservation; Natural resources; Brackishwater environment; Governments; Environmental conditions; Land degradation; Conservation; River basins; Environmental degradation; Rangelands; Soil conservation; agricultural land; Watersheds; Land use; Cropland; River Basins; Natural Resources; Land Tenure; Assessments; Monitoring; Systematics; USA, Mississippi R. basin; ANW, USA, Chesapeake Bay; Brackish DO - http://dx.doi.org/10.2A89/jswc.66.5.154A ER - TY - JOUR T1 - Rendered-protein hydrolysates for microbial synthesis of cyanophycin biopolymer AN - 899152444; 15793178 AB - Cyanophycin is a poly(arginyl-aspartate) biopolymer produced and stored intracellularly by bacteria. Cyanophycin has been proposed as a renewable replacement for petrochemical-based industrial products. An abundant source of amino acids and nitrogen such as in the form of protein hydrolysates is needed for the biosynthesis of cyanophycin. Rendered proteins are largely used as a feed supplement in animal husbandry and aquaculture. New uses would expand the market size of this class of protein coproducts. We prepared and thoroughly characterized the hydrolysates of meat and bone meal, and proceeded to demonstrate for the first time that these hydrolysates could be used in the fermentative production of cyanophycin. Using the enzyme-hydrolyzed meat and bone meal preparation, we obtained crude cyanophycin product at 33-35% level of that produced using the reference casamino acids in both shake-flask and 10-L bioreactor fermentation studies. Polyacrylamide-gel electrophoresis of the cyanophycin under denaturing conditions showed the molecular weight of the isolated polyamide at 24 kDa. Our results open a new avenue for the utilization of rendered protein coproducts to produce the cyanophycin biopolymer. JF - New Biotechnology AU - Solaiman, Daniel KY AU - Garcia, Rafael A AU - Ashby, Richard D AU - Piazza, George J AU - Steinbuechel, Alexander AD - Biobased and Other Animal Coproducts Research Unit, U.S. Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, 600 E. Mermaid Lane, Wyndmoor, PA 19038, USA, dan.solaiman@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 552 EP - 558 PB - Elsevier B.V., The Boulevard Kidlington Oxford OX5 1GB United Kingdom VL - 28 IS - 6 SN - 1871-6784, 1871-6784 KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Biotechnology and Bioengineering Abstracts; ASFA Aquaculture Abstracts; ASFA 1: Biological Sciences & Living Resources KW - polyamides KW - Biosynthesis KW - Amino acids KW - Electrophoresis KW - Feed KW - Fermentation KW - Biopolymers KW - Industrial products KW - Aquaculture KW - Fermented products KW - Feed composition KW - Bone KW - Meat KW - Acids KW - Molecular weight KW - Bioreactors KW - Feeding experiments KW - Husbandry KW - Hydrolysates KW - Biotechnology KW - Nitrogen KW - Q1 08626:Food technology KW - Q3 08581:Aquaculture: General KW - A 01310:Products of Microorganisms KW - W 30900:Methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/899152444?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=New+Biotechnology&rft.atitle=Rendered-protein+hydrolysates+for+microbial+synthesis+of+cyanophycin+biopolymer&rft.au=Solaiman%2C+Daniel+KY%3BGarcia%2C+Rafael+A%3BAshby%2C+Richard+D%3BPiazza%2C+George+J%3BSteinbuechel%2C+Alexander&rft.aulast=Solaiman&rft.aufirst=Daniel&rft.date=2011-10-01&rft.volume=28&rft.issue=6&rft.spage=552&rft.isbn=&rft.btitle=&rft.title=New+Biotechnology&rft.issn=18716784&rft_id=info:doi/10.1016%2Fj.nbt.2011.03.025 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Biosynthesis; Feed; Bioreactors; Industrial products; Feeding experiments; Fermented products; Aquaculture; Biotechnology; Feed composition; polyamides; Electrophoresis; Amino acids; Fermentation; Biopolymers; Meat; Bone; Molecular weight; Acids; Hydrolysates; Husbandry; Nitrogen DO - http://dx.doi.org/10.1016/j.nbt.2011.03.025 ER - TY - JOUR T1 - Localization of Bacillus thuringiensis Cry1A toxin-binding molecules in gypsy moth larval gut sections using fluorescence microscopy. AN - 887758413; 21767544 AB - The microbial insecticide Bacillus thuringiensis (Bt) produces Cry toxins, proteins that bind to the brush border membranes of gut epithelial cells of insects that ingest it, disrupting the integrity of the membranes, and leading to cell lysis and insect death. In gypsy moth, Lymantria dispar, two toxin-binding molecules for the Cry1A class of Bt toxins have been identified: an aminopeptidase N (APN-1) and a 270kDa anionic glycoconjugate (BTR-270). Studies have shown that APN-1 has a relatively weak affinity and a very narrow specificity to Cry1Ac, the only Cry1A toxin that it binds. In contrast, BTR-270 binds all toxins that are active against L. dispar larvae, and the affinities for these toxins to BTR-270 correlate positively with their respective toxicities. In this study, an immunohistochemical approach was coupled with fluorescence microscopy to localize APN-1 and BTR-270 in paraffin embedded midgut sections of L. dispar larvae. The distribution of cadherin and alkaline phosphatase in the gut tissue was also examined. A strong reaction indicative of polyanionic material was detected with alcian blue staining over the entire epithelial brush border, suggesting the presence of acidic glycoconjugates in the microvillar matrix. The Cry1A toxin-binding sites were confined to the apical surface of the gut epithelial cells with intense labeling of the apical tips of the microvilli. APN-1, BTR-270, and alkaline phosphatase were found to be present exclusively along the brush border microvilli along the entire gut epithelium. In contrast, cadherin, detected only in older gypsy moth larvae, was present both in the apical brush border and in the basement membrane anchoring the midgut epithelial cells. The topographical relationship between the Bt Cry toxin-binding molecules BTR-270 and APN-1 and the Cry1A toxin-binding sites that were confined to the apical brush border of the midgut cells is consistent with findings implicating their involvement in the mechanism of the action of Bt Cry toxins. Published by Elsevier Inc. JF - Journal of invertebrate pathology AU - Valaitis, Algimantas P AD - USDA Forest Service, Delaware, OH 43015, USA. avalaitis@fs.fed.us Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 69 EP - 75 VL - 108 IS - 2 KW - Anion Transport Proteins KW - 0 KW - Bacterial Proteins KW - Cadherins KW - Endotoxins KW - Hemolysin Proteins KW - Recombinant Proteins KW - insecticidal crystal protein, Bacillus Thuringiensis KW - Endodeoxyribonucleases KW - EC 3.1.- KW - Alkaline Phosphatase KW - EC 3.1.3.1 KW - Index Medicus KW - Animals KW - Cadherins -- metabolism KW - Microvilli -- metabolism KW - Microscopy, Fluorescence -- methods KW - Endodeoxyribonucleases -- metabolism KW - Alkaline Phosphatase -- metabolism KW - Pest Control, Biological KW - Anion Transport Proteins -- metabolism KW - Insect Control KW - Host-Pathogen Interactions KW - Endotoxins -- metabolism KW - Larva -- metabolism KW - Bacillus thuringiensis -- physiology KW - Bacterial Proteins -- metabolism KW - Intestinal Mucosa -- metabolism KW - Hemolysin Proteins -- metabolism KW - Moths -- microbiology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/887758413?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+invertebrate+pathology&rft.atitle=Localization+of+Bacillus+thuringiensis+Cry1A+toxin-binding+molecules+in+gypsy+moth+larval+gut+sections+using+fluorescence+microscopy.&rft.au=Valaitis%2C+Algimantas+P&rft.aulast=Valaitis&rft.aufirst=Algimantas&rft.date=2011-10-01&rft.volume=108&rft.issue=2&rft.spage=69&rft.isbn=&rft.btitle=&rft.title=Journal+of+invertebrate+pathology&rft.issn=1096-0805&rft_id=info:doi/10.1016%2Fj.jip.2011.07.001 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2011-12-22 N1 - Date created - 2011-09-05 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1016/j.jip.2011.07.001 ER - TY - JOUR T1 - Niobium-tantalum oxide minerals in the Jezuitske Lesy granitic pegmatite, Bratislava Massif, Slovakia: Ta to Nb and Fe to Mn evolutionary trends in a narrow Be,Cs-rich and Li,B-poor dike AN - 1805503801; 18524602 AB - A complex assemblage of Nb-Ta-(Sn) oxide minerals occur in a relatively narrow (~1-2 m thick) extensively albitized, Hercynian granitic pegmatite dike intruding biotite granodiorites near Bratislava, SW Slovakia. The dike shows enrichment in beryl (locally Cs-rich) but absence of Li- and B-rich phases. Compositions and textural relationships indicate complex evolutions of Nb-Ta oxide phases with several generations presenting distinct textural and compositional features. The first generation of the Nb-Ta minerals from the quartz-microcline-muscovite zone show Ta,Fe-rich compositions with Ta# [Ta/(Ta + Nb)]=0.52-0.70 (Ct I columbite-tantalite), 0.88-0.90 (Tap I ferrotapiolite) and 0.73-0.86 (Fw I ferrowodginite); Mn# [Mn/(Mn + Fe)]=0.32-0.49 (Ct I), 0.06-0.10 (Tap I) and 0.33-0.41 (Fw I). The 2nd generation is represented by ferrocolumbite to ferrotantalite (Ct II) in saccharoidal albite zone, replacement zones of Ct II in Ct I, and irregular overgrowths of ferrotapiolite (Tap II) and ferrowodginite (Fw II) on Tap I grains. The minerals of the 2nd generation show decreasing of Ta# in comparison to the 1st group: 0.10-0.60 (Ct II), 0.85-0.87 (Tap II) and 0.73-0.77 (Fw II); Mn# attains 0.30-0.45 (Ct II), 0.06-0.09 (Tap II) and 0.26-0.37 (Fw II). The 3rd generation includes fissure fillings, overgrowths and replacement zones of manganocolumbite and manganotantalite (Ct III), ferrotapiolite (Tap III) and ferrowodginite (Fw III) on the older Nb-Ta phases (Ct I, Tap I, Fw I, Fw II), in the coarse-grained unit. The 3rd population displays distinct Mn# increasing (Ct III: 0.51-0.69, Tap III: 0.11-0.24, Fw III: 0.40-0.41), Ta# values reach 0.16-0.79 (Ct III), 0.88-0.92 (Tap III) and 0.80-0.81 (Fw III). The latest, 4th generation of the Nb-Ta phases represents irregular veinlets and patches of fluorcalciomicrolite, replacing Ct I, Tap I, Fw I, Ct II and Tap III. Decrease of Ta/(Ta + Nb) values in Ct II from the saccharoidal albite unit can be explained by crystallization from the albite-rich melt, which was significantly impoverished in Ta with respect to Nb, after crystallization of Ta-rich phases from the 1st generation (ferrotapiolite I, ferrowodginite I). JF - Mineralogy and Petrology AU - Chudik, Peter AU - Uher, Pavel AU - Gadas, Petr AU - Skoda, Radek AU - Prsek, Jaroslav AD - Department of Mineral Deposits, Comenius University, Mlynska dolina, 842 15, Bratislava, Slovakia, chudik@fns.uniba.sk Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 15 EP - 27 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 102 IS - 1-4 SN - 0930-0708, 0930-0708 KW - Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Oxide minerals KW - Crystallization KW - Slovakia KW - Mineralogy KW - Dikes KW - Petrology KW - Enrichment KW - Slovakia, Zapadoslovensky, Bratislava KW - Minerals KW - Manganese KW - Iron KW - Oxides KW - Evolution KW - Biotite KW - Q2 09405:Oil and gas KW - SW 0810:General UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1805503801?