TY - JOUR T1 - Metastatic peripheral primitive neuroectodermal tumor (PNET) masquerading as liver abscess: a case report of liver metastasis in orbital PNET. AN - 85374975; pmid-12080235 AB - Adult primitive neuroectodermal tumor (PNET) of the orbit is an extremely rare malignant tumor. We report the case of a 37-year-old woman with PNET metastasis of the liver 3 years after treatment of the primary right intraconal orbital PNET with resection and chemoradiation adjuvant therapy. Literature review revealed eight previous cases of orbital PNET, but this is the first case report of liver metastasis arising from orbital PNET. JF - Journal of clinical gastroenterology AU - Hyun, Chris B AU - Lee, Y Renee AU - Bemiller, Timothy A AD - Department of Internal Medicine, Gastroenterology Division, Naval Medical Center San Diego, California 92134-1005, USA. cbhyun@nmcsd.med.navy.mil Y1 - 2002/07// PY - 2002 DA - Jul 2002 SP - 93 EP - 97 VL - 35 IS - 1 SN - 0192-0790, 0192-0790 KW - Index Medicus KW - National Library of Medicine KW - Adult KW - Diagnosis, Differential KW - Female KW - Humans KW - *Liver Abscess: diagnosis KW - *Liver Neoplasms: diagnosis KW - *Liver Neoplasms: secondary KW - *Neuroectodermal Tumors, Primitive, Peripheral: diagnosis KW - *Neuroectodermal Tumors, Primitive, Peripheral: secondary KW - *Orbital Neoplasms: pathology KW - Orbital Neoplasms: therapy KW - *Puerperal Disorders: etiology KW - Time Factors KW - Tomography, X-Ray Computed UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85374975?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+clinical+gastroenterology&rft.atitle=Metastatic+peripheral+primitive+neuroectodermal+tumor+%28PNET%29+masquerading+as+liver+abscess%3A+a+case+report+of+liver+metastasis+in+orbital+PNET.&rft.au=Hyun%2C+Chris+B%3BLee%2C+Y+Renee%3BBemiller%2C+Timothy+A&rft.aulast=Hyun&rft.aufirst=Chris&rft.date=2002-07-01&rft.volume=35&rft.issue=1&rft.spage=93&rft.isbn=&rft.btitle=&rft.title=Journal+of+clinical+gastroenterology&rft.issn=01920790&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Scanning ultraviolet two-step laser mass spectroscopy of polycyclic aromatic hydrocarbon distributions on creosote-contaminated soil particles. AN - 71955896; 12141660 AB - The distribution of polycyclic aromatic hydrocarbons (PAHs) on creosote-contaminated soil has been examined with scanning ultraviolet two-step laser desorption/laser ionization mass spectroscopy (UV-L2MS). The instrument has been constructed in-house by modifying a reflectron time-of-flight mass spectrometer. Two-dimensional chemical maps were accurately generated from model patterned PAH distributions. From examination of three-dimensional substrates, the depth of field of the experiment allows surfaces with roughness of up to 120 microm to be treated as a two-dimensional system and still achieve an accurate representation of the surface deposits. Soil was obtained from a former wood treatment facility. Individual particles of 100-1000 microm were mounted on indexed sample plates and examined by reflectance infrared microscopy, optical microscopy, and imaging UV-L2MS. The most intense PAH signals were associated with regions on the particles where clay/organic carbon deposits were found. JF - Analytical chemistry AU - Fye, J L AU - Nelson, H H AU - Mowery, R L AU - Baronavski, A P AU - Callahan, J H AD - Naval Research Laboratory, Chemistry Division, Washington, DC 20375-5342, USA. Y1 - 2002/07/01/ PY - 2002 DA - 2002 Jul 01 SP - 3019 EP - 3029 VL - 74 IS - 13 SN - 0003-2700, 0003-2700 KW - Polycyclic Aromatic Hydrocarbons KW - 0 KW - Soil KW - Soil Pollutants KW - Creosote KW - 8021-39-4 KW - Index Medicus KW - Spectrophotometry, Infrared KW - Spectrophotometry, Ultraviolet KW - Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization KW - Image Processing, Computer-Assisted KW - Creosote -- analysis KW - Polycyclic Aromatic Hydrocarbons -- analysis KW - Soil -- analysis KW - Soil Pollutants -- analysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71955896?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Analytical+chemistry&rft.atitle=Scanning+ultraviolet+two-step+laser+mass+spectroscopy+of+polycyclic+aromatic+hydrocarbon+distributions+on+creosote-contaminated+soil+particles.&rft.au=Fye%2C+J+L%3BNelson%2C+H+H%3BMowery%2C+R+L%3BBaronavski%2C+A+P%3BCallahan%2C+J+H&rft.aulast=Fye&rft.aufirst=J&rft.date=2002-07-01&rft.volume=74&rft.issue=13&rft.spage=3019&rft.isbn=&rft.btitle=&rft.title=Analytical+chemistry&rft.issn=00032700&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-09-06 N1 - Date created - 2002-07-26 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Controlled breaks as a fatigue countermeasure on the flight deck. AN - 71948690; 12137101 AB - A major challenge for flight crews is the need to maintain vigilance during long, highly automated nighttime flights. No system currently exists to assist in managing alertness, and countermeasure options are limited. Surveys reveal many pilots use breaks as an in-flight countermeasure, but there have been no controlled studies of their effectiveness. We hypothesized that brief, regular breaks could improve alertness and performance during an overnight flight. A 6-h, uneventful, nighttime flight in a Boeing 747-400 flight simulator was flown by fourteen two-man crews. The 14 subjects in the treatment group received 5 short breaks spaced hourly during cruise; the 14 subjects in the control group received 1 break in the middle of cruise. Continuous EEG/EOG, subjective sleepiness, and psychomotor vigilance performance data were collected. During the latter part of the night, the treatment group showed significant reductions for 15 min post-break in slow eye movements, theta-band activity, and unintended sleep episodes compared with the control group. The treatment group reported significantly greater subjective alertness for up to 25 min post-break, with strongest effects near the time of the circadian trough. There was no evidence of objective vigilance performance improvement at 15-25 min post-break, with expected performance deterioration occurring due to elevated sleep drive and circadian time. The physiological and subjective data indicate the breaks reduced nighttime sleepiness for at least 15 min post-break and may have masked sleepiness for up to 25 min, suggesting the potential usefulness of short-duration breaks as an in-flight fatigue countermeasure. JF - Aviation, space, and environmental medicine AU - Neri, David F AU - Oyung, Raymond L AU - Colletti, Laura M AU - Mallis, Melissa M AU - Tam, Patricia Y AU - Dinges, David F AD - Fatigue Countermeasures Group, NASA Ames Research Center, Moffett Field, CA, USA. nerid@onr.navy.mil Y1 - 2002/07// PY - 2002 DA - July 2002 SP - 654 EP - 664 VL - 73 IS - 7 SN - 0095-6562, 0095-6562 KW - Index Medicus KW - Space life sciences KW - NASA Discipline Space Human Factors KW - Non-NASA Center KW - Analysis of Variance KW - Personnel Staffing and Scheduling -- organization & administration KW - Electrooculography KW - Humans KW - Electroencephalography KW - Adult KW - Psychomotor Performance KW - Middle Aged KW - Time Factors KW - Wakefulness KW - Male KW - Occupational Diseases -- diagnosis KW - Occupational Health KW - Fatigue -- prevention & control KW - Occupational Diseases -- prevention & control KW - Occupational Diseases -- etiology KW - Occupational Diseases -- physiopathology KW - Fatigue -- diagnosis KW - Work Schedule Tolerance -- psychology KW - Fatigue -- physiopathology KW - Work Schedule Tolerance -- physiology KW - Fatigue -- psychology KW - Aerospace Medicine KW - Fatigue -- etiology KW - Occupational Diseases -- psychology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71948690?