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Mineralogy+and+Petrology&rft.atitle=Niobium-tantalum+oxide+minerals+in+the+Jezuitske+Lesy+granitic+pegmatite%2C+Bratislava+Massif%2C+Slovakia%3A+Ta+to+Nb+and+Fe+to+Mn+evolutionary+trends+in+a+narrow+Be%2CCs-rich+and+Li%2CB-poor+dike&rft.au=Chudik%2C+Peter%3BUher%2C+Pavel%3BGadas%2C+Petr%3BSkoda%2C+Radek%3BPrsek%2C+Jaroslav&rft.aulast=Chudik&rft.aufirst=Peter&rft.date=2011-10-01&rft.volume=102&rft.issue=1-4&rft.spage=15&rft.isbn=&rft.btitle=&rft.title=Mineralogy+and+Petrology&rft.issn=09300708&rft_id=info:doi/10.1007%2Fs00710-011-0163-9 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2016-07-01 N1 - Last updated - 2016-12-22 N1 - SubjectsTermNotLitGenreText - Crystallization; Oxide minerals; Petrology; Mineralogy; Iron; Manganese; Biotite; Dikes; Enrichment; Minerals; Evolution; Oxides; Slovakia; Slovakia, Zapadoslovensky, Bratislava DO - http://dx.doi.org/10.1007/s00710-011-0163-9 ER - TY - JOUR T1 - A simulation of probabilistic wildfire risk components for the continental United States AN - 1777100926; 15522462 AB - This simulation research was conducted in order to develop a large-fire risk assessment system for the contiguous land area of the United States. The modeling system was applied to each of 134 Fire Planning Units (FPUs) to estimate burn probabilities and fire size distributions. To obtain stable estimates of these quantities, fire ignition and growth was simulated for 10,000 to 50,000 "years" of artificial weather. The fire growth simulations, when run repeatedly with different weather and ignition locations, produce burn probabilities and fire behavior distributions at each landscape location (e.g., number of times a "cell" burns at a given intensity divided by the total years). The artificial weather was generated for each land unit using (1) a fire danger rating index known as the Energy Release Component (ERC) which is a proxy for fuel moisture contents, (2) a time-series analysis of ERC to represent daily and seasonal variability, and (3) distributions of wind speed and direction from weather records. Large fire occurrence was stochastically modeled based on historical relationships to ERC. The simulations also required spatial data on fuel structure and topography which were acquired from the LANDFIRE project (http://www.landfire.gov). Fire suppression effects were represented by a statistical model that yields a probability of fire containment based on independent predictors of fire growth rates and fuel type. The simulated burn probabilities were comparable to observed patterns across the U.S. over the range of four orders of magnitude, generally falling within a factor of 3 or 4 of historical estimates. Close agreement between simulated and historical fire size distributions suggest that fire sizes are determined by the joint distributions of spatial opportunities for fire growth (dependent on fuels and ignition location) and the temporal opportunities produced by conducive weather sequences. The research demonstrates a practical approach to using fire simulations at very broad scales for purposes of operational planning and perhaps ecological research. JF - Stochastic Environmental Research and Risk Assessment AU - Finney, Mark A AU - McHugh, Charles W AU - Grenfell, Isaac C AU - Riley, Karin L AU - Short, Karen C AD - USDA Forest Service, Missoula Fire Sciences Laboratory, 5775 Highway 10 West, Missoula, MT, 59808, USA mfinney@fs.fed.us Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 973 EP - 1000 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 25 IS - 7 SN - 1436-3240, 1436-3240 KW - Materials Business File (MB); Environmental Engineering Abstracts (EN); CSA / ASCE Civil Engineering Abstracts (CE) KW - Burns KW - Weather KW - Fires KW - Estimates KW - Mathematical models KW - Computer simulation KW - Fuels KW - Climatology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1777100926?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvironmentalengabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Stochastic+Environmental+Research+and+Risk+Assessment&rft.atitle=A+simulation+of+probabilistic+wildfire+risk+components+for+the+continental+United+States&rft.au=Finney%2C+Mark+A%3BMcHugh%2C+Charles+W%3BGrenfell%2C+Isaac+C%3BRiley%2C+Karin+L%3BShort%2C+Karen+C&rft.aulast=Finney&rft.aufirst=Mark&rft.date=2011-10-01&rft.volume=25&rft.issue=7&rft.spage=973&rft.isbn=&rft.btitle=&rft.title=Stochastic+Environmental+Research+and+Risk+Assessment&rft.issn=14363240&rft_id=info:doi/10.1007%2Fs00477-011-0462-z LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-02-01 N1 - Last updated - 2016-05-18 DO - http://dx.doi.org/10.1007/s00477-011-0462-z ER - TY - JOUR T1 - Comparison of Rhodamine-WT and bromide as a tracer for elucidating internal wetland flow dynamics AN - 1762122835; 15379275 AB - Artificially constructed wetlands offer a low-cost treatment alternative to remove a number of pollutants found in effluent water from industry, mining, agriculture, and urban areas. The determination of treatment efficiency cannot be determined without understanding the flow dynamics of individual parcels of water through the wetland. A method for tracking parcels of water is proposed, using Rhodamine-WT as a tracer. A series of tracer tests were conducted on a 1.2ha treatment wetland. Bromide and Rhodamine-WT were simultaneously dosed into the inlet and monitored at 60 sampling locations for 5 weeks. Rhodamine-WT concentrations were found to be coincident with bromide. For all three events the relationship between Rhodamine-WT concentration and bromide concentration was linear at each sampling point with a slope of 0.82. The peak concentration of Rhodamine-WT and bromide was also found to coincide throughout the wetland. Rhodamine-WT can be used to determine the movement of individual parcels of water through a treatment wetland and used to determine treatment efficiencies at individual locations within a wetland. JF - Ecological Engineering AU - Williams, C F AU - Nelson, S D Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 1492 EP - 1498 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 37 IS - 10 SN - 0925-8574, 0925-8574 KW - Environmental Engineering Abstracts (EN); CSA / ASCE Civil Engineering Abstracts (CE) KW - Wetland KW - Tracer KW - Rhodamine-WT KW - Bromide KW - Tracers KW - Bromides KW - Wetlands KW - Sampling KW - Parcels KW - Effluents KW - Tracking KW - Dynamics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1762122835?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvironmentalengabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Ecological+Engineering&rft.atitle=Comparison+of+Rhodamine-WT+and+bromide+as+a+tracer+for+elucidating+internal+wetland+flow+dynamics&rft.au=Williams%2C+C+F%3BNelson%2C+S+D&rft.aulast=Williams&rft.aufirst=C&rft.date=2011-10-01&rft.volume=37&rft.issue=10&rft.spage=1492&rft.isbn=&rft.btitle=&rft.title=Ecological+Engineering&rft.issn=09258574&rft_id=info:doi/10.1016%2Fj.ecoleng.2011.05.003 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-12-01 N1 - Last updated - 2016-05-18 DO - http://dx.doi.org/10.1016/j.ecoleng.2011.05.003 ER - TY - JOUR T1 - Quantifying species trait-functioning relationships for ecosystem management AN - 1551639712; 20316408 AB - Questions: Can we use plant traits to make predictions about ecosystem functioning of different species mixtures, identify inherent trade-offs of particular species, and design custom communities for desired ecosystem functions? Can we develop a methodology to address plant trait-functioning relationships in species-level units, which are missing from measures of community functional diversity but needed for management? Location: Grazing lands northeastern USA. Method: We measured 53 physiological, morphological and growth traits for 19 plant species from glasshouse and field experiments. We developed a two-step method to link species to ecosystem processes related to management goals of improving desirable forage production in grazing lands in northeastern USA. Results: Species were distributed continuously, rather than clustering into discrete functional types. Grasses, legumes and forbs overlapped considerably in trait values with these common classifications failing to adequately distinguish functional differences. Factor analyses were used to assess variation in species traits, and to rate species for six plant processes through which species contribute to the production of desirable forage. Species performed well in some processes and poorly in others, illustrating complex trade-offs. Conclusions: This methodology provides a foundation for developing tools to guide construction of communities for applied settings, and for assembling hypotheses about plant functioning in mixtures. JF - Applied Vegetation Science AU - Comas, L H AU - Goslee, S C AU - Skinner, R H AU - Sanderson, MA AD - USDA-ARS Pasture Systems and Watershed Management Research Unit, University Park, PA 16802, USA. Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 583 EP - 595 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 14 IS - 4 SN - 1402-2001, 1402-2001 KW - Ecology Abstracts KW - Classification KW - Grazing KW - Grasses KW - Legumes KW - Forbs KW - Factor analysis KW - Plant communities KW - Ecosystem management KW - Vegetation KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1551639712?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Vegetation+Science&rft.atitle=Quantifying+species+trait-functioning+relationships+for+ecosystem+management&rft.au=Comas%2C+L+H%3BGoslee%2C+S+C%3BSkinner%2C+R+H%3BSanderson%2C+MA&rft.aulast=Comas&rft.aufirst=L&rft.date=2011-10-01&rft.volume=14&rft.issue=4&rft.spage=583&rft.isbn=&rft.btitle=&rft.title=Applied+Vegetation+Science&rft.issn=14022001&rft_id=info:doi/10.1111%2Fj.1654-109X.2011.01136.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-08-01 N1 - Last updated - 2014-10-15 N1 - SubjectsTermNotLitGenreText - Classification; Grasses; Grazing; Factor analysis; Forbs; Legumes; Ecosystem management; Plant communities; Vegetation DO - http://dx.doi.org/10.1111/j.1654-109X.2011.01136.x ER - TY - JOUR T1 - Using light to predict fuels-reduction and group-selection effects on succession in Sierran mixed-conifer forest AN - 1434031201; 18512736 AB - Many semi-arid coniferous forests in western North America have reached historically unprecedented densities over the past 150 years and are dominated by shade-tolerant trees. Silvicultural treatments generally open the canopy but may not restore shade-intolerant species. We determined crossover-point irradiance (CPI) (light at which the height growth rank of pairs of species changes) for seedlings in Sierra Nevada mixed-conifer forest and used these to interpret light environments produced by fuels-reduction thinning and group selection with reserved large trees. Nine of 21 species pairs had well-defined CPIs. The CPI of the most common shade-tolerant and intolerant species (white fir (Abies concolor (Gordon & Glendl.) Lindl. ex Hildebr.) and ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson)) was 22.5 mol.m super(-2).day super(-1) or 41% of full sun. Median understory irradiance increased from 9.2 mol.m super(-2). day super(-1) (17% full sun) in pretreatment forest to 13 mol.m super(-2).d ay super(-1) (24% full sun) in lightly and 15.5 mol.m super(-2).day super(-1) (28% full sun) in moderately thinned stands and 37 mol.m super(-2).d ay super(-1) (67% full sun) in group-selection openings. We estimate that 5%-20% of ground area in lightly to moderately thinned stands would have enough light to favor shade-intolerant over shade-tolerant growth compared with 89% of ground area in group-selection openings. The CPI provides a tool to assess regeneration implications of treatment modification such as increasing heterogeneity of thinning to enhance regeneration or reserving large trees in group-selection openings to maintain wildlife habitat.Original Abstract: Plusieurs forets resineuses semi-arides de l'ouest de l'Amerique du Nord ont atteint des densites historiquement sans precedents au cours des 150 dernieres annees et sont dominees par des especes tolerantes a l'ombre. Les traitements sylvicoles ont generalement pour effet d'ouvrir le couvert sans necessairement retablir la presence d'especes intolerantes a l'ombre. Nous avons determine le point de croisement pour l'irradiance (PCI) (le degre de lumiere correspondant a une inversion du rang de deux especes base sur leur croissance en hauteur) de semis dans une foret melangee de coniferes de la Sierra Nevada et nous l'avons utilise pour interpreter l'environnement lumineux produit par une eclaircie visant a diminuer les combustibles et par une coupe de jardinage par groupes avec reserve de gros arbres. Neuf des 21 paires d'especes avaient un PCI bien defini. Le PCI des especes tolerante et intolerante a l'ombre les plus communes (sapin argente(Abies concolor (Gordon & Glend.) Lindl. ex Hildebr.) et pin ponderosa (Pinus ponderosa Douglas ex P. Lawson & C. Lawson)) etait de 22,5 mol.m super(-2).jour super(-1) ou 41% de la pleine lumiere. L'irradiance mediane du sous-bois a augmente de 9,2 mol.m super(-2).jour super(-1) (17% de la pleine lumiere) dans la foret non traitee a 13 mol.m super(-2).jour super(-1) (24% de la pleine lumiere) dans l'eclaircie legere, 15,5 mol.m super(-2).jour super(-1) (28% de la pleine lumiere) dans l'eclaircie moderee et 37 mol.m super(-2).jour super(-1) (67% de la pleine lumiere) dans les ouvertures de la coupe de jardinage par groupes. Nous estimons que de 5% a 20% de la surface du sol des peuplements faiblement a moderement eclaircis auraient suffisamment de lumiere pour favoriser la croissance d'une espece intolerante a l'ombre plutot que celle d'une espece tolerante comparativement a 89% de la surface du sol dans le cas des ouvertures de la coupe de jardinage par groupes. Le PCI peut etre utilise comme un outil pour estimer l'implication sur la regeneration de la modification des traitements sylvicoles, comme l'augmentation de l'heterogeneite de l'eclaircie dans le but d'ameliorer la regeneration ou la reserve de gros arbres dans les ouvertures de la coupe de jardinage par groupes dans le but de maintenir les habitats fauniques. JF - Canadian Journal of Forest Research/Revue Canadienne de Recherche Forestiere AU - Bigelow, Seth W AU - North, Malcolm P AU - Salk, Carl F AD - USDA Forest Service, Pacific Southwest Research Station, 1731 Research Park Drive, Davis, CA 95618, USA., sbigelow@fs.fed.us Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 2051 EP - 2063 PB - NRC Research Press VL - 41 IS - 10 SN - 0045-5067, 0045-5067 KW - Sustainability Science Abstracts; Ecology Abstracts KW - Irradiance KW - Abies concolor KW - Trees KW - Pinus ponderosa KW - Group selection KW - Forests KW - Succession KW - Silviculture KW - Sun KW - Canopies KW - Understory KW - Wildlife KW - Habitat KW - USA, California, Sierra Nevada Mts. KW - Light effects KW - Thinning KW - Regeneration KW - Seedlings KW - M3 1010:Issues in Sustainable Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1434031201?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.atitle=Using+light+to+predict+fuels-reduction+and+group-selection+effects+on+succession+in+Sierran+mixed-conifer+forest&rft.au=Bigelow%2C+Seth+W%3BNorth%2C+Malcolm+P%3BSalk%2C+Carl+F&rft.aulast=Bigelow&rft.aufirst=Seth&rft.date=2011-10-01&rft.volume=41&rft.issue=10&rft.spage=2051&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Forest+Research%2FRevue+Canadienne+de+Recherche+Forestiere&rft.issn=00455067&rft_id=info:doi/10.1139%2Fx11-120 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-09-01 N1 - Number of references - 41 N1 - Last updated - 2015-05-27 N1 - SubjectsTermNotLitGenreText - Irradiance; Trees; Group selection; Wildlife; Succession; Habitat; Light effects; Thinning; Silviculture; Sun; Seedlings; Canopies; Understory; Regeneration; Forests; Abies concolor; Pinus ponderosa; USA, California, Sierra Nevada Mts. DO - http://dx.doi.org/10.1139/x11-120 ER - TY - JOUR T1 - The overlooked soil-forming factors; distinguishing influences of soil age and hydrology from climate influences on Vertisols, and applications to interpreting paleosols AN - 1420515693; 2013-064614 AB - According to the classic model of Jenny, pedogenic processes are driven by interrelationships between five primary soil-forming factors: climate, topography, time, biota, and parent material. Most paleosol studies focus on reconstructions of paleoclimate, emphasizing applications of climate proxies developed from modern soils for estimating paleoprecipitation amount and seasonality, as well as paleotemperature in paleosols. Soil age and soil hydrological state are examined here as important controls on development for Vertisols, which are clay-rich soils formed from shrink-swell processes associated with seasonal moisture deficit and increased evapotranspiration. Trends in macro- and micromorphology and bulk chemistry are used to address three primary topics: 1) rates of Vertisol pedogenesis, 2) characteristics associated with time steps within the pedogenic process, and 3) influences of changes in saturation state in sites where seasonal ponding of water occurs. Soils formed on inset terraces of the Brazos River, TX (<18,000 yrs) and the related San Bernard River floodplain (<6,600 yrs), and on the Coast Prairie climosequence of Texas where soils formed from Beaumont alluvium (< 100,000 yrs: MAP ranging from 700-1450 mm/yr), collectively are used to investigate these three topics. Variations in profile thickness, lack of preservation of relict primary sedimentary bedding, depth of leaching, and depth and degree of development of pedogenic carbonate, slickensides, and clay fabric as well as geochemical mass balance (strain, translocation) are quantified for soils of different ages as well as variable saturation conditions. Results suggest that time-dependent morphological and chemical features may mimic those that are climate-dependent. Soils formed in drier climates may display similar characteristics to those seen in younger profiles, whereas soils formed in wetter climates may exhibit features comparable to older profiles, thus obscuring paleoclimate interpretations obtained from analysis of paleoVertisols. In addition, variable soil saturation state can result in close-spatial variability of parameters used for interpreting time and climate in paleoVertisols, such as depth to Bk and thickness of Bk horizons. JF - Abstracts with Programs - Geological Society of America AU - Driese, Steven G AU - Nordt, Lee AU - Mintz, Jason S AU - Robinson, Amelia C AU - Miller, Wesley L AU - Anonymous Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 662 PB - Geological Society of America (GSA), Boulder, CO VL - 43 IS - 5 SN - 0016-7592, 0016-7592 KW - United States KW - Brazos River KW - Vertisols KW - paleoclimatology KW - topography KW - sediments KW - thickness KW - paleosols KW - applications KW - horizons KW - climate KW - soils KW - processes KW - pedogenesis KW - clastic sediments KW - paleohydrology KW - San Bernard River KW - Texas KW - biota KW - models KW - saturation KW - parent materials KW - expansive materials KW - alluvium KW - reconstruction KW - 25:Soils UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1420515693?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+with+Programs+-+Geological+Society+of+America&rft.atitle=The+overlooked+soil-forming+factors%3B+distinguishing+influences+of+soil+age+and+hydrology+from+climate+influences+on+Vertisols%2C+and+applications+to+interpreting+paleosols&rft.au=Driese%2C+Steven+G%3BNordt%2C+Lee%3BMintz%2C+Jason+S%3BRobinson%2C+Amelia+C%3BMiller%2C+Wesley+L%3BAnonymous&rft.aulast=Driese&rft.aufirst=Steven&rft.date=2011-10-01&rft.volume=43&rft.issue=5&rft.spage=662&rft.isbn=&rft.btitle=&rft.title=Abstracts+with+Programs+-+Geological+Society+of+America&rft.issn=00167592&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Geological Society of America, 2011 annual meeting N1 - Copyright - GeoRef, Copyright 2013, American Geosciences Institute. Reference includes data supplied by the Geological Society of America, Boulder, CO, United States N1 - Date revised - 2013-01-01 N1 - PubXState - CO N1 - Last updated - 2013-08-15 N1 - CODEN - GAAPBC N1 - SubjectsTermNotLitGenreText - alluvium; applications; biota; Brazos River; clastic sediments; climate; expansive materials; horizons; models; paleoclimatology; paleohydrology; paleosols; parent materials; pedogenesis; processes; reconstruction; San Bernard River; saturation; sediments; soils; Texas; thickness; topography; United States; Vertisols ER - TY - JOUR T1 - Karst features of the Hiawatha National Forest, Upper Peninsula, Michigan AN - 1287377638; 2013-017547 AB - The Upper Peninsula of Michigan is made up in part of Silurian carbonate sequences. These carbonate sequences make up the northern edge of the Michigan Basin and part of the Niagara Escarpment, which runs from eastern New York, through Ontario, Canada, across the Upper Peninsula in Michigan, and back south through the Door Peninsula in Wisconsin. The group which makes up the largest areal extent and upon which nearly all the karst is found in the Upper Peninsula is the Engadine group, which is a dolostone of Middle Silurian age. Karst features have been mapped in this area for the last few years, including: alvar, boulder fields, caves, cliffs, fissures, ledges, outcrops, sinkholes, and springs. With the addition of this year's (2011) field data and the data from Larson et al. (2010) further karst-paleo-lake level relationships can be made. Our data suggest that the karst features on the Hiawatha are related to the Algonquin ( approximately 250m) and the Nippising ( approximately 200m) high lake level stages. We believe that these surficial karst exposures are due to wave action, which eroded away the overburden leaving the bedrock and subsequent karst features exposed with the ensuing lake level drops. We also present a model for the formation of the dolostone boulder fields on the Hiawatha that invokes the association between the boulder fields and outcrops. We suggest that the boulder fields found surrounding the outcrops are formed by the freeze-thaw cycles of northern Michigan, which bring the upper part of the bedrock to the surface in the form of boulders. This project was made possible by the GeoCorps America Program which is sponsored by the Geological Society of America and the United States Forest Service. JF - Abstracts with Programs - Geological Society of America AU - Larson, Erik B AU - Stuntebeck, Jessica J AU - Anonymous Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 252 PB - Geological Society of America (GSA), Boulder, CO VL - 43 IS - 5 SN - 0016-7592, 0016-7592 KW - United States KW - North America KW - Paleozoic KW - Michigan Upper Peninsula KW - karst KW - Silurian KW - Niagara Escarpment KW - Hiawatha National Forest KW - sedimentary rocks KW - sinkholes KW - Michigan KW - geomorphology KW - carbonate rocks KW - solution features KW - 23:Geomorphology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1287377638?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+with+Programs+-+Geological+Society+of+America&rft.atitle=Karst+features+of+the+Hiawatha+National+Forest%2C+Upper+Peninsula%2C+Michigan&rft.au=Larson%2C+Erik+B%3BStuntebeck%2C+Jessica+J%3BAnonymous&rft.aulast=Larson&rft.aufirst=Erik&rft.date=2011-10-01&rft.volume=43&rft.issue=5&rft.spage=252&rft.isbn=&rft.btitle=&rft.title=Abstracts+with+Programs+-+Geological+Society+of+America&rft.issn=00167592&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Geological Society of America, 2011 annual meeting N1 - Copyright - GeoRef, Copyright 2013, American Geosciences Institute. Reference includes data supplied by the Geological Society of America, Boulder, CO, United States N1 - Date revised - 2013-01-01 N1 - PubXState - CO N1 - Last updated - 2013-02-14 N1 - CODEN - GAAPBC N1 - SubjectsTermNotLitGenreText - carbonate rocks; geomorphology; Hiawatha National Forest; karst; Michigan; Michigan Upper Peninsula; Niagara Escarpment; North America; Paleozoic; sedimentary rocks; Silurian; sinkholes; solution features; United States ER - TY - JOUR T1 - Variation in local abundance and species richness of stream fishes in relation to dispersal barriers: implications for management and conservation AN - 1257855888; 15929821 AB - 1.Barriers to immigration, all else being equal, should in principle depress local abundance and reduce local species richness. These issues are particularly relevant to stream-dwelling species when improperly designed road crossings act as barriers to migration with potential impacts on the viability of upstream populations. However, because abundance and richness are highly spatially and temporally heterogeneous and the relative importance of immigration on demography is uncertain, population- and community-level effects can be difficult to detect. 2.In this study, we tested the effects of potential barriers to upstream movements on the local abundance and species richness of a diverse assemblage of resident stream fishes in the Monongahela National Forest, West Virginia, U.S.A. Fishes were sampled using simple standard techniques above- and below road crossings that were either likely or unlikely to be barriers to upstream fish movements (based on physical dimensions of the crossing). We predicted that abundance of resident fishes would be lower in the upstream sections of streams with predicted impassable barriers, that the strength of the effect would vary among species and that variable effects on abundance would translate into lower species richness. 3.Supporting these predictions, the statistical model that best accounted for variation in abundance and species richness included a significant interaction between location (upstream or downstream of crossing) and type (passable or impassable crossing). Stream sections located above predicated impassable culverts had fewer than half the number of species and less than half the total fish abundance, while stream sections above and below passable culverts had essentially equivalent richness and abundance. 4.Our results are consistent with the importance of immigration and population connectivity to local abundance and species richness of stream fishes. In turn, these results suggest that when measured at appropriate scales (multiple streams within catchments), with simple protocols amenable to use by management agencies, differences in local abundance and species richness may serve as indicators of the extent to which road crossings are barriers to fish movement and help determine whether road-crossing improvements have restored connectivity to stream fish populations and communities. JF - Freshwater Biology AU - Nislow, Keith H AU - Hudy, Mark AU - Letcher, Benjamin H AU - Smith, Eric P AD - USDA Forest Service Northern Research Station, Amherst, MA, U.S.A. Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 2135 EP - 2144 PB - Wiley-Blackwell, 111 River Street Hoboken NJ 07030-5774 United States VL - 56 IS - 10 SN - 0046-5070, 0046-5070 KW - Environment Abstracts; Ecology Abstracts; Water Resources Abstracts; Aqualine Abstracts; ASFA 1: Biological Sciences & Living Resources KW - Barriers KW - Abundance KW - Freshwater KW - Freshwater fish KW - Migration KW - Roads KW - Fishery management KW - Species richness KW - USA, West Virginia KW - Community composition KW - Stream KW - Conservation KW - Fish KW - Fish Populations KW - Dispersal KW - Prediction KW - Species Richness KW - Statistical analysis KW - Species Diversity KW - Relative abundance KW - Culverts KW - Streams KW - Models KW - Pisces KW - Demography KW - Upstream KW - Downstream KW - Immigration KW - Mathematical models KW - Scales KW - Species diversity KW - Governments KW - Population number KW - AQ 00001:Water Resources and Supplies KW - Q1 08463:Habitat community studies KW - SW 0835:Streamflow and runoff KW - ENA 18:Transportation KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1257855888?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Freshwater+Biology&rft.atitle=Variation+in+local+abundance+and+species+richness+of+stream+fishes+in+relation+to+dispersal+barriers%3A+implications+for+management+and+conservation&rft.au=Nislow%2C+Keith+H%3BHudy%2C+Mark%3BLetcher%2C+Benjamin+H%3BSmith%2C+Eric+P&rft.aulast=Nislow&rft.aufirst=Keith&rft.date=2011-10-01&rft.volume=56&rft.issue=10&rft.spage=2135&rft.isbn=&rft.btitle=&rft.title=Freshwater+Biology&rft.issn=00465070&rft_id=info:doi/10.1111%2Fj.1365-2427.2011.02634.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-12-01 N1 - Document feature - figure 4 N1 - Last updated - 2014-05-02 N1 - SubjectsTermNotLitGenreText - Community composition; Barriers; Fishery management; Species Richness; Stream; Species diversity; Governments; Freshwater fish; Population number; Demography; Mathematical models; Immigration; Scales; Abundance; Statistical analysis; Conservation; Dispersal; Migration; Streams; Species richness; Models; Prediction; Upstream; Downstream; Relative abundance; Fish; Roads; Species Diversity; Fish Populations; Culverts; Pisces; USA, West Virginia; Freshwater DO - http://dx.doi.org/10.1111/j.1365-2427.2011.02634.x ER - TY - JOUR T1 - Welfare Impacts of Alternative Biofuel and Energy Policies AN - 1038599440; 17103629 AB - An open-economy equilibrium model is derived to investigate the effects of energy policy on the U.S. economy, with emphasis on corn-based ethanol. A second best policy of a fuel tax and ethanol subsidy is found to approximate fairly closely the welfare gains associated with the first best policy of an optimal carbon tax and tariffs on traded goods. The largest economic gains to the U.S. economy from these energy policies arise from their impact on U.S. terms of trade, particularly in the oil market. Conditional on the current fuel tax, an optimal ethanol mandate is superior to an optimal ethanol subsidy. JF - American Journal of Agricultural Economics AU - Cui, Jingbo AU - Lapan, Harvey AU - Moschini, GianCarlo AU - Cooper, Joseph AD - Jingbo Cui is a Ph.D. student, Harvey Lapan is a university professor, and GianCarlo Moschini is professor and Pioneer Chair in Science and Technology Policy, all with the Department of Economics, Iowa State University. Joseph Cooper is with the Economic Research Service, USDA., hlapan@iastate.edu Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 1235 EP - 1256 PB - Oxford University Press, Oxford Journals, Great Clarendon Street Oxford OX2 6DP United Kingdom VL - 93 IS - 5 SN - 0002-9092, 0002-9092 KW - Environment Abstracts; Sustainability Science Abstracts KW - biofuel policies KW - carbon tax KW - ethanol subsidy KW - gasoline tax KW - greenhouse gas emissions KW - mandates KW - renewable fuel standard KW - second best KW - Q2 KW - H2 KW - F1 KW - Taxation KW - Oil KW - Fuel technology KW - USA KW - Energy policy KW - Fuels KW - Economics KW - Subsidies KW - Biofuels KW - Ethanol KW - ENA 03:Energy KW - M3 1010:Issues in Sustainable Development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1038599440?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+Journal+of+Agricultural+Economics&rft.atitle=Welfare+Impacts+of+Alternative+Biofuel+and+Energy+Policies&rft.au=Cui%2C+Jingbo%3BLapan%2C+Harvey%3BMoschini%2C+GianCarlo%3BCooper%2C+Joseph&rft.aulast=Cui&rft.aufirst=Jingbo&rft.date=2011-10-01&rft.volume=93&rft.issue=5&rft.spage=1235&rft.isbn=&rft.btitle=&rft.title=American+Journal+of+Agricultural+Economics&rft.issn=00029092&rft_id=info:doi/10.1093%2Fajae%2Faar053 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-09-01 N1 - Last updated - 2015-03-19 N1 - SubjectsTermNotLitGenreText - Oil; Taxation; Fuel technology; Energy policy; Fuels; Economics; Subsidies; Biofuels; Ethanol; USA DO - http://dx.doi.org/10.1093/ajae/aar053 ER - TY - JOUR T1 - False-positive identification of Escherichia coli in treated municipal wastewater and wastewater-irrigated soils AN - 1034816516; 16957570 AB - The increasing use of treated wastewater for irrigation heightens the importance of accurate monitoring of water quality. Chromogenic media, because they are easy to use and provide rapid results, are often used for detection of Escherichia coli in environmental samples, but unique levels of organic and inorganic compounds alter the chemistry of treated wastewater, potentially hindering the accurate performance of chromogenic media. We used MI agar and molecular confirmatory methods to assess false-positive identification of E. coli in treated wastewater samples collected from municipal utilities, an irrigation holding pond, irrigated soils, and in samples collected from storm flows destined for groundwater recharge. False-positive rates in storm flows (4.0%) agreed closely with USEPA technical literature but were higher in samples from the pond, soils, and treatment facilities (33.3%, 38.0%, and 48.8%, respectively). Sequencing of false-positive isolates confirmed that most were, like E. coli, of the family Enterobacteriaceae, and many of the false-positive isolates were reported to produce the beta -d-glucuronidase enzyme targeted by MI agar. False-positive identification rates were inversely related to air temperature, suggesting that seasonal variations in water quality influence E. coli identification. Knowledge of factors contributing to failure of chromogenic media will lead to manufacturer enhancements in media quality and performance and will ultimately increase the accuracy of future water quality monitoring programs.Original Abstract: L'utilisation croissante des eaux usees traitees a des fins d'irrigation accentue l'importance d'un suivi precis de la qualite de l'eau. Les milieux chromogenes, parce qu'ils sont faciles d'utilisation et qu'ils generent rapidement des resultats, sont souvent utilises pour detecter Escherichia coli dans les echantillons environnementaux, mais des niveaux particuliers de composes organiques ou inorganiques modifient la chimie des eaux usees traitees, nuisant potentiellement a la precision des milieux chromogenes. Nous avons utilise une gelose MI et des methodes moleculaires de confirmation pour evaluer l'identification faussement positive d'E. coli dans des echantillons d'eaux usees traitees, recoltes de services municipaux, d'un etang de retenue d'irrigation, de sols irrigues et de bassins d'orage, destines a la realimentation de la nappe phreatique. Le taux de faux positifs des bassins d'orage (4,0 %) concordait etroitement avec les donnees de la litterature technique de l'USEPA, mais les taux des echantillons provenant de l'etang, des sols et des uequipements de traitement etaient superieurs (33,3 %, 38,0 % et 48,8 %, respectivement). Le sequencage des isolats faussement positifs a confirme que la plupart d'entre eux appartenait, comme E. coli, a la famille des enterobacteries, plusieurs etant rapportes produire la beta -d-glucuronidase ciblee par la gelose MI. Les taux d'identification de faux positifs etaient inversement relies a la temperature de l'air, ce qui suggere que les variations saisonnieres de la qualite de l'eau influencent l'identification d'E. coli. La connaissance des facteurs qui contribuent a la defaillance des milieux chromogenes conduira les manufacturiers a ameliorer la qualite et la performance des milieux, et augmentera ultimement la precision des programmes de suivi de la qualite de l'eau. JF - Canadian Journal of Microbiology/Revue Canadienne de Microbiologie AU - McLain, Jean ET AU - Rock, Channah M AU - Lohse, Kathleen AU - Walworth, James AD - USDA-ARS, US Arid-Land Agricultural Research Center, 21881 North Cardon Lane, Maricopa, AZ 85138, USA., jean.mclain@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 775 EP - 784 PB - NRC Research Press VL - 57 IS - 10 SN - 0008-4166, 0008-4166 KW - Microbiology Abstracts B: Bacteriology; Pollution Abstracts; Environment Abstracts KW - Agar KW - Air temperature KW - Enzymes KW - Ground water KW - Groundwater recharge KW - Inorganic compounds KW - Irrigation KW - Municipal wastes KW - Pollution monitoring KW - Ponds KW - Seasonal variations KW - Soil KW - Storms KW - Waste water KW - Wastewater treatment KW - Water quality KW - Escherichia coli KW - Enterobacteriaceae KW - P 2000:FRESHWATER POLLUTION KW - J 02450:Ecology KW - ENA 01:Air Pollution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1034816516?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+Journal+of+Microbiology%2FRevue+Canadienne+de+Microbiologie&rft.atitle=False-positive+identification+of+Escherichia+coli+in+treated+municipal+wastewater+and+wastewater-irrigated+soils&rft.au=McLain%2C+Jean+ET%3BRock%2C+Channah+M%3BLohse%2C+Kathleen%3BWalworth%2C+James&rft.aulast=McLain&rft.aufirst=Jean&rft.date=2011-10-01&rft.volume=57&rft.issue=10&rft.spage=775&rft.isbn=&rft.btitle=&rft.title=Canadian+Journal+of+Microbiology%2FRevue+Canadienne+de+Microbiologie&rft.issn=00084166&rft_id=info:doi/10.1139%2Fw11-070 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-08-01 N1 - Number of references - 65 N1 - Last updated - 2012-10-08 N1 - SubjectsTermNotLitGenreText - Soil; Agar; Inorganic compounds; Irrigation; Ground water; Enzymes; Water quality; Waste water; Seasonal variations; Air temperature; Ponds; Pollution monitoring; Groundwater recharge; Municipal wastes; Storms; Wastewater treatment; Escherichia coli; Enterobacteriaceae DO - http://dx.doi.org/10.1139/w11-070 ER - TY - JOUR T1 - Growing Evidence for Human Health Benefits of Boron AN - 1023095937; 201217057 AB - Growing evidence from a variety of experimental models shows that boron is a bioactive and beneficial (perhaps essential) element for humans. Reported beneficial actions of boron include arthritis alleviation or risk reduction, bone growth and maintenance, central nervous system function, cancer risk reduction, hormone facilitation, and immune response, inflammation, and oxidative stress modulation. The diverse effects of boron indicate that it influences the formation and/or activity of an entity that is involved in many biochemical processes. Formation of boroesters with the ribose moiety of compounds involved in numerous reactions, such as S-adenosylmethionine and oxidized nicotinamide adenine dinucleotide (NAD+) might be the reason for boron bioactivity. Both animal and human data suggest that boron intakes should be >1.0 mg/d. Many people consume less than this amount. Thus, a low boron intake should be considered a health concern, which can be prevented by diets rich in fruits, vegetables, nuts, and pulses. Adapted from source document JF - Journal of Evidence-Based Complementary & Alternative Medicine AU - Nielsen, Forrest H AU - Meacham, Susan L Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 169 EP - 180 PB - Sage Publications, Inc. VL - 16 IS - 3 SN - 2156-5872, 2156-5872 KW - boron nutrition, action mechanisms, intakes, S-adenosylmethionine, NAD, boroesters, ribose KW - Central nervous system KW - Health problems KW - Healthy food KW - Bones KW - Risk reduction KW - Boron KW - article UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1023095937?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aassia&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Evidence-Based+Complementary+%26+Alternative+Medicine&rft.atitle=Growing+Evidence+for+Human+Health+Benefits+of+Boron&rft.au=Nielsen%2C+Forrest+H%3BMeacham%2C+Susan+L&rft.aulast=Nielsen&rft.aufirst=Forrest&rft.date=2011-10-01&rft.volume=16&rft.issue=3&rft.spage=169&rft.isbn=&rft.btitle=&rft.title=Journal+of+Evidence-Based+Complementary+%26+Alternative+Medicine&rft.issn=21565872&rft_id=info:doi/10.1177%2F2156587211407638 L2 - http://chp.sagepub.com/content/by/year LA - English DB - Applied Social Sciences Index & Abstracts (ASSIA) N1 - Date revised - 2012-07-01 N1 - Last updated - 2016-09-27 N1 - SubjectsTermNotLitGenreText - Boron; Healthy food; Risk reduction; Health problems; Central nervous system; Bones DO - http://dx.doi.org/10.1177/2156587211407638 ER - TY - JOUR T1 - Molybdenum Nutriture in Humans AN - 1023095690; 201217120 AB - Molybdenum is a trace element that functions as a cofactor for at least 4 enzymes: sulfite oxidase, xanthine oxidase, aldehyde oxidase, and mitochondrial amidoxime reducing component. In each case, molybdenum is bound to a complex, multiring organic component called molybdopterin, forming the entity molybdenum cofactor. The best sources of dietary molybdenum are legumes, grains, and nuts. Bioavailability of molybdenum is fairly high but depends on form, with molybdenum preparations having greater bioavailability than food-bound molybdenum. Molybdenum deficiency and toxicity are rare, possibly because of the body's ability to adapt to a wide range of molybdenum intake levels. At low intakes of molybdenum, the fractional transfer of molybdenum from plasma to urine is lower and a greater fraction is deposited into tissues, and at high intakes of molybdenum, the opposite occurs. Molybdenum has proven to be an interesting trace mineral that is essential for life. Adapted from source document JF - Journal of Evidence-Based Complementary & Alternative Medicine AU - Novotny, Janet A Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 164 EP - 168 PB - Sage Publications, Inc. VL - 16 IS - 3 SN - 2156-5872, 2156-5872 KW - bioavailability, cofactor, hyperuricemia, mineral, molybdenum, molybdopterin, nutrition, sulfite oxidase KW - Urine KW - Legumes KW - Grain KW - Nuts KW - Minerals KW - article UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1023095690?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aassia&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Evidence-Based+Complementary+%26+Alternative+Medicine&rft.atitle=Molybdenum+Nutriture+in+Humans&rft.au=Novotny%2C+Janet+A&rft.aulast=Novotny&rft.aufirst=Janet&rft.date=2011-10-01&rft.volume=16&rft.issue=3&rft.spage=164&rft.isbn=&rft.btitle=&rft.title=Journal+of+Evidence-Based+Complementary+%26+Alternative+Medicine&rft.issn=21565872&rft_id=info:doi/10.1177%2F2156587211406732 L2 - http://chp.sagepub.com/content/by/year LA - English DB - Applied Social Sciences Index & Abstracts (ASSIA) N1 - Date revised - 2012-07-01 N1 - Last updated - 2016-09-27 N1 - SubjectsTermNotLitGenreText - Minerals; Grain; Nuts; Urine; Legumes DO - http://dx.doi.org/10.1177/2156587211406732 ER - TY - JOUR T1 - Prevalence of Cardiovascular Disease Risk Factors Among Older Puerto Rican Adults Living in Massachusetts AN - 1010709420; 201209392 AB - There remains limited research on cardiovascular disease (CVD) risk factors in Puerto Rican adults. We compared lifestyle and CVD risk factors in Puerto Rican men and women with normal fasting glucose (NFG), impaired fasting glucose (IFG), or type 2 diabetes (T2D), and investigated achievement of American Diabetes Association (ADA) treatment goals in those with T2D. Baseline data from the Boston Puerto Rican Health Study were analyzed, which included 1,287 adults aged 45-75 years. Obesity, hyperglycemia, and dyslipidemia were prevalent and increased from NFG to IFG and T2D. In individuals without T2D, fasting insulin correlated significantly with body mass index. Achievement of ADA goals was poor; LDL cholesterol was most achieved (59.4%), followed by blood pressure (27.2%) and glycosylated hemoglobin (27.0%). Poverty, female sex, current alcohol use, and diabetes or anti-hypertensive medication use were associated with not meeting goals. Puerto Rican adults living in the Boston area showed several metabolic abnormalities and high CVD risk, likely due to pervasive obesity and socio-economic disparities. Adapted from the source document. JF - Journal of Immigrant and Minority Health AU - Rompay, Maria I AU - Castaneda-Sceppa, Carmen AU - McKeown, Nicola M AU - Ordovas, Jose M AU - Tucker, Katherine L AD - Nutrition and Genomics Laboratory, Jean Mayer USDA Human Nutrition Research Center on Aging, Tufts University, Boston, MA, USA Y1 - 2011/10// PY - 2011 DA - October 2011 SP - 825 EP - 833 PB - Springer, Dordrecht The Netherlands VL - 13 IS - 5 SN - 1557-1912, 1557-1912 KW - Goals KW - Type 2 diabetes mellitus KW - Risk factors KW - Puerto Rican people KW - Fasting KW - Cardiovascular diseases KW - article UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1010709420?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aassia&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Immigrant+and+Minority+Health&rft.atitle=Prevalence+of+Cardiovascular+Disease+Risk+Factors+Among+Older+Puerto+Rican+Adults+Living+in+Massachusetts&rft.au=Rompay%2C+Maria+I%3BCastaneda-Sceppa%2C+Carmen%3BMcKeown%2C+Nicola+M%3BOrdovas%2C+Jose+M%3BTucker%2C+Katherine+L&rft.aulast=Rompay&rft.aufirst=Maria&rft.date=2011-10-01&rft.volume=13&rft.issue=5&rft.spage=825&rft.isbn=&rft.btitle=&rft.title=Journal+of+Immigrant+and+Minority+Health&rft.issn=15571912&rft_id=info:doi/10.1007%2Fs10903-011-9448-7 LA - English DB - Applied Social Sciences Index & Abstracts (ASSIA) N1 - Date revised - 2012-05-01 N1 - Last updated - 2016-09-27 N1 - SubjectsTermNotLitGenreText - Puerto Rican people; Cardiovascular diseases; Goals; Fasting; Risk factors; Type 2 diabetes mellitus DO - http://dx.doi.org/10.1007/s10903-011-9448-7 ER - TY - JOUR T1 - Priority resource access mediates competitive intensity between an invasive weevil and native floral herbivores AN - 1008841628; 16491984 AB - Mechanisms underlying invasive species impacts remain incompletely understood. We tested the hypothesis that priority resource access by an invasive biocontrol weevil, Rhinocyllus conicus, intensifies and alters the outcome of competition with native floral herbivores over flower head resources of the non-target, native host plant Cirsium canescens, specifically with the predominant, synchronous tephritid fly Paracantha culta. Four main results emerged. First, we documented strong, asymmetric competition, with R. conicus out-competing P. culta. Second, weevil priority access to floral resources accelerated competitive suppression of P. culta. Evidence for competitive suppression with increased weevil priority included decreases in both the numbers and the total biomass of native flies, plus decreases in individual P. culta fly mass and, so, potential fitness. Third, we found evidence for three concurrent mechanisms underlying the competitive suppression of P. culta by R. conicus. Prior use of a flower head by R. conicus interfered with P. culta pre-oviposition behavior. Once oviposition occurred, the weevil also reduced fly post-oviposition performance. Preemptive resource exploitation occurred, shown by the significant effect of flower head size on the total number of insects developing and in the magnitude of R. conicus effects on P. culta. Interference also occurred, shown by a spatial shift of surviving P. culta individuals away from the preferred receptacle resources as R. conicus priority increased. Finally, fourth, using an individual-based model (IBM), we found that the competitive interactions documented have the potential for imposing demographic consequences, causing a reduction in P. culta population sizes. Thus, priority resource access by an invasive insect increased competitive impact on the predominant native insect in the invaded floral guild. This study also provides the first experimental evidence for non-target effects of a weed biological control agent on an associated native insect herbivore. JF - Biological Invasions AU - Louda, S M AU - Rand, T A AU - Kula, AAR AU - Arnett, A E AU - West, N M AU - Tenhumberg, B AD - School of Biological Sciences, University of Nebraska, Lincoln, NE, 68588, USA, tatyana.rand@ars.usda.gov Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 2233 EP - 2248 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 13 IS - 10 SN - 1387-3547, 1387-3547 KW - Entomology Abstracts; Sustainability Science Abstracts; Ecology Abstracts KW - Biological control KW - Biomass KW - Competition KW - Demography KW - Fitness KW - Flowers KW - Guilds KW - Head KW - Herbivores KW - Host plants KW - Introduced species KW - Invasions KW - Models KW - Oviposition KW - Receptacles KW - Resource exploitation KW - Weeds KW - competition KW - exploitation KW - flowers KW - herbivores KW - insects KW - invasions KW - invasive species KW - Cirsium canescens KW - Rhinocyllus conicus KW - Paracantha culta KW - M3 1010:Issues in Sustainable Development KW - Z 05330:Reproduction and Development KW - D 04060:Management and Conservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1008841628?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biological+Invasions&rft.atitle=Priority+resource+access+mediates+competitive+intensity+between+an+invasive+weevil+and+native+floral+herbivores&rft.au=Louda%2C+S+M%3BRand%2C+T+A%3BKula%2C+AAR%3BArnett%2C+A+E%3BWest%2C+N+M%3BTenhumberg%2C+B&rft.aulast=Louda&rft.aufirst=S&rft.date=2011-10-01&rft.volume=13&rft.issue=10&rft.spage=2233&rft.isbn=&rft.btitle=&rft.title=Biological+Invasions&rft.issn=13873547&rft_id=info:doi/10.1007%2Fs10530-011-0036-5 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Last updated - 2012-06-18 N1 - SubjectsTermNotLitGenreText - Biological control; Fitness; Weeds; Flowers; Head; Biomass; Resource exploitation; Host plants; Models; Demography; Herbivores; Guilds; Invasions; Receptacles; Introduced species; Oviposition; Competition; herbivores; invasive species; invasions; exploitation; flowers; insects; competition; Paracantha culta; Cirsium canescens; Rhinocyllus conicus DO - http://dx.doi.org/10.1007/s10530-011-0036-5 ER - TY - JOUR T1 - Plant community diversity and native plant abundance decline with increasing abundance of an exotic annual grass AN - 1008841178; 16491949 AB - Exotic plants are generally considered a serious problem in wildlands around the globe. However, some argue that the impacts of exotic plants have been exaggerated and that biodiversity and other important plant community characteristics are commonly improved with invasion. Thus, disagreement exists among ecologists as to the relationship of exotic plants with biodiversity and native plant communities. A better understanding of the relationships between exotic plants and native plant communities is needed to improve funding allocation and legislation regarding exotic plants, and justify and prioritize invasion management. To evaluate these relationships, 65 shrub-bunchgrass plant communities with varying densities of an exotic annual grass, Taeniatherum caput-medusae (L.) Nevski (medusahead), were sampled across 160,000 ha in southeastern Oregon, United States. Environmental factors were generally not correlated with plant community characteristics when exotic annual grass density was included in models. Plant diversity and species richness were negatively correlated with exotic annual grass density. Exotic annual grass density explained 62% of the variation in plant diversity. All native plant functional groups, except annual forbs, exhibited a negative relationship with T. caput-medusae. The results of this study suggest that T. caput-medusae invasions probably have substantial negative impacts on biodiversity and native plant communities. The strength of the relationships between plant community characteristics and T. caput-medusae density suggests that some exotic plants are a major force of change in plant communities and subsequently threaten ecosystem functions and processes. However, experimental studies are needed to fully substantiate that annual grass invasion is the cause of these observed correlations. JF - Oecologia AU - Davies, Kirk W AD - United States Department of Agriculture, Agricultural Research Service, Eastern Oregon Agricultural Research Center, 67826-A Hwy 205, Burns, OR, 97720, USA, kirk.davies@oregonstate.edu Y1 - 2011/10// PY - 2011 DA - Oct 2011 SP - 481 EP - 491 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 167 IS - 2 SN - 0029-8549, 0029-8549 KW - Sustainability Science Abstracts; Ecology Abstracts KW - plant diversity KW - Grasses KW - Forbs KW - Abundance KW - Biological diversity KW - Biodiversity KW - USA, Southeast KW - Environmental factors KW - ecologists KW - species richness KW - plant communities KW - Taeniatherum caput-medusae KW - Plant communities KW - invasions KW - Species richness KW - Legislation KW - M3 1010:Issues in Sustainable Development KW - D 04040:Ecosystem and Ecology Studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1008841178?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Oecologia&rft.atitle=Plant+community+diversity+and+native+plant+abundance+decline+with+increasing+abundance+of+an+exotic+annual+grass&rft.au=Davies%2C+Kirk+W&rft.aulast=Davies&rft.aufirst=Kirk&rft.date=2011-10-01&rft.volume=167&rft.issue=2&rft.spage=481&rft.isbn=&rft.btitle=&rft.title=Oecologia&rft.issn=00298549&rft_id=info:doi/10.1007%2Fs00442-011-1992-2 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-04-01 N1 - Last updated - 2015-09-03 N1 - SubjectsTermNotLitGenreText - Grasses; Forbs; Abundance; Plant communities; Biodiversity; Environmental factors; Legislation; Species richness; plant diversity; species richness; plant communities; Biological diversity; invasions; ecologists; Taeniatherum caput-medusae; USA, Southeast DO - http://dx.doi.org/10.1007/s00442-011-1992-2 ER - TY - JOUR T1 - Exposure to 16O-Particle Radiation Causes Aging-Like Decrements in Rats through Increased Oxidative Stress, Inflammation and Loss of Autophagy AN - 1492615699; 16388554 AB - Exposing young rats to particles of high energy and charge (HZE particles), a ground-based model for exposure to cosmic rays, enhances indices of oxidative stress and inflammation, disrupts the functioning of neuronal communication, and alters cognitive behaviors. Even though exposure to HZE particles occurs at low fluence rates, the cumulative effects of long-term exposure result in molecular changes similar to those seen in aged animals. In the present study, we assessed markers of autophagy, a dynamic process for intracellular degradation and recycling of toxic proteins and organelles, as well as stress and inflammatory responses, in the brains of Sprague-Dawley rats irradiated at 2 months of age with 5 and 50 cGy and 1 Gy of ionizing oxygen particles (16O) (1000 MeV/n). Compared to nonirradiated controls, exposure to 16O particles significantly inhibited autophagy function in the hippocampus as measured by accumulation of ubiquitin inclusion bodies such as P62/SQSTM1, autophagosome marker microtubule-associated protein 1 beta light chain 3 (MAP1B-LC3), beclin1 and proteins such as mammalian target of rapamycin (mTOR). The molecular changes measured at short (36 h) and long (75 days) intervals after 16O-particle exposure indicate that the loss of autophagy function occurred shortly after exposure but was recovered via inhibition of mTOR. However, HZE-particle radiation caused significant sustained loss of protein kinase C alpha (PKC- alpha ), a key G protein modulator involved in neuronal survival and functions of neuronal trophic factors. Exposure to 16O particles also caused substantial increases in the levels of nuclear factor kappa B (NF- Kappa B) and glial fibrillary acidic protein (GFAP), indicating glial cell activation 75 days after exposure. This is the first report to show the molecular effects of 16O-particle radiation on oxidative stress, inflammation and loss of autophagy in the brain of young rats. JF - Radiation Research AU - Poulose, Shibu M AU - Bielinski, Donna F AU - Carrihill-Knoll, Kirsty AU - Rabin, Bernard M AU - Shukitt-Hale, Barbara AD - USDA-ARS, Human Nutrition Research Center on Aging at Tufts University, Boston, Massachusetts 02111, Barbara.Shukitthale@@ars.usda.gov Y1 - 2011/09/30/ PY - 2011 DA - 2011 Sep 30 SP - 761 EP - 769 PB - Radiation Research Society VL - 176 IS - 6 SN - 0033-7587, 0033-7587 KW - Toxicology Abstracts KW - Brain KW - Phagocytosis KW - X:24390 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1492615699?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Radiation+Research&rft.atitle=Exposure+to+16O-Particle+Radiation+Causes+Aging-Like+Decrements+in+Rats+through+Increased+Oxidative+Stress%2C+Inflammation+and+Loss+of+Autophagy&rft.au=Poulose%2C+Shibu+M%3BBielinski%2C+Donna+F%3BCarrihill-Knoll%2C+Kirsty%3BRabin%2C+Bernard+M%3BShukitt-Hale%2C+Barbara&rft.aulast=Poulose&rft.aufirst=Shibu&rft.date=2011-09-30&rft.volume=176&rft.issue=6&rft.spage=761&rft.isbn=&rft.btitle=&rft.title=Radiation+Research&rft.issn=00337587&rft_id=info:doi/10.1667%2FRR2605.1 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-01-01 N1 - Number of references - 1 N1 - Last updated - 2014-02-21 N1 - SubjectsTermNotLitGenreText - Phagocytosis DO - http://dx.doi.org/10.1667/RR2605.1 ER - TY - JOUR T1 - Fast, low-pressure gas chromatography triple quadrupole tandem mass spectrometry for analysis of 150 pesticide residues in fruits and vegetables AN - 910783934; 15704558 AB - We developed and evaluated a new method of low-pressure gas chromatography-tandem mass spectrometry (LP-GC/MS-MS) using a triple quadrupole instrument for fast analysis of 150 relevant pesticides in four representative fruits and vegetables. This LP-GC (vacuum outlet) approach entails coupling a 10 m, 0.53 mm i.d., 1 mu m film analytical column between the MS transfer line and a 3 m, 0.15 mm i.d. capillary at the inlet. The MS creates a vacuum in the 10 m analytical column, which reduces the viscosity of the He carrier gas and thereby shifts the optimal flow rate to greater velocity. By taking advantage of the H sub(2-like properties of He under vacuum, the short analytical column, a rapid oven temperature ramp rate, and the high selectivity and sensitivity of MS/MS, 150 pesticides were separated in 6.5 min. The 2.5 ms dwell time and 1 ms interscan delay of the MS/MS instrument were critical for achieving 8 data points across the 2-3 s wide peaks. To keep dwell and cycle times constant across all peaks, each segment consisted of 30 analytes (60 transitions). For assessment, we injected extracts of spiked broccoli, cantaloupe, lemon, and sweet potato from the updated QuEChERS sample preparation method. Average recoveries (n = 72) were 70-120% for 144 of the pesticides, and reproducibilities were 20% RSD for all but 4 analytes. Also, detection limits were 5 ng/g for all but a few pesticides, depending on the matrix. In addition to high quality performance, the method gave excellent reliability and high sample throughput, including easy peak integration to obtain rapid results.) JF - Journal of Chromatography A AU - Koesukwiwat, Urairat AU - Lehotay, Steven J AU - Leepipatpiboon, Natchanun Y1 - 2011/09/28/ PY - 2011 DA - 2011 Sep 28 SP - 7039 EP - 7050 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 1218 IS - 39 SN - 0021-9673, 0021-9673 KW - ASFA 3: Aquatic Pollution & Environmental Quality; Water Resources Abstracts; Aqualine Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - QuEChERS KW - Sample throughput KW - Pesticide analysis KW - Vacuum-outlet gas chromatography KW - Triple quadrupole mass spectrometry KW - Mass Spectrometry KW - Outlets KW - Chromatographic techniques KW - Temperature KW - Mass spectroscopy KW - Agricultural Chemicals KW - Flow Rates KW - Assessments KW - Analytical Methods KW - Pesticides KW - Coastal inlets KW - Films KW - SW 5010:Network design KW - Q2 09403:Chemicals from sea water KW - Q5 08502:Methods and instruments KW - AQ 00003:Monitoring and Analysis of Water and Wastes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/910783934?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Chromatography+A&rft.atitle=Fast%2C+low-pressure+gas+chromatography+triple+quadrupole+tandem+mass+spectrometry+for+analysis+of+150+pesticide+residues+in+fruits+and+vegetables&rft.au=Koesukwiwat%2C+Urairat%3BLehotay%2C+Steven+J%3BLeepipatpiboon%2C+Natchanun&rft.aulast=Koesukwiwat&rft.aufirst=Urairat&rft.date=2011-09-28&rft.volume=1218&rft.issue=39&rft.spage=7039&rft.isbn=&rft.btitle=&rft.title=Journal+of+Chromatography+A&rft.issn=00219673&rft_id=info:doi/10.1016%2Fj.chroma.2011.07.094 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-10-01 N1 - Last updated - 2015-04-16 N1 - SubjectsTermNotLitGenreText - Chromatographic techniques; Pesticides; Coastal inlets; Mass spectroscopy; Mass Spectrometry; Outlets; Agricultural Chemicals; Assessments; Flow Rates; Analytical Methods; Temperature; Films DO - http://dx.doi.org/10.1016/j.chroma.2011.07.094 ER - TY - JOUR T1 - Immunoproteomic analysis of the antibody response obtained in Nile tilapia following vaccination with a Streptococcus iniae vaccine AN - 907170634; 15700117 AB - Streptococcus iniae is one of the most economically important Gram-positive pathogens in cultured fish species worldwide. The USDA-ARS Aquatic Animal Health Research Unit developed a modified (contains concentrated culture supernatant) S. iniae bacterin that has been demonstrated to be efficacious, and protection is mediated by specific anti-S. iniae antibodies. Although effective, the specific vaccine components important for efficacy are not known. In the present study, an immunoproteomic approach was utilized to identify whole-cell lysate proteins of S. iniae that stimulated specific antibody production in Nile tilapia (Oreochromis niloticus) following vaccination. Groups of tilapia were vaccinated by intraperitoneal injection with the modified S. iniae bacterin or were mock-vaccinated, and at 30 d post-vaccination sera samples were obtained from individual fish. Vaccination of tilapia with the S. iniae vaccine stimulated significantly elevated specific antibody responses against proteins of the bacterium and passive immunization of tilapia with this serum demonstrated the antibodies were highly protective. Whole-cell lysate proteins of S. iniae were separated by 2D-PAGE and were probed with a pooled serum sample from vaccinated tilapia. A total of eleven unique immunogenic proteins were positively identified by mass spectrometry. Based on research conducted on homologous proteins in other Streptococcus spp., antibodies specific for three of the identified proteins, enolase, glyceraldehyde-3-phosphate dehydrogenase, and fructose-bisphosphate aldolase, are likely involved in protection from streptococcosis caused by S. iniae. JF - Veterinary Microbiology AU - LaFrentz, Benjamin R AU - Shoemaker, Craig A AU - Klesius, Phillip H Y1 - 2011/09/28/ PY - 2011 DA - 2011 Sep 28 SP - 346 EP - 352 PB - Elsevier B.V., P.O. Box 211 Amsterdam 1000 AE Netherlands VL - 152 IS - 3-4 SN - 0378-1135, 0378-1135 KW - Immunology Abstracts; ASFA 1: Biological Sciences & Living Resources; ASFA Aquaculture Abstracts; Microbiology Abstracts B: Bacteriology KW - Streptococcus iniae KW - Immunoproteomic KW - Vaccine KW - Nile tilapia KW - Aquatic animals KW - Disease control KW - Mass spectroscopy KW - Glyceraldehyde-3-phosphate dehydrogenase KW - Brackishwater fish KW - Fructose-bisphosphate aldolase KW - Streptococcus KW - Bacterins KW - Brackish KW - Antibody response KW - Pathogens KW - Vaccination KW - Aquaculture economics KW - Antibodies KW - Immunogenicity KW - Serum KW - Immunization (passive) KW - Vaccines KW - Phosphopyruvate hydratase KW - Oreochromis niloticus KW - Q1 08485:Species interactions: pests and control KW - J 02350:Immunology KW - F 06910:Microorganisms & Parasites KW - Q3 08587:Diseases of Cultured Organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/907170634?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Veterinary+Microbiology&rft.atitle=Immunoproteomic+analysis+of+the+antibody+response+obtained+in+Nile+tilapia+following+vaccination+with+a+Streptococcus+iniae+vaccine&rft.au=LaFrentz%2C+Benjamin+R%3BShoemaker%2C+Craig+A%3BKlesius%2C+Phillip+H&rft.aulast=LaFrentz&rft.aufirst=Benjamin&rft.date=2011-09-28&rft.volume=152&rft.issue=3-4&rft.spage=346&rft.isbn=&rft.btitle=&rft.title=Veterinary+Microbiology&rft.issn=03781135&rft_id=info:doi/10.1016%2Fj.vetmic.2011.04.033 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2011-11-01 N1 - Last updated - 2014-09-18 N1 - SubjectsTermNotLitGenreText - Aquaculture economics; Antibodies; Bacterins; Serum; Disease control; Pathogens; Vaccines; Brackishwater fish; Vaccination; Aquatic animals; Glyceraldehyde-3-phosphate dehydrogenase; Immunogenicity; Immunization (passive); Antibody response; Phosphopyruvate hydratase; Fructose-bisphosphate aldolase; Mass spectroscopy; Streptococcus; Streptococcus iniae; Oreochromis niloticus; Brackish DO - http://dx.doi.org/10.1016/j.vetmic.2011.04.033 ER - TY - JOUR T1 - Contact and fumigant toxicity of a botanical-based feeding deterrent of the stable fly, Stomoxys calcitrans (Diptera: Muscidae). AN - 893719304; 21848320 AB - The stable fly, Stomoxys calcitrans (L.), has been considered one of the most serious biting flies of confined and pastured livestock. The economic losses caused by the stable fly to the cattle industry in the United States exceed $2 billion annually. Current practices for managing stable flies using insecticides provide only marginal control. Insecticide resistance has also been recently reported in stable flies. The present study reports the use of plant-based insecticides, for example, essential oils, as alternatives for managing this fly pest. The toxicity of several plant essential oils and selected ingredient compounds was evaluated by contact and fumigant toxicity bioassays. Catnip oil (20 mg dosage) showed the highest toxicity against stable flies, the shortest knock-down time (∼7 min), and the quickest lethal time (∼19 min). Toxicity levels similar to catnip oil were found among three insect repellent compounds (N,N-diethyl-3-methylbenzamide, 2-methylpiperidinyl-3-cyclohexene-1-carboxamide, (1S,2'S)-2-methylpiperidinyl-3-cyclohexene-1-carboxamide). No differences in knock-down and lethal times were found among the catnip oil and its two active ingredient compounds. Similar stable fly mortality was observed using a 20 mg dose of catnip oil in a modified K&D system and a fumigant jar. When catnip oil was topically applied to stable flies, the least lethal dose was 12.5 μg/fly, and a 50 μg/fly dose resulted in 100% mortality. The blood-feeding behavior of stable flies was also negatively affected by the topical application of catnip oil, and the effect was dose-dependent. This study demonstrated that catnip oil has both contact and fumigant toxicity against the stable fly and thus has the potential as an alternative for stable fly control. JF - Journal of agricultural and food chemistry AU - Zhu, Junwei J AU - Li, Andrew Y AU - Pritchard, Sara AU - Tangtrakulwanich, Khanobporn AU - Baxendale, Frederick P AU - Brewer, Gary AD - Agroecosystem Management Research Unit, Agricultural Research Service, U.S. Department of Agriculture, Lincoln, Nebraska 68583, United States. Jerry.Zhu@ars.usda.gov Y1 - 2011/09/28/ PY - 2011 DA - 2011 Sep 28 SP - 10394 EP - 10400 VL - 59 IS - 18 KW - Insect Repellents KW - 0 KW - Insecticides KW - Oils, Volatile KW - Plant Oils KW - Index Medicus KW - Animals KW - Cattle KW - Oils, Volatile -- administration & dosage KW - Nepeta -- chemistry KW - Time Factors KW - Feeding Behavior -- drug effects KW - Fumigation KW - Insecticides -- administration & dosage KW - Plant Oils -- administration & dosage KW - Muscidae -- physiology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/893719304?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+agricultural+and+food+chemistry&rft.atitle=Contact+and+fumigant+toxicity+of+a+botanical-based+feeding+deterrent+of+the+stable+fly%2C+Stomoxys+calcitrans+%28Diptera%3A+Muscidae%29.&rft.au=Zhu%2C+Junwei+J%3BLi%2C+Andrew+Y%3BPritchard%2C+Sara%3BTangtrakulwanich%2C+Khanobporn%3BBaxendale%2C+Frederick+P%3BBrewer%2C+Gary&rft.aulast=Zhu&rft.aufirst=Junwei&rft.date=2011-09-28&rft.volume=59&rft.issue=18&rft.spage=10394&rft.isbn=&rft.btitle=&rft.title=Journal+of+agricultural+and+food+chemistry&rft.issn=1520-5118&rft_id=info:doi/10.1021%2Fjf2016122 LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2012-01-13 N1 - Date created - 2011-09-21 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 DO - http://dx.doi.org/10.1021/jf2016122 ER - TY - CPAPER T1 - RosBREED Deploys Genome-wide Scans in Peach, Apple, and Cherry T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1313000815; 6041973 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Bassil, Nahla AU - Peace, Cameron AU - Main, Doreen AU - Gilmore, Barbara AU - Mockler, Todd AU - Wilhelm, Larry AU - Chagne, David AU - Gardiner, Susan AU - Crowhurst, Ross AU - Verde, Ignazio AU - Sosinski, Bryon AU - Morgante, Michele AU - Scalabrin, Simone AU - Arus, Pere AU - Velasco, Riccardo AU - Troggio, Michela AU - Cestaro, Alessandro AU - Ficklin, Stephen AU - Fazio, Gennaro AU - Norelli, John AU - Rees, Jasper AU - Lawley, Cindy AU - Hansen, Mark AU - Iezzoni, Amy Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Ash KW - Food KW - Malus KW - Prunus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1313000815?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=RosBREED+Deploys+Genome-wide+Scans+in+Peach%2C+Apple%2C+and+Cherry&rft.au=Bassil%2C+Nahla%3BPeace%2C+Cameron%3BMain%2C+Doreen%3BGilmore%2C+Barbara%3BMockler%2C+Todd%3BWilhelm%2C+Larry%3BChagne%2C+David%3BGardiner%2C+Susan%3BCrowhurst%2C+Ross%3BVerde%2C+Ignazio%3BSosinski%2C+Bryon%3BMorgante%2C+Michele%3BScalabrin%2C+Simone%3BArus%2C+Pere%3BVelasco%2C+Riccardo%3BTroggio%2C+Michela%3BCestaro%2C+Alessandro%3BFicklin%2C+Stephen%3BFazio%2C+Gennaro%3BNorelli%2C+John%3BRees%2C+Jasper%3BLawley%2C+Cindy%3BHansen%2C+Mark%3BIezzoni%2C+Amy&rft.aulast=Bassil&rft.aufirst=Nahla&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Postharvest Ripening and Fermentation of Noni Fruit (Morinda citrifolia) in Hawaii T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312999828; 6042361 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Nishijima, Kate AU - Wall, Marisa Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - USA, Hawaii KW - Fermentation KW - fruits KW - Fruits KW - Ripening KW - Morinda citrifolia UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312999828?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Postharvest+Ripening+and+Fermentation+of+Noni+Fruit+%28Morinda+citrifolia%29+in+Hawaii&rft.au=Nishijima%2C+Kate%3BWall%2C+Marisa&rft.aulast=Nishijima&rft.aufirst=Kate&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Highbush and Half-high Blueberry Trials on Alaska's Kenai Peninsula T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312999509; 6042386 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Barney, Danny AU - Hummer, Kim Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - USA, Alaska, Kenai Peninsula KW - USA, Alaska KW - Ash KW - Food KW - Vaccinium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312999509?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Highbush+and+Half-high+Blueberry+Trials+on+Alaska%27s+Kenai+Peninsula&rft.au=Barney%2C+Danny%3BHummer%2C+Kim&rft.aulast=Barney&rft.aufirst=Danny&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Applying Untargeted Metabolic Profi ling to Depict Metabolism During Apple Storage T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312998735; 6041849 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Rudell, David Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Metabolism KW - Storage KW - Malus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998735?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Applying+Untargeted+Metabolic+Profi+ling+to+Depict+Metabolism+During+Apple+Storage&rft.au=Rudell%2C+David&rft.aulast=Rudell&rft.aufirst=David&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Use of Irradiation as a Quarantine Treatment for Tropical Fruit and Vegetable Crops T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312998450; 6041928 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Follett, Peter Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - fruits KW - Irradiation KW - Crops KW - Vegetables KW - Quarantine KW - Fruits UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312998450?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Use+of+Irradiation+as+a+Quarantine+Treatment+for+Tropical+Fruit+and+Vegetable+Crops&rft.au=Follett%2C+Peter&rft.aulast=Follett&rft.aufirst=Peter&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Mentoring At the USDA/ARS T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312997411; 6041837 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Hummer, Kim Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Ash KW - Food UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312997411?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Mentoring+At+the+USDA%2FARS&rft.au=Hummer%2C+Kim&rft.aulast=Hummer&rft.aufirst=Kim&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Maintaining Fresh-Cut Wash Water Quality and Sanitizer Effi cacy via Rinsing before Washing T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312994635; 6042110 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Luo, Yaguang AU - Yang, Yang Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Sanitation KW - Water quality KW - Sanitizers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312994635?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Maintaining+Fresh-Cut+Wash+Water+Quality+and+Sanitizer+Effi+cacy+via+Rinsing+before+Washing&rft.au=Luo%2C+Yaguang%3BYang%2C+Yang&rft.aulast=Luo&rft.aufirst=Yaguang&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Genotypic Diversity in the Seasonal Expression of Five Peach Dehydrin Genes T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312992758; 6042203 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Bassett, Carole AU - Gasic, Ksenija AU - Wisniewski, Michael Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Seasonal variations KW - Sulfur dioxide KW - Dehydrin KW - Genetic diversity KW - Prunus UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312992758?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Genotypic+Diversity+in+the+Seasonal+Expression+of+Five+Peach+Dehydrin+Genes&rft.au=Bassett%2C+Carole%3BGasic%2C+Ksenija%3BWisniewski%2C+Michael&rft.aulast=Bassett&rft.aufirst=Carole&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Comparison of MatK Sequences and TRAP Molecular Markers for the Taxonomic Characterization of Six Species of the Allium Section Cepa (Mill.) Prokh. Complex T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312992629; 6042200 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Kisha, Theodore AU - Hellier, Barbara AU - Tank, David AU - Hu, Jinguo Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - taxonomy KW - Acid phosphatase (tartrate-resistant) KW - Nucleotide sequence KW - Allium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312992629?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Comparison+of+MatK+Sequences+and+TRAP+Molecular+Markers+for+the+Taxonomic+Characterization+of+Six+Species+of+the+Allium+Section+Cepa+%28Mill.%29+Prokh.+Complex&rft.au=Kisha%2C+Theodore%3BHellier%2C+Barbara%3BTank%2C+David%3BHu%2C+Jinguo&rft.aulast=Kisha&rft.aufirst=Theodore&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Comparison of Tillage Implements to Incorporate Broadcast Cover Crop Seed for Small-Scale Vegetable Growers T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312992543; 6042198 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Brennan, Eric AU - Leap, Jim Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - tillage KW - Crops KW - Vegetables KW - Cover crops KW - Seeds KW - Tillage UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312992543?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Comparison+of+Tillage+Implements+to+Incorporate+Broadcast+Cover+Crop+Seed+for+Small-Scale+Vegetable+Growers&rft.au=Brennan%2C+Eric%3BLeap%2C+Jim&rft.aulast=Brennan&rft.aufirst=Eric&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Characterization of the Floral Induction Mechanism of Longan T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312985119; 6042572 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Heller, Wade AU - Matsumoto, Tracie Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Ash KW - Food UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312985119?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Characterization+of+the+Floral+Induction+Mechanism+of+Longan&rft.au=Heller%2C+Wade%3BMatsumoto%2C+Tracie&rft.aulast=Heller&rft.aufirst=Wade&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Yield and Fruit Quality Traits of Mamey Sapote Grown at Two Locations in Puerto Rico T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312985089; 6042571 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Goenaga, Ricardo AU - Jenkins, David AU - Marrero, Angel Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Caribbean Sea, Greater Antilles, Puerto Rico KW - fruits KW - Fruits UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312985089?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Yield+and+Fruit+Quality+Traits+of+Mamey+Sapote+Grown+at+Two+Locations+in+Puerto+Rico&rft.au=Goenaga%2C+Ricardo%3BJenkins%2C+David%3BMarrero%2C+Angel&rft.aulast=Goenaga&rft.aufirst=Ricardo&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Tropical Crop Quality after Quarantine Treatment Using Irradiation T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312984242; 6041929 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Wall, Marisa Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Irradiation KW - Crops KW - Quarantine KW - Radiation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312984242?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Tropical+Crop+Quality+after+Quarantine+Treatment+Using+Irradiation&rft.au=Wall%2C+Marisa&rft.aulast=Wall&rft.aufirst=Marisa&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - WUE in Blackberries Is Improved by the Use of Weed Barriers and Seasonal Shading T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312978889; 6042541 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Makus, Donald AU - Zibilske, Larry Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Seasonal variations KW - shading KW - weeds KW - Sulfur dioxide KW - Shading KW - Weeds KW - Barriers UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312978889?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=WUE+in+Blackberries+Is+Improved+by+the+Use+of+Weed+Barriers+and+Seasonal+Shading&rft.au=Makus%2C+Donald%3BZibilske%2C+Larry&rft.aulast=Makus&rft.aufirst=Donald&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Developing a Successful Research Program in USDA/ARS T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312976680; 6041832 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Franz, Jonathan Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Research programs UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312976680?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Developing+a+Successful+Research+Program+in+USDA%2FARS&rft.au=Franz%2C+Jonathan&rft.aulast=Franz&rft.aufirst=Jonathan&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Expectations for Promotion of USDA/ARS Scientists T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312976578; 6041829 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Gonsalves, Dennis Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Ash KW - Food UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312976578?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Expectations+for+Promotion+of+USDA%2FARS+Scientists&rft.au=Gonsalves%2C+Dennis&rft.aulast=Gonsalves&rft.aufirst=Dennis&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Genome Size in Anthurium species Evaluated in the Context of Karyotypes and Phenotypes T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312972627; 6042627 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Bliss, Barbara AU - Suzuki, Jon Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - karyotypes KW - Genomes KW - Karyotypes KW - Phenotypes KW - Anthurium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312972627?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Genome+Size+in+Anthurium+species+Evaluated+in+the+Context+of+Karyotypes+and+Phenotypes&rft.au=Bliss%2C+Barbara%3BSuzuki%2C+Jon&rft.aulast=Bliss&rft.aufirst=Barbara&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Infl uence of Fe Source on Marigold Nutrition, Substrate Chemistry, and Nutrient Runoff: Cu, Fe, Mn, and Zn T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312970789; 6042442 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Albano, Joseph Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Zinc KW - Nutrition KW - Runoff KW - Manganese UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312970789?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Infl+uence+of+Fe+Source+on+Marigold+Nutrition%2C+Substrate+Chemistry%2C+and+Nutrient+Runoff%3A+Cu%2C+Fe%2C+Mn%2C+and+Zn&rft.au=Albano%2C+Joseph&rft.aulast=Albano&rft.aufirst=Joseph&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Nutrient Uptake and Use in Young 'Pinot Noir' Grapevines T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312969323; 6042254 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Schreiner, R AU - Lee, Jungmin Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Nutrient uptake KW - Uptake KW - Vitaceae UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312969323?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Nutrient+Uptake+and+Use+in+Young+%27Pinot+Noir%27+Grapevines&rft.au=Schreiner%2C+R%3BLee%2C+Jungmin&rft.aulast=Schreiner&rft.aufirst=R&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Field Evidence for Lateral Transfer of Water and Nutrients in Highbush Blueberry T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312968932; 6042003 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Bryla, David AU - Leitzke, Luciane Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Nutrients KW - Vaccinium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312968932?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Field+Evidence+for+Lateral+Transfer+of+Water+and+Nutrients+in+Highbush+Blueberry&rft.au=Bryla%2C+David%3BLeitzke%2C+Luciane&rft.aulast=Bryla&rft.aufirst=David&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - In Vitro Storage and Cryopreservation of 'Ohelo Seed and Tissue Cultures T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312968471; 6042477 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Reed, Barbara AU - Uchendu, Esther AU - Wada, Sugae AU - Zee, Francis Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Storage KW - Tissue culture KW - Seeds KW - Cryopreservation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312968471?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=In+Vitro+Storage+and+Cryopreservation+of+%27Ohelo+Seed+and+Tissue+Cultures&rft.au=Reed%2C+Barbara%3BUchendu%2C+Esther%3BWada%2C+Sugae%3BZee%2C+Francis&rft.aulast=Reed&rft.aufirst=Barbara&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - The Effects of Pre-Sowing Treatments on Tamarind (Tamarindus indica L.) Seed Germination T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312967581; 6042079 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Ayala-Silva, Tomas AU - Schnell, Raymond AU - Gordon, Garry AU - Gubbuk, Hamide AU - Gozlekci, Sadiye Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - seed germination KW - Seed germination KW - Germination KW - Seeds KW - Tamarindus indica UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312967581?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=The+Effects+of+Pre-Sowing+Treatments+on+Tamarind+%28Tamarindus+indica+L.%29+Seed+Germination&rft.au=Ayala-Silva%2C+Tomas%3BSchnell%2C+Raymond%3BGordon%2C+Garry%3BGubbuk%2C+Hamide%3BGozlekci%2C+Sadiye&rft.aulast=Ayala-Silva&rft.aufirst=Tomas&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Molecular and Biochemical Tools for Characterization and Cultivar Improvement of Anthurium andraeanum Hort. T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312967225; 6042126 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Suzuki, Jon AU - Bliss, Barbara AU - Clark, Benjamin AU - Borris, Robert AU - Gonsalves, Dennis Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - cultivars KW - Biochemistry KW - Anthurium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312967225?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Molecular+and+Biochemical+Tools+for+Characterization+and+Cultivar+Improvement+of+Anthurium+andraeanum+Hort.&rft.au=Suzuki%2C+Jon%3BBliss%2C+Barbara%3BClark%2C+Benjamin%3BBorris%2C+Robert%3BGonsalves%2C+Dennis&rft.aulast=Suzuki&rft.aufirst=Jon&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Variation in Antioxidant Enzyme Activities among Blueberry Cultivars (Vaccinium species) T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312961230; 6042514 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Wang, Shiow AU - Chen, Hangjun AU - Ehlenfeldt, Mark Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - cultivars KW - enzymatic activity KW - Antioxidants KW - Enzymatic activity KW - Vaccinium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312961230?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Variation+in+Antioxidant+Enzyme+Activities+among+Blueberry+Cultivars+%28Vaccinium+species%29&rft.au=Wang%2C+Shiow%3BChen%2C+Hangjun%3BEhlenfeldt%2C+Mark&rft.aulast=Wang&rft.aufirst=Shiow&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Antioxidant Capacities and Flavonoid Constituents of Various Blueberry Cultivars (Vaccinium species) T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312961192; 6042513 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Wang, Shiow AU - Chen, Hangjun AU - Ehlenfeldt, Mark AU - Camp, Mary Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - flavonoids KW - cultivars KW - Antioxidants KW - Flavonoids KW - Vaccinium UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312961192?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Antioxidant+Capacities+and+Flavonoid+Constituents+of+Various+Blueberry+Cultivars+%28Vaccinium+species%29&rft.au=Wang%2C+Shiow%3BChen%2C+Hangjun%3BEhlenfeldt%2C+Mark%3BCamp%2C+Mary&rft.aulast=Wang&rft.aufirst=Shiow&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Range of Black Raspberry (Rubus occidentalis L.) Anthocyanin Content from 26 Seedling Populations T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312961145; 6042512 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Lee, Jungmin AU - Dossett, Michael AU - Finn, Chad Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Seedlings KW - Anthocyanins KW - Rubus occidentalis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312961145?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Range+of+Black+Raspberry+%28Rubus+occidentalis+L.%29+Anthocyanin+Content+from+26+Seedling+Populations&rft.au=Lee%2C+Jungmin%3BDossett%2C+Michael%3BFinn%2C+Chad&rft.aulast=Lee&rft.aufirst=Jungmin&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Sustainable Production and Utilization of 'Ohelo As an Edible Berry and Ornamental Crop T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312959597; 6041907 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Zee, Francis AU - Keith, Lisa AU - Strauss, Amy AU - Arakawa, Claire AU - Foote, Tristan AU - Hummer, Kim AU - Reed, Barbara AU - Bassil, Nahla AU - Nakamoto, Stuart AU - Hamasaki, Randall AU - Kawabata, Andrew AU - Durst, Bob AU - Ikawa, Allan AU - Silva, Jodi AU - Love, Ken AU - Chang, Yongjiang Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Sustainable development KW - Crops KW - Fruits UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312959597?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Sustainable+Production+and+Utilization+of+%27Ohelo+As+an+Edible+Berry+and+Ornamental+Crop&rft.au=Zee%2C+Francis%3BKeith%2C+Lisa%3BStrauss%2C+Amy%3BArakawa%2C+Claire%3BFoote%2C+Tristan%3BHummer%2C+Kim%3BReed%2C+Barbara%3BBassil%2C+Nahla%3BNakamoto%2C+Stuart%3BHamasaki%2C+Randall%3BKawabata%2C+Andrew%3BDurst%2C+Bob%3BIkawa%2C+Allan%3BSilva%2C+Jodi%3BLove%2C+Ken%3BChang%2C+Yongjiang&rft.aulast=Zee&rft.aufirst=Francis&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Transgenic Papaya in Hawaii: From the Beginning to the Future T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312958202; 6041923 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Gonsalves, Dennis Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - USA, Hawaii KW - Ash KW - Food UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312958202?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Transgenic+Papaya+in+Hawaii%3A+From+the+Beginning+to+the+Future&rft.au=Gonsalves%2C+Dennis&rft.aulast=Gonsalves&rft.aufirst=Dennis&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Characterization of the SR/CAMTA Gene Family in Tomato: Cloning, Gene Expression, and Calcium Regulation T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312952600; 6042192 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Yang, Tianbao AU - Peng, Hui AU - Whitaker, Bruce AU - Conway, William Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Calcium KW - Gene families KW - Gene expression KW - Lycopersicon esculentum UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312952600?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Characterization+of+the+SR%2FCAMTA+Gene+Family+in+Tomato%3A+Cloning%2C+Gene+Expression%2C+and+Calcium+Regulation&rft.au=Yang%2C+Tianbao%3BPeng%2C+Hui%3BWhitaker%2C+Bruce%3BConway%2C+William&rft.aulast=Yang&rft.aufirst=Tianbao&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Population Structure and Conservation of Wild Pyrus communis T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312952562; 6042206 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Volk, Gayle AU - Richards, Christopher AU - Cruz, Von AU - Bassil, Nahla AU - Postman, J Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Conservation KW - population structure KW - Population structure KW - Pyrus communis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312952562?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Population+Structure+and+Conservation+of+Wild+Pyrus+communis&rft.au=Volk%2C+Gayle%3BRichards%2C+Christopher%3BCruz%2C+Von%3BBassil%2C+Nahla%3BPostman%2C+J&rft.aulast=Volk&rft.aufirst=Gayle&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Production and Short-Term Storage of Synthetic Seeds from Encapsulated Begonia Shoot Tips T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312952282; 6042338 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Sakhanokho, Hamidou AU - Pounders, Cecil AU - Spiers, James Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Shoots KW - Storage KW - Seeds KW - Begonia UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312952282?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Production+and+Short-Term+Storage+of+Synthetic+Seeds+from+Encapsulated+Begonia+Shoot+Tips&rft.au=Sakhanokho%2C+Hamidou%3BPounders%2C+Cecil%3BSpiers%2C+James&rft.aulast=Sakhanokho&rft.aufirst=Hamidou&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2013-02-26 N1 - Last updated - 2013-02-28 ER - TY - CPAPER T1 - Iron Induced Nickel Deficiency T2 - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AN - 1312951845; 6042044 JF - 2011 Annual Meeting of the American Society for Horticultural Science (ASHS 2011) AU - Wood, Bruce Y1 - 2011/09/25/ PY - 2011 DA - 2011 Sep 25 KW - Iron KW - Nickel KW - Nutrient deficiency UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1312951845?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.atitle=Iron+Induced+Nickel+Deficiency&rft.au=Wood%2C+Bruce&rft.aulast=Wood&rft.aufirst=Bruce&rft.date=2011-09-25&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=2011+Annual+Meeting+of+the+American+Society+for+Horticultural+Science+%28ASHS+2011%29&rft.issn=&rft_id=info:doi/ L2 - http://ashs.org/downloads/2011ASHS_Conference_abstracts.pdf LA - English DB - ProQuest Environmental Science Collection N