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aviation%2C+space%2C+and+environmental+medicine&rft.atitle=Controlled+breaks+as+a+fatigue+countermeasure+on+the+flight+deck.&rft.au=Neri%2C+David+F%3BOyung%2C+Raymond+L%3BColletti%2C+Laura+M%3BMallis%2C+Melissa+M%3BTam%2C+Patricia+Y%3BDinges%2C+David+F&rft.aulast=Neri&rft.aufirst=David&rft.date=2002-07-01&rft.volume=73&rft.issue=7&rft.spage=654&rft.isbn=&rft.btitle=&rft.title=Aviation%2C+space%2C+and+environmental+medicine&rft.issn=00956562&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-01-06 N1 - Date created - 2002-07-24 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - College Quality and Employee Job Performance: Evidence from Naval Officers AN - 60448674; 200307282 AB - This study analyzes the effects of college quality & individual academic background on selected job performance measures for officers working in professional & managerial jobs in the US Navy. The study analyzes performance indicators at selected career points for cohorts in two occupational groups. Among staff personnel, who perform mostly administrative & support functions, the authors find that graduates of private schools, regardless of college quality, received better performance appraisals than did other officers. Among line personnel, who perform jobs on ships & submarines & in aviation, graduates of top-rated schools, both public & private, received better appraisals during the early career period. Within both occupational groups, graduates of top-rated private schools were more likely than other officers to be promoted at the up-or-out point. The results are consistent with prior studies that find an earnings premium attached to attendance at elite private colleges. 4 Tables, 1 Appendix, 23 References. Adapted from the source document. JF - Industrial and Labor Relations Review AU - Bowman, William R AU - Mehay, Stephen L AD - US Naval Academy, Annapolis, MD Y1 - 2002/07// PY - 2002 DA - July 2002 SP - 700 EP - 714 VL - 55 IS - 4 SN - 0019-7939, 0019-7939 KW - Colleges KW - College Graduates KW - Military Officers KW - United States of America KW - Private Schools KW - Job Performance KW - article KW - 1020: social differentiation; sociology of occupations & professions KW - 0621: complex organization; jobs, work organization, workplaces, & unions UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60448674?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Asocabs&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Industrial+and+Labor+Relations+Review&rft.atitle=College+Quality+and+Employee+Job+Performance%3A+Evidence+from+Naval+Officers&rft.au=Bowman%2C+William+R%3BMehay%2C+Stephen+L&rft.aulast=Bowman&rft.aufirst=William&rft.date=2002-07-01&rft.volume=55&rft.issue=4&rft.spage=700&rft.isbn=&rft.btitle=&rft.title=Industrial+and+Labor+Relations+Review&rft.issn=00197939&rft_id=info:doi/ LA - English DB - Sociological Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - ILREAQ N1 - SubjectsTermNotLitGenreText - Colleges; United States of America; Job Performance; Military Officers; Private Schools; College Graduates ER - TY - JOUR T1 - Quantitative assessment of filter-based cDNA microarrays: gene expression profiles of human T-lymphoma cell lines AN - 18684447; 5579064 AB - While the use of cDNA microarrays for functional genomic analysis has become commonplace, relatively little attention has been placed on false positives, i.e. the likelihood that a change in measured radioactive or fluorescence intensity may reflect a change in gene expression when, in fact, there is none. Since cDNA arrays are being increasingly used to rapidly distinguish biomarkers for disease detection and subsequent assay development (Wellman et al., Blood, 96, 398-404, 2000), the impact of false positives can be significant. For the use of this technology, it is necessary to develop quantitative criteria for reduction of false positives with radioactively-labeled cDNA arrays. JF - Bioinformatics AU - Dodson, J M AU - Charles, P T AU - Stenger, DA AU - Pancrazio, J J AD - Center for Bio/Molecular Science & Engineering, Code 6900, Naval Research Laboratory, Washington, DC 20375, USA Y1 - 2002/07// PY - 2002 DA - Jul 2002 SP - 953 EP - 960 VL - 18 IS - 7 SN - 1367-4803, 1367-4803 KW - DNA microarrays KW - biomarkers KW - false positives KW - Biotechnology and Bioengineering Abstracts; Bioengineering Abstracts; Medical and Pharmaceutical Biotechnology Abstracts KW - W4 130:General Biomedical Engineering: Tools & Techniques KW - W 30965:Miscellaneous, Reviews KW - W3 33000:General topics and reviews UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18684447?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Bioinformatics&rft.atitle=Quantitative+assessment+of+filter-based+cDNA+microarrays%3A+gene+expression+profiles+of+human+T-lymphoma+cell+lines&rft.au=Dodson%2C+J+M%3BCharles%2C+P+T%3BStenger%2C+DA%3BPancrazio%2C+J+J&rft.aulast=Dodson&rft.aufirst=J&rft.date=2002-07-01&rft.volume=18&rft.issue=7&rft.spage=953&rft.isbn=&rft.btitle=&rft.title=Bioinformatics&rft.issn=13674803&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - DNA damage, histologial changes and DNA repair in larval Japanese medaka (Oryzias latipes) exposed to ultraviolet-B radiation AN - 1798737543; 5370414 AB - Cyclobutane dimer formation, photorepair capability and histological damage were compared among four differently pigmented strains of larval Japanese medaka (Oryzias latipes) to determine whether pigmentation modifies the level of UV-B radiation (290-320 nm) inducible damage in these fish. One-day post-hatch medaka were exposed to one of several UV-B fluence rates with or without photoreactivating light for 5 days for 7 h per day. Their DNA was extracted for analysis by ELISA for cyclobutane pyrimidine dimers or the larvae were processed for histological examination. At the higher UV-B fluence rates tested, wild-type melanophore-containing medaka formed significantly more dimers than at least one of the other strains tested. Wild-type medaka also showed significantly less photorepair capability than the white melanophore-lacking medaka. The wild-type larvae had significantly more necrosis than the orange-red melanophore-lacking larvae at the lower UV-B fluence rate tested and at the higher fluence rate used, the wild-type medaka also exhibited significantly more necrosis than the white melanophore-lacking larvae. Of the 19 medaka observed with cellular hyperplasia, six were wild-type. These six individual larvae showed the greatest degree of cellular hyperplasia. Cellular hyperplasia appeared to be greatest at the lowest UV-B fluence rate used. The presence of melanophores in the wild-type medaka may have contributed to an increased level of tissue damage in this strain when compared to the other strains. JF - Aquatic Toxicology AU - Armstrong, T N AU - Reimschuessel, R AU - Bradley, B P AD - BBL Sciences, 326 First Street, Suite 200, 21403-2678 Annapolis, MD USA Y1 - 2002/07/01/ PY - 2002 DA - 2002 Jul 01 SP - 1 EP - 14 PB - Elsevier Science VL - 58 IS - 1-2 SN - 0166-445X, 0166-445X KW - Medaka KW - genetics KW - Toxicology Abstracts; Pollution Abstracts; Water Resources Abstracts; Aqualine Abstracts; ASFA 1: Biological Sciences & Living Resources; ASFA 3: Aquatic Pollution & Environmental Quality KW - Environmental Effects KW - Aquatic organisms KW - Oryzias latipes KW - Pollution (Environmental) KW - Histopathology KW - Pollution effects KW - Fish larvae KW - Toxicity tests KW - Colour KW - Comparative studies KW - Fish (Cyprinodontiform) KW - U.V. radiation KW - Radiation KW - Pigments KW - Ultraviolet radiation KW - Experimental Data KW - Pigmentation KW - Larvae KW - Toxicity KW - Chromatophores KW - Fish Physiology KW - Ultraviolet Radiation KW - DNA damage KW - Cytotoxicity KW - Histology KW - Comparison Studies KW - Chromatic pigments KW - DNA KW - Fish Populations KW - Toxicity (see also Lethal limits) KW - Toxicity testing KW - Larval Growth Stage KW - X 24210:Radiation & radioactive materials KW - Q1 08346:Physiology, biochemistry, biophysics KW - P 8000:RADIATION KW - Q5 08504:Effects on organisms KW - AQ 00008:Effects of Pollution KW - SW 3030:Effects of pollution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1798737543?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aquatic+Toxicology&rft.atitle=DNA+damage%2C+histologial+changes+and+DNA+repair+in+larval+Japanese+medaka+%28Oryzias+latipes%29+exposed+to+ultraviolet-B+radiation&rft.au=Armstrong%2C+T+N%3BReimschuessel%2C+R%3BBradley%2C+B+P&rft.aulast=Armstrong&rft.aufirst=T&rft.date=2002-07-01&rft.volume=58&rft.issue=1-2&rft.spage=1&rft.isbn=&rft.btitle=&rft.title=Aquatic+Toxicology&rft.issn=0166445X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Pigments; Ultraviolet radiation; DNA; Chromatic pigments; Pollution effects; Histopathology; Chromatophores; Toxicity tests; Fish larvae; Pigmentation; DNA damage; U.V. radiation; Aquatic organisms; Cytotoxicity; Radiation; Histology; Larvae; Toxicity testing; Fish (Cyprinodontiform); Comparative studies; Colour; Pollution (Environmental); Toxicity (see also Lethal limits); Environmental Effects; Experimental Data; Comparison Studies; Toxicity; Fish Populations; Fish Physiology; Larval Growth Stage; Ultraviolet Radiation; Oryzias latipes ER - TY - JOUR T1 - Emission of nitrous oxide from rice-wheat systems of indo-gangetic plains of India AN - 16138663; 5441818 AB - Nitrous oxide (N sub(2)O) accounts for 5% of the total enhanced greenhouse effect and responsible for the destruction of the stratospheric ozone. The rice-wheat cropping system occupying 26 million ha of productive land in Asia could be a major source of N sub(2)O as most of the fertilizer N in this region is consumed by this system. Emission of N sub(2)O as influenced by application of urea, urea plus farm yard manure (FYM), and urea plus dicyandiamide (DCD), a nitrification inhibitor, was studied in rice-wheat systems of Indo-Gangetic plains of India. Total emission of N sub(2)O-N from the rice-wheat systems varied between 654 g ha super(-1) in unfertilized plots and 1570 g ha super(-1) in urea fertilized plots. Application of FYM and DCD reduced emission of N sub(2)O-N in rice. The magnitude of reduction was higher with DCD. In wheat also N sub(2)O-N emission was reduced by DCD. FYM applied in rice had no residual effect on N sub(2)O-N emission in wheat. In rice intermittent wetting and drying condition of soil resulted in higher N sub(2)O-N emission than that of saturated soil condition. Treatments with 5 irrigations gave higher emissions in wheat than those with 3 irrigations. In rice-wheat system, typical of a farmer's field in Indo-Gangetic plains, where 240 kg N is generally applied through urea, N sub(2)O-N emission is 1570 g ha super(-1) (0.38% of applied N) and application of FYM and DCD reduced it to 1415 and 1096 g ha super(-1), respectively. JF - Environmental Monitoring and Assessment AU - Pathak, H AU - Bhatia, A AU - Prasad, S AU - Singh, S AU - Kumar, S AU - Jain, M C AU - Kumar, U AD - Division of Environmental Sciences, Nuclear Research Laboratory (NRL) Building, Indian Agricultural Research Institute, New Delhi, India, him_ensc@iari.ernet.in Y1 - 2002/07// PY - 2002 DA - Jul 2002 SP - 163 EP - 178 VL - 77 IS - 2 SN - 0167-6369, 0167-6369 KW - Pollution Abstracts KW - Fertilizers KW - Rice fields KW - Nitrous oxide KW - Emissions KW - Greenhouse effect KW - India KW - Ozone KW - P 0000:AIR POLLUTION UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/16138663?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Apollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Monitoring+and+Assessment&rft.atitle=Emission+of+nitrous+oxide+from+rice-wheat+systems+of+indo-gangetic+plains+of+India&rft.au=Pathak%2C+H%3BBhatia%2C+A%3BPrasad%2C+S%3BSingh%2C+S%3BKumar%2C+S%3BJain%2C+M+C%3BKumar%2C+U&rft.aulast=Pathak&rft.aufirst=H&rft.date=2002-07-01&rft.volume=77&rft.issue=2&rft.spage=163&rft.isbn=&rft.btitle=&rft.title=Environmental+Monitoring+and+Assessment&rft.issn=01676369&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-09-01 N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Fertilizers; Nitrous oxide; Rice fields; Emissions; Greenhouse effect; Ozone; India ER - TY - JOUR T1 - Involvement of protein phosphatase-1-mediated MARCKS translocation in myogenic differentiation of embryonic muscle cells. AN - 71775436; 12045217 AB - Myristoylated alanine-rich C kinase substrate (MARCKS) translocates from the cytosol to the plasma membrane while mononucleated myoblasts fuse to form multinucleated myotubes. Here, we show that protein phosphatase-1-mediated dephosphorylation of MARCKS largely influences its subcellular localization and the fusion process. Treatment with okadaic acid or tautomycin, which are potent inhibitors of protein phosphatases and cell fusion, was found to reversibly block the MARCKS translocation. Moreover, the dephosphorylating activity against MARCKS markedly increased during myogenesis, and this increase was closely correlated with the membrane fusion of the cells. In addition, protein phosphatase-1 was identified as a major enzyme that is responsible for dephosphorylation of MARCKS. Furthermore, a mutation preventing MARCKS phosphorylation and thus facilitating MARCKS translocation resulted in promotion of the cell fusion. In contrast, overexpression of MARCKS carrying a mutation that blocks myristoylation and thus prevents the MARCKS translocation impaired the myoblast fusion. Together with the fact that MARCKS regulates the cytoskeleton dynamics by crosslinking the actin filaments in the plasma membrane and that myoblast fusion accompanies massive cytoskeleton reorganization, these results suggest that protein phosphatase-1-mediated MARCKS localization at the membrane is required for the fusion of embryonic muscle cells. JF - Journal of cell science AU - Kim, Sang Soo AU - Kim, Jung Hwa AU - Lee, Seung-Hye AU - Chung, Sung Soo AU - Bang, Ok-Sun AU - Park, Dongeun AU - Chung, Chin Ha AD - NRL of Protein Biochemistry, School of Biological Sciences, Seoul National University, 56-1 Shinreem-dong, Kwanak-gu, Seoul 151-742, Korea. Y1 - 2002/06/15/ PY - 2002 DA - 2002 Jun 15 SP - 2465 EP - 2473 VL - 115 SN - 0021-9533, 0021-9533 KW - Enzyme Inhibitors KW - 0 KW - Intracellular Signaling Peptides and Proteins KW - Membrane Proteins KW - Proteins KW - myristoylated alanine-rich C kinase substrate KW - 125267-21-2 KW - Okadaic Acid KW - 1W21G5Q4N2 KW - Creatine Kinase KW - EC 2.7.3.2 KW - Phosphoprotein Phosphatases KW - EC 3.1.3.16 KW - Protein Phosphatase 1 KW - Myosin Heavy Chains KW - EC 3.6.4.1 KW - Index Medicus KW - Mutation -- drug effects KW - Animals KW - Cytosol -- metabolism KW - Cell Membrane -- drug effects KW - Cytosol -- drug effects KW - Protein Transport -- drug effects KW - Amino Acid Sequence -- drug effects KW - Chick Embryo KW - Amino Acid Sequence -- genetics KW - Creatine Kinase -- metabolism KW - Cell Adhesion -- genetics KW - Myosin Heavy Chains -- metabolism KW - Phosphorylation -- drug effects KW - Cells, Cultured KW - Okadaic Acid -- pharmacology KW - Mutation -- genetics KW - Enzyme Inhibitors -- pharmacology KW - Cell Adhesion -- drug effects KW - Cell Membrane -- metabolism KW - Protein Transport -- physiology KW - Muscle, Skeletal -- enzymology KW - Proteins -- metabolism KW - Proteins -- genetics KW - Proteins -- drug effects KW - Muscle, Skeletal -- embryology KW - Phosphoprotein Phosphatases -- drug effects KW - Muscle, Skeletal -- cytology KW - Cell Differentiation -- physiology KW - Myoblasts, Skeletal -- cytology KW - Phosphoprotein Phosphatases -- metabolism KW - Cell Differentiation -- drug effects KW - Muscle Fibers, Skeletal -- enzymology KW - Myoblasts, Skeletal -- drug effects KW - Myoblasts, Skeletal -- enzymology KW - Muscle Fibers, Skeletal -- cytology KW - Muscle Fibers, Skeletal -- drug effects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71775436?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+cell+science&rft.atitle=Involvement+of+protein+phosphatase-1-mediated+MARCKS+translocation+in+myogenic+differentiation+of+embryonic+muscle+cells.&rft.au=Kim%2C+Sang+Soo%3BKim%2C+Jung+Hwa%3BLee%2C+Seung-Hye%3BChung%2C+Sung+Soo%3BBang%2C+Ok-Sun%3BPark%2C+Dongeun%3BChung%2C+Chin+Ha&rft.aulast=Kim&rft.aufirst=Sang&rft.date=2002-06-15&rft.volume=115&rft.issue=&rft.spage=2465&rft.isbn=&rft.btitle=&rft.title=Journal+of+cell+science&rft.issn=00219533&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-11-26 N1 - Date created - 2002-06-04 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Avidin: a natural bridge for quantum dot-antibody conjugates. AN - 71735451; 12033868 AB - We describe the preparation and characterization of bioinorganic conjugates in which luminescent semiconductor CdSe-ZnS core-shell nanocrystal quantum dots (QDs) were coupled to antibodies through the use of an avidin bridge adsorbed to the nanocrystal surface via electrostatic self-assembly. Avidin, a highly positively charged protein, was found to adsorb tightly to QDs modified with dihydrolipoic acid, which gives their surface a homogeneous negative charge. QD conjugation to biotinylated antibodies subsequently is readily achieved. Fluoroimmunoassays utilizing these antibody conjugated QDs were successful in the detection of protein toxins (staphylococcal enterotoxin B, cholera toxin). QD-antibody conjugates formed in such a facile manner permit their use as a common immuno reagent, and in the development of multianalyte detection. JF - Journal of the American Chemical Society AU - Goldman, Ellen R AU - Balighian, Eric D AU - Mattoussi, Hedi AU - Kuno, M Kenneth AU - Mauro, J Matthew AU - Tran, Phan T AU - Anderson, George P AD - U.S. Naval Research Laboratory, Center for Bio/Molecular Science and Engineering and Division of Optical Sciences, Washington, D.C. 20375, USA. erg@cbmse.nrl.navv.mil Y1 - 2002/06/05/ PY - 2002 DA - 2002 Jun 05 SP - 6378 EP - 6382 VL - 124 IS - 22 SN - 0002-7863, 0002-7863 KW - Antibodies KW - 0 KW - Antigens, Bacterial KW - Carrier Proteins KW - Enterotoxins KW - Immunoconjugates KW - Maltose-Binding Proteins KW - Sulfides KW - Zinc Compounds KW - Cadmium KW - 00BH33GNGH KW - Avidin KW - 1405-69-2 KW - enterotoxin B, staphylococcal KW - 39424-53-8 KW - Biotin KW - 6SO6U10H04 KW - Cholera Toxin KW - 9012-63-9 KW - zinc sulfide KW - KPS085631O KW - Index Medicus KW - Carrier Proteins -- chemistry KW - Fluorometry -- methods KW - Antigens, Bacterial -- analysis KW - Sulfides -- chemistry KW - Enterotoxins -- analysis KW - Semiconductors KW - Biotin -- chemistry KW - Cadmium -- chemistry KW - Leucine Zippers KW - Cholera Toxin -- analysis KW - Immunoassay -- methods KW - Zinc Compounds -- chemistry KW - Protein Structure, Tertiary KW - Immunoconjugates -- chemistry KW - Avidin -- chemistry KW - Antibodies -- chemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71735451?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+the+American+Chemical+Society&rft.atitle=Avidin%3A+a+natural+bridge+for+quantum+dot-antibody+conjugates.&rft.au=Goldman%2C+Ellen+R%3BBalighian%2C+Eric+D%3BMattoussi%2C+Hedi%3BKuno%2C+M+Kenneth%3BMauro%2C+J+Matthew%3BTran%2C+Phan+T%3BAnderson%2C+George+P&rft.aulast=Goldman&rft.aufirst=Ellen&rft.date=2002-06-05&rft.volume=124&rft.issue=22&rft.spage=6378&rft.isbn=&rft.btitle=&rft.title=Journal+of+the+American+Chemical+Society&rft.issn=00027863&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-08-16 N1 - Date created - 2002-05-29 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - CPAPER T1 - Naval benefits of geosynchronous hyperspectral imagery AN - 39526948; 3670497 AU - McKeown, W Y1 - 2002/06/03/ PY - 2002 DA - 2002 Jun 03 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39526948?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Naval+benefits+of+geosynchronous+hyperspectral+imagery&rft.au=McKeown%2C+W&rft.aulast=McKeown&rft.aufirst=W&rft.date=2002-06-03&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Alliance for Marine Remote Sensing Association, NSCC, 5685 Leeds Street, P.O. Box 1153, Halifax, Nova Scotia, B3J 2X1, Canada; phone: 902-491-2160; fax: 902-491-2162; email: amrsAdmin@waterobserver.org N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Current and future state of data assimilation for sea-ice studies AN - 39458076; 3670487 AU - Meier, W Y1 - 2002/06/03/ PY - 2002 DA - 2002 Jun 03 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39458076?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Current+and+future+state+of+data+assimilation+for+sea-ice+studies&rft.au=Meier%2C+W&rft.aulast=Meier&rft.aufirst=W&rft.date=2002-06-03&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Alliance for Marine Remote Sensing Association, NSCC, 5685 Leeds Street, P.O. Box 1153, Halifax, Nova Scotia, B3J 2X1, Canada; phone: 902-491-2160; fax: 902-491-2162; email: amrsAdmin@waterobserver.org N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - Matched-field processing gain degradation caused by tidal flow over continental shelf bathymetry. AN - 85375446; pmid-12083193 AB - Temporally variable, range dependent sound-speed profiles measured during ebb flow and estimated for slack flow are used to quantify the variability of matched-field signal-processing gain degradation in shallow water propagation channels controlled by tidally driven stratified flow over variable bathymetry. Calculations along a 9.3 km range establish phase changes in the acoustic signal as the primary cause of a 3-9 dB degradation in the coherent matched-field processing output of a full water column vertical array. The work indicates that over a tidal cycle acoustic signal properties and matched-field processing gain can be expected to change continuously in a shallow water stratified channel that has bathymetry variability. Acoustic signals propagating in such tidal flow-controlled environments may be expected to display repeatable (over successive tidal cycles) and predictable changes in their phase coherent properties. These results suggest that matched-field processor replica fields used in the shelf/slope propagation environment will have to be updated regularly during a tidal cycle to maintain maximum processor gain. JF - The Journal of the Acoustical Society of America AU - Orr, Marshall H AU - Mignerey, Peter C AD - Acoustics Division, Naval Research Laboratory, Washington, DC 20375-5320, USA. Y1 - 2002/06// PY - 2002 DA - Jun 2002 SP - 2615 EP - 2620 VL - 111 IS - 6 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85375446?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Matched-field+processing+gain+degradation+caused+by+tidal+flow+over+continental+shelf+bathymetry.&rft.au=Orr%2C+Marshall+H%3BMignerey%2C+Peter+C&rft.aulast=Orr&rft.aufirst=Marshall&rft.date=2002-06-01&rft.volume=111&rft.issue=6&rft.spage=2615&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Ectopic cervical thymus: an uncommon diagnosis in the evaluation of pediatric neck masses. AN - 85374437; pmid-12049570 AB - Ectopic cervical thymic tissue is an uncommon cause of neck masses in children, with fewer than 100 cases reported in children who presented with primary neck masses. To illustrate the unique characteristics of these tumors, we report the case of a 13-month-old boy with ectopic thymic tissue presenting with asymptomatic, bilateral, and solid cervical masses. This case report highlights several unique findings: (1) the rare nature of solid thymic tumors compared with cystic lesions, (2) the utility of magnetic resonance imaging scanning with and without fat suppression for diagnosis, and (3) the risks of surgical removal of thymic tissue in children. Despite its infrequent occurrence and often asymptomatic presentation, ectopic cervical thymus masses should be included as a rare cause of cervical masses in the pediatric population. Awareness of this diagnosis will allow for appropriate preoperative diagnostic studies, which may preclude the need for biopsy. JF - Archives of otolaryngology--head & neck surgery AU - Scott, Kirby J AU - Schroeder, Ashley A AU - Greinwald, John H AD - Department of Otolaryngology, Naval Medical Center, 27 Effingham St, Portsmouth, VA 23708-5000, USA. KJScott@mar.med.navy.mil Y1 - 2002/06// PY - 2002 DA - Jun 2002 SP - 714 EP - 717 VL - 128 IS - 6 SN - 0886-4470, 0886-4470 KW - National Library of Medicine KW - *Choristoma: diagnosis KW - Choristoma: surgery KW - Diagnosis, Differential KW - Humans KW - Infant KW - Lymphatic Diseases: diagnosis KW - Magnetic Resonance Imaging KW - Male KW - *Mediastinal Diseases: diagnosis KW - Mediastinal Diseases: surgery KW - Neck KW - *Thymus Gland KW - Tomography, X-Ray Computed UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85374437?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Archives+of+otolaryngology--head+%26+neck+surgery&rft.atitle=Ectopic+cervical+thymus%3A+an+uncommon+diagnosis+in+the+evaluation+of+pediatric+neck+masses.&rft.au=Scott%2C+Kirby+J%3BSchroeder%2C+Ashley+A%3BGreinwald%2C+John+H&rft.aulast=Scott&rft.aufirst=Kirby&rft.date=2002-06-01&rft.volume=128&rft.issue=6&rft.spage=714&rft.isbn=&rft.btitle=&rft.title=Archives+of+otolaryngology--head+%26+neck+surgery&rft.issn=08864470&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Time reversed reverberation focusing in a waveguide. AN - 85374072; pmid-12083192 AB - Time reversal mirrors have been applied to focus energy at probe source locations and point scatterers in inhomogeneous media. In this paper, we investigate the application of a time reversal mirror to rough interface reverberation processing in a waveguide. The method is based on the decomposition of the time reversal operator which is computed from the transfer matrix measured on a source-receiver array [Prada et al., J. Acoust. Soc. Am. 99, 2067-2076 (1996)]. In a similar manner, reverberation data collected on a source-receiver array can be filtered through an appropriate temporal window to form a time reversal operator. The most energetic eigenvector of the time reversal operator focuses along the interface at the range corresponding to the filter delay. It is also shown that improved signal-to-noise ratio measurement of the time reversal operator can be obtained by ensonifying the water column with a set of orthogonal array beams. Since these methods do not depend upon a priori environmental information, they are applicable to complex shallow water environments. Numerical simulations with a Pekeris waveguide demonstrate this method. JF - The Journal of the Acoustical Society of America AU - Lingevitch, J F AU - Song, H C AU - Kuperman, W A AD - Naval Research Laboratory, Washington, DC 20375, USA. jfl@aslan.nrl.navy.mil Y1 - 2002/06// PY - 2002 DA - Jun 2002 SP - 2609 EP - 2614 VL - 111 IS - 6 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85374072?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Time+reversed+reverberation+focusing+in+a+waveguide.&rft.au=Lingevitch%2C+J+F%3BSong%2C+H+C%3BKuperman%2C+W+A&rft.aulast=Lingevitch&rft.aufirst=J&rft.date=2002-06-01&rft.volume=111&rft.issue=6&rft.spage=2609&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Generalization of a model of hysteresis for dynamical systems. AN - 85373636; pmid-12083200 AB - A previously described model of hysteresis [J. C. Piquette and S. E. Forsythe, J. Acoust. Soc. Am. 106, 3317-3327 (1999); 106, 3328-3334 (1999)] is generalized to apply to a dynamical system. The original model produces theoretical hysteresis loops that agree well with laboratory measurements acquired under quasi-static conditions. The loops are produced using three-dimensional rotation matrices. An iterative procedure, which allows the model to be applied to a dynamical system, is introduced here. It is shown that, unlike the quasi-static case, self-crossing of the loops is a realistic possibility when inertia and viscous friction are taken into account. JF - The Journal of the Acoustical Society of America AU - Piquette, Jean C AU - McLaughlin, Elizabeth A AU - Ren, Wei AU - Mukherjee, Binu K AD - Naval Undersea Warfare Center, Division Newport, Rhode Island 02841, USA. piquettejc@npt.nuwc.navy.mil Y1 - 2002/06// PY - 2002 DA - Jun 2002 SP - 2671 EP - 2674 VL - 111 IS - 6 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85373636?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Generalization+of+a+model+of+hysteresis+for+dynamical+systems.&rft.au=Piquette%2C+Jean+C%3BMcLaughlin%2C+Elizabeth+A%3BRen%2C+Wei%3BMukherjee%2C+Binu+K&rft.aulast=Piquette&rft.aufirst=Jean&rft.date=2002-06-01&rft.volume=111&rft.issue=6&rft.spage=2671&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - A cost comparison of two malaria control methods in Kyunggi Province, Republic of Korea, using remote sensing and geographic information systems. AN - 72073520; 12224574 AB - A cost-comparison of two methods for the control of malaria in the Republic of Korea was performed. The cost of larviciding with methoprene granules was estimated at $93.48/hectare. The annual cost of providing chemoprophylaxis was estimated at $37.53/person. Remote sensing and geographic information systems were used to obtain estimates of the size of vector larval habitats around two U.S. Army camps, allowing an estimate of the cost of larviciding around each of the camps. This estimate was compared to the cost of providing chloroquine and primaquine chemoprophylaxis for the camp populations. Costs on each of the camps differed by the size of the larval habitats and the size of the at-risk population. These tools allow extrapolation of larval surveillance data to a regional scale while simultaneously providing site-specific cost analysis, thus reducing the cost and labor associated with vector surveillance over large areas. JF - The American journal of tropical medicine and hygiene AU - Claborn, David M AU - Masuoka, Penny M AU - Klein, Terry A AU - Hooper, Tomoko AU - Lee, Arthur AU - Andre, Richard G AD - Navy Disease Vector Ecology and Control Center, Naval Air Station, Jacksonville, Florida 32212-0043, USA. Dmclaborn@dveccjax.med.navy.mil Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 680 EP - 685 VL - 66 IS - 6 SN - 0002-9637, 0002-9637 KW - Insecticides KW - 0 KW - Abridged Index Medicus KW - Index Medicus KW - United States KW - Environment KW - Animals KW - Flight, Animal KW - Costs and Cost Analysis KW - Military Personnel KW - Humans KW - Korea KW - Geography KW - Anopheles -- physiology KW - Plasmodium -- drug effects KW - Malaria -- prevention & control KW - Insecticides -- therapeutic use KW - Insecticides -- economics KW - Chemoprevention -- economics KW - Malaria -- economics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72073520?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+American+journal+of+tropical+medicine+and+hygiene&rft.atitle=A+cost+comparison+of+two+malaria+control+methods+in+Kyunggi+Province%2C+Republic+of+Korea%2C+using+remote+sensing+and+geographic+information+systems.&rft.au=Claborn%2C+David+M%3BMasuoka%2C+Penny+M%3BKlein%2C+Terry+A%3BHooper%2C+Tomoko%3BLee%2C+Arthur%3BAndre%2C+Richard+G&rft.aulast=Claborn&rft.aufirst=David&rft.date=2002-06-01&rft.volume=66&rft.issue=6&rft.spage=680&rft.isbn=&rft.btitle=&rft.title=The+American+journal+of+tropical+medicine+and+hygiene&rft.issn=00029637&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-10-03 N1 - Date created - 2002-09-12 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Potential applications of DNA microarrays in biodefense-related diagnostics. AN - 71987746; 12180094 AB - Recent years have witnessed a logarithmic growth in the number of applications involving DNA microarrays. Extrapolation of their use for infectious diagnostics and biodefense-related diagnostics seems obvious. Nevertheless, the application of DNA microarrays to biodefense-related diagnostics will depend on solving a set of substantial, yet approachable, technical and logistical problems that encompass diverse topics from amplification efficiency to bioinformatics. JF - Current opinion in biotechnology AU - Stenger, David A AU - Andreadis, Joanne D AU - Vora, Gary J AU - Pancrazio, Joseph J AD - Center for Bio/Molecular Science and Engineering, Code 6910, Naval Research Laboratory, Washington, DC 20375, USA. dstenger@ccs.nrl.navy.mil Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 208 EP - 212 VL - 13 IS - 3 SN - 0958-1669, 0958-1669 KW - DNA, Bacterial KW - 0 KW - DNA, Viral KW - Index Medicus KW - Gene Expression Profiling -- instrumentation KW - Humans KW - Environmental Monitoring -- methods KW - Environmental Monitoring -- instrumentation KW - Environmental Microbiology KW - Oligonucleotide Array Sequence Analysis -- trends KW - DNA, Bacterial -- classification KW - Oligonucleotide Array Sequence Analysis -- classification KW - DNA, Bacterial -- genetics KW - Oligonucleotide Array Sequence Analysis -- methods KW - DNA, Viral -- classification KW - Oligonucleotide Array Sequence Analysis -- instrumentation KW - Bioterrorism KW - DNA, Viral -- genetics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71987746?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Current+opinion+in+biotechnology&rft.atitle=Potential+applications+of+DNA+microarrays+in+biodefense-related+diagnostics.&rft.au=Stenger%2C+David+A%3BAndreadis%2C+Joanne+D%3BVora%2C+Gary+J%3BPancrazio%2C+Joseph+J&rft.aulast=Stenger&rft.aufirst=David&rft.date=2002-06-01&rft.volume=13&rft.issue=3&rft.spage=208&rft.isbn=&rft.btitle=&rft.title=Current+opinion+in+biotechnology&rft.issn=09581669&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-01-08 N1 - Date created - 2002-08-15 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Chloroquine for the treatment of uncomplicated malaria in Guyana. AN - 71979855; 12171615 AB - At a public hospital in Georgetown, Guyana, 44 patients seeking treatment for symptomatic, slide-confirmed malaria were given standard chloroquine (CQ) therapy and followed for 28 days. The patients apparently had pure infections with Plasmodium falciparum (14), P. vivax (13) or P. malariae (one), or mixed infections either of P. falciparum and P. vivax (17) or of P. falciparum, P. malariae and P. vivax (two). Each received supervised treatment with 10 mg CQ base/kg on each of days 0 and 1, and 5 mg/kg on day 2. On the day of enrollment (day 0), the patients complained of fever (100%), headache (100%), malaise (94%), myalgia (79%), nausea (67%), vertigo (49%) and vomiting (33%). Many (39%) were ill enough to confine themselves to bed. On day 4, fewer of the subjects complained of fever (15%), headache (15%), malaise (6%), myalgia (21%), nausea (6%), vertigo (24%) or vomiting (0%) despite the relatively high (>48%) risk of therapeutic failure. The cumulative incidence of parasitological failure against P. falciparum was 15% at day 4, 33% at day 7 and 48% at day 14. All of the P. vivax and P. malariae infections cleared before day 4 and none recurred by day 7. Two infections with P. vivax recurred later (on day 14 or 28) but in the presence of less than adequate, whole-blood concentrations of CQ plus desethyl-chloroquine (i.e. <100 ng/ml). Taken together, the results indicate a high risk of therapeutic failure of CQ against P. falciparum but also indicate that resistance to CQ in P. vivax occurs infrequently in Guyana. JF - Annals of tropical medicine and parasitology AU - Baird, J K AU - Tiwari, T AU - Martin, G J AU - Tamminga, C L AU - Prout, T M AU - Tjaden, J AU - Bravet, P P AU - Rawlins, S AU - Ferrel, M AU - Carucci, D AU - Hoffman, S L AD - U.S. Naval Medical Research Unit #2, American Embassy Jakarta, Fleet Post Office-Asia/Pacific 96520-8132, U.S.A. bairdjk@namru2.med.navy.mil Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 339 EP - 348 VL - 96 IS - 4 SN - 0003-4983, 0003-4983 KW - Antimalarials KW - 0 KW - Chloroquine KW - 886U3H6UFF KW - Index Medicus KW - Animals KW - Treatment Failure KW - Humans KW - Drug Resistance KW - Child KW - Malaria, Vivax -- drug therapy KW - Recurrence KW - Life Tables KW - Adult KW - Treatment Outcome KW - Plasmodium malariae KW - Malaria, Falciparum -- diagnosis KW - Malaria, Vivax -- diagnosis KW - Middle Aged KW - Follow-Up Studies KW - Malaria, Falciparum -- drug therapy KW - Adolescent KW - Male KW - Female KW - Malaria -- drug therapy KW - Antimalarials -- adverse effects KW - Chloroquine -- therapeutic use KW - Malaria -- diagnosis KW - Chloroquine -- adverse effects KW - Antimalarials -- therapeutic use UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71979855?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annals+of+tropical+medicine+and+parasitology&rft.atitle=Chloroquine+for+the+treatment+of+uncomplicated+malaria+in+Guyana.&rft.au=Baird%2C+J+K%3BTiwari%2C+T%3BMartin%2C+G+J%3BTamminga%2C+C+L%3BProut%2C+T+M%3BTjaden%2C+J%3BBravet%2C+P+P%3BRawlins%2C+S%3BFerrel%2C+M%3BCarucci%2C+D%3BHoffman%2C+S+L&rft.aulast=Baird&rft.aufirst=J&rft.date=2002-06-01&rft.volume=96&rft.issue=4&rft.spage=339&rft.isbn=&rft.btitle=&rft.title=Remote+Sensing+of+Environment&rft.issn=00344257&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-09-27 N1 - Date created - 2002-08-12 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Porous polysilsesquioxanes for the adsorption of phenols. AN - 71842574; 12075813 AB - Arylene- and ethylene-bridged polysilsesquioxane materials have been synthesized by the hydrolysis and condensation of alkoxysilyl precursors under basic conditions. Cetyltrimethylammonium chloride was used to increase the porosity and surface areas of these materials via the surfactanttemplate approach. Structural characterization of these materials was carried out by nitrogen gas sorption and X-ray diffraction. The adsorption of three phenolic compounds (4-nitrophenol, 4-chlorophenol, 4-methylphenol) has been investigated by both batch and column testing. The arylene-bridged material exhibited a much greater affinity for all three phenols. The efficient removal of adsorbed phenols by a simple ethanol wash led to sorbent regeneration and separation of the aromatic species. JF - Environmental science & technology AU - Burleigh, Mark C AU - Markowitz, Michael A AU - Spector, Mark S AU - Gaber, Bruce P AD - Laboratory for Molecular Interfacial Interactions, Center for Bio/Molecular Science and Engineering, Naval Research Laboratory, Washington, DC 20375, USA. Y1 - 2002/06/01/ PY - 2002 DA - 2002 Jun 01 SP - 2515 EP - 2518 VL - 36 IS - 11 SN - 0013-936X, 0013-936X KW - Phenols KW - 0 KW - Siloxanes KW - Water Pollutants, Chemical KW - Index Medicus KW - Water Pollutants, Chemical -- analysis KW - Porosity KW - Adsorption KW - Hydrolysis KW - Phenols -- chemistry KW - Water Pollution -- prevention & control KW - Water Purification -- methods KW - Siloxanes -- chemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71842574?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+science+%26+technology&rft.atitle=Porous+polysilsesquioxanes+for+the+adsorption+of+phenols.&rft.au=Burleigh%2C+Mark+C%3BMarkowitz%2C+Michael+A%3BSpector%2C+Mark+S%3BGaber%2C+Bruce+P&rft.aulast=Burleigh&rft.aufirst=Mark&rft.date=2002-06-01&rft.volume=36&rft.issue=11&rft.spage=2515&rft.isbn=&rft.btitle=&rft.title=Environmental+science+%26+technology&rft.issn=0013936X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-12-11 N1 - Date created - 2002-06-21 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Effect of Navy chaff release on aluminum levels in an area of the Chesapeake Bay. AN - 71801019; 12061831 AB - The U.S. Navy uses aluminized glass chaff as a passive countermeasure for radar-guided threats to aircraft and surface ships. Over the last 25 years, several hundred thousand pounds of aluminized chaff have been released during flight operations over a training area on the Chesapeake Bay. There is concern that these releases have resulted in the accumulation of significant amounts of aluminum in the soil and sediment of this training area. This study compares the exchangeable and monomeric aluminum content of sediment within the affected area with that of samples taken from outside the training area. We found a less than twofold increase in the content of organic monomeric aluminum in samples taken from the affected area versus background samples, whereas inorganic monomeric aluminum concentrations within the affected area were significantly lower than background. These results suggest that chaff releases have not resulted in a significant accumulation of aluminum in this training area. (c) 2002 Elsevier Science (USA). JF - Ecotoxicology and environmental safety AU - Wilson, Cody L AU - Arfsten, Darryl P AU - Carpenter, Robert L AU - Alexander, William K AU - Still, Kenneth R AD - Naval Health Research Center Detachment (Toxicology), Wright-Patterson Air Force Base, Ohio 45433-7903, USA. cwilson1@mar.med.navy.mil Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 137 EP - 142 VL - 52 IS - 2 SN - 0147-6513, 0147-6513 KW - Soil Pollutants KW - 0 KW - Water Pollutants KW - Aluminum KW - CPD4NFA903 KW - Index Medicus KW - Environmental Monitoring KW - Ecosystem KW - Glass -- chemistry KW - Aircraft KW - Military Personnel KW - Maryland KW - Geologic Sediments -- chemistry KW - Water Pollutants -- analysis KW - Aluminum -- analysis KW - Soil Pollutants -- analysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71801019?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Ecotoxicology+and+environmental+safety&rft.atitle=Effect+of+Navy+chaff+release+on+aluminum+levels+in+an+area+of+the+Chesapeake+Bay.&rft.au=Wilson%2C+Cody+L%3BArfsten%2C+Darryl+P%3BCarpenter%2C+Robert+L%3BAlexander%2C+William+K%3BStill%2C+Kenneth+R&rft.aulast=Wilson&rft.aufirst=Cody&rft.date=2002-06-01&rft.volume=52&rft.issue=2&rft.spage=137&rft.isbn=&rft.btitle=&rft.title=Ecotoxicology+and+environmental+safety&rft.issn=01476513&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-10-29 N1 - Date created - 2002-06-13 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Residual mercury content and leaching of mercury and silver from used amalgam capsules. AN - 71661997; 11992905 AB - The objective of this investigation was to carry out residual mercury (Hg) determinations and toxicity characteristic leaching procedure (TCLP) analysis of used amalgam capsules. For residual Hg analysis, 25 capsules (20 capsules for one brand) from each of 10 different brands of amalgam were analyzed. Total residual Hg levels per capsule were determined using United States Environmental Protection Agency (USEPA) Method 7471. For TCLP analysis, 25 amalgam capsules for each of 10 brands were extracted using a modification of USEPA Method 1311. Hg analysis of the TCLP extracts was done with USEPA Method 7470A. Analysis of silver (Ag) concentrations in the TCLP extract was done with USEPA Method 6010B. Analysis of the residual Hg data resulted in the segregation of brands into three groups: Dispersalloy capsules, Group A, retained the most Hg (1.225 mg/capsule). These capsules were the only ones to include a pestle. Group B capsules, Valliant PhD, Optaloy II, Megalloy and Valliant Snap Set, retained the next highest amount of Hg (0.534-0.770 mg/capsule), and were characterized by a groove in the inside of the capsule. Group C, Tytin regular set double-spill, Tytin FC, Contour, Sybraloy regular set, and Tytin regular set single-spill retained the least amount of Hg (0.125-0.266 mg/capsule). TCLP analysis of the triturated capsules showed Sybraloy and Contour leached Hg at greater than the 0.2 mg/l Resource Conservation and Recovery Act (RCRA) limit. This study demonstrated that residual mercury may be related to capsule design features and that TCLP extracts from these capsules could, in some brands, exceed RCRA Hg limits, making their disposal problematic. At current RCRA limits, the leaching of Ag is not a problem. JF - Dental materials : official publication of the Academy of Dental Materials AU - Stone, M E AU - Pederson, E D AU - Cohen, M E AU - Ragain, J C AU - Karaway, R S AU - Auxer, R A AU - Saluta, A R AD - The Naval Dental Research Institute, Building 1H, 310A B Street, 60088-5259, Great Lakes, IL 60088-5259, USA. mark.stone@ndri.med.navy.mil Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 289 EP - 294 VL - 18 IS - 4 SN - 0109-5641, 0109-5641 KW - Dental Waste KW - 0 KW - Hazardous Waste KW - Silver KW - 3M4G523W1G KW - Dental Amalgam KW - 8049-85-2 KW - Mercury KW - FXS1BY2PGL KW - Dentistry KW - United States KW - Hazardous Waste -- legislation & jurisprudence KW - United States Environmental Protection Agency KW - Chemistry Techniques, Analytical -- methods KW - Maximum Allowable Concentration KW - Toxicity Tests KW - Silver -- analysis KW - Mercury -- analysis KW - Dental Waste -- analysis KW - Dental Amalgam -- chemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71661997?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Dental+materials+%3A+official+publication+of+the+Academy+of+Dental+Materials&rft.atitle=Residual+mercury+content+and+leaching+of+mercury+and+silver+from+used+amalgam+capsules.&rft.au=Stone%2C+M+E%3BPederson%2C+E+D%3BCohen%2C+M+E%3BRagain%2C+J+C%3BKaraway%2C+R+S%3BAuxer%2C+R+A%3BSaluta%2C+A+R&rft.aulast=Stone&rft.aufirst=M&rft.date=2002-06-01&rft.volume=18&rft.issue=4&rft.spage=289&rft.isbn=&rft.btitle=&rft.title=Dental+materials+%3A+official+publication+of+the+Academy+of+Dental+Materials&rft.issn=01095641&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-08-29 N1 - Date created - 2002-05-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Electron energy loss spectroscopy techniques for the study of microbial chromium(VI) reduction. AN - 71582289; 11943357 AB - Electron energy loss spectroscopy (EELS) techniques were used to determine oxidation state, at high spatial resolution, of chromium associated with the metal-reducing bacteria, Shewanella oneidensis, in anaerobic cultures containing Cr(VI)O4(2-). These techniques were applied to fixed cells examined in thin section by conventional transmission electron microscopy (TEM) as well as unfixed, hydrated bacteria examined by environmental cell (EC)-TEM. Two distinct populations of bacteria were observed by TEM: bacteria exhibiting low image contrast and bacteria exhibiting high contrast in their cell membrane (or boundary) structure which was often encrusted with high-contrast precipitates. Measurements by EELS demonstrated that cell boundaries became saturated with low concentrations of Cr and the precipitates encrusting bacterial cells contained a reduced form of Cr in oxidation state + 3 or lower. JF - Journal of microbiological methods AU - Daulton, Tyrone L AU - Little, Brenda J AU - Lowe, Kristine AU - Jones-Meehan, Joanne AD - Marine Geosciences Division, Naval Research Laboratory, Stennis Space Center, MS 39529, USA. tld@howdy.wustl.edu Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 39 EP - 54 VL - 50 IS - 1 SN - 0167-7012, 0167-7012 KW - Culture Media KW - 0 KW - Chromium KW - 0R0008Q3JB KW - chromium hexavalent ion KW - 18540-29-9 KW - Index Medicus KW - Shewanella -- metabolism KW - Shewanella -- ultrastructure KW - Microscopy, Electron -- instrumentation KW - Chromium -- chemistry KW - Spectrum Analysis -- methods KW - Microscopy, Electron -- methods KW - Spectrum Analysis -- instrumentation KW - Shewanella -- growth & development UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71582289?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+microbiological+methods&rft.atitle=Electron+energy+loss+spectroscopy+techniques+for+the+study+of+microbial+chromium%28VI%29+reduction.&rft.au=Daulton%2C+Tyrone+L%3BLittle%2C+Brenda+J%3BLowe%2C+Kristine%3BJones-Meehan%2C+Joanne&rft.aulast=Daulton&rft.aufirst=Tyrone&rft.date=2002-06-01&rft.volume=50&rft.issue=1&rft.spage=39&rft.isbn=&rft.btitle=&rft.title=Journal+of+microbiological+methods&rft.issn=01677012&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-07-19 N1 - Date created - 2002-04-10 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - South Africa's Chemical and Biological Warfare Programme: A Historical and International Perspective AN - 60615872; 200304474 AB - This article describes important historical roots & factors that influenced the evolution of South Africa's past covert chemical & biological warfare (CBW) program, Project Coast. Some of the complex international linkages developed under the auspices of Project Coast are also discussed. The conclusion discusses some of the characteristics of the program that help to explain these widely varying assessments. Adapted from the source document. JF - Journal of Southern African Studies AU - Purkitt, Helen E AU - Burgess, Stephen AD - Dept Political Science, United States Naval Academy, Annapolis, MD purkitt@toast.net Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 229 EP - 253 VL - 28 IS - 2 SN - 0305-7070, 0305-7070 KW - Project Coast KW - Biological Weapons KW - Chemical Weapons KW - Chemical Warfare KW - Biological Warfare KW - South Africa KW - Historical Development KW - article KW - 9063: international relations; international relations KW - 9105: politics; national-level politics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60615872?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Southern+African+Studies&rft.atitle=South+Africa%27s+Chemical+and+Biological+Warfare+Programme%3A+A+Historical+and+International+Perspective&rft.au=Purkitt%2C+Helen+E%3BBurgess%2C+Stephen&rft.aulast=Purkitt&rft.aufirst=Helen&rft.date=2002-06-01&rft.volume=28&rft.issue=2&rft.spage=229&rft.isbn=&rft.btitle=&rft.title=Journal+of+Southern+African+Studies&rft.issn=03057070&rft_id=info:doi/10.1080%2F03057070220140685 LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - JSASDC N1 - SubjectsTermNotLitGenreText - Historical Development; South Africa; Chemical Warfare; Biological Warfare; Chemical Weapons; Biological Weapons DO - http://dx.doi.org/10.1080/03057070220140685 ER - TY - JOUR T1 - Coalition Warfare: The Commander's Role AN - 60603060; 200301696 AB - Explores the role of NATO's commander, General Clark, in successfully waging Operation Allied Force, a 78-day air campaign against the Serbs to stop fighting in Kosovo. General Clark was required to use his diplomatic skills to convince diplomats, NATO political leaders, national political leaders, & national chiefs of defense to support a sustained effort. General Clark's strategy was not to silence opposition, but to encourage skeptic countries, such as Greece, Italy, Hungary, Germany, & sometimes the US, to pursue their own national agendas & to give support at whatever level they were willing. To achieve greater cooperation, General Clark involved ambassadors in the details of the operation & allowed the North Atlantic Council (NAC) to approve or deny sensitive air targets. He also resorted to exaggerations of Serbian brutality & of NATO bombing effectiveness to ride opposition. Serbian expertise at troop concealment & the ever-present fear of Russian diplomatic or military intervention were only some of the factors that challenged the operation. General Clark was essentially fighting two wars -- a military engagement against Milosevic & a defensive war against reluctant NATO members & NATO critics. L. A. Hoffman JF - Defense & Security Analysis AU - Reveron, Derek S AD - Dept Political Science, US Naval Academy, Annapolis, MD Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 107 EP - 121 VL - 18 IS - 2 SN - 1475-1798, 1475-1798 KW - Serbia KW - Military Strategy KW - Kosovo KW - Diplomacy KW - Coalitions KW - International Alliances KW - Negotiation KW - article KW - 9065: international relations; international institutions KW - 9091: government/political systems; armed forces UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60603060?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Defense+%26+Security+Analysis&rft.atitle=Coalition+Warfare%3A+The+Commander%27s+Role&rft.au=Reveron%2C+Derek+S&rft.aulast=Reveron&rft.aufirst=Derek&rft.date=2002-06-01&rft.volume=18&rft.issue=2&rft.spage=107&rft.isbn=&rft.btitle=&rft.title=Defense+%26+Security+Analysis&rft.issn=14751798&rft_id=info:doi/10.1080%2F147517902201325 LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - SubjectsTermNotLitGenreText - International Alliances; Military Strategy; Coalitions; Negotiation; Diplomacy; Serbia; Kosovo DO - http://dx.doi.org/10.1080/147517902201325 ER - TY - JOUR T1 - Geologic structure and tectonic evolution of the Canada Basin, Arctic Ocean AN - 52076636; 2002-062483 AB - Geophysical and geologic data indicate that Canada Basin is underlain by oceanic crust of normal thickness (7+ or -1 km) formed in two stages of sea-floor spreading that followed Sinemurian to early Neocomian pre-breakup extension. The earlier stage of spreading separated Northwind Ridge from the Arctic Islands, and rotated it 35 degrees clockwise, during the Berriasian (?) and Valanginian. The younger stage, well expressed in low-amplitude magnetic anomalies that radiate northward from a pole in the lower Mackenzie Valley, is Hauterivian to earliest Aptian. . The axis of these anomalies coincides with a narrow linear negative gravity anomaly that is typical of extinct spreading centers, and a graben recorded in seismic reflection data. Sediment from the Mackenzie River deposited a clastic wedge (oceanic layer 1) in the Canada Basin that is 14 km thick at the Mackenzie Delta and thins to 5 to 7 km beneath the western part of the basin. Underlying layer 1 are well-bedded strata of erratic thickness ranging up to 1 km that contain strong seismic reflectors and intrusive bodies. We interpret this unit, which contains numerous normal faults older than layer 1, to be oceanic layer 2A. Northwind Escarpment, which bounds Canada Basin on the west, is a sediment-starved, non-volcanic margin containing grabens and a belt of transitional crust as much as 100 km wide that stands 1 to 3 km higher than oceanic crust in the central Canada Basin. In these and other respects it resembles the classic sediment-starved nonvolcanic passive continental margin off western Iberia. JF - AAPG Bulletin AU - Grantz, Arthur AU - Kovacs, L C AU - McAdoo, D C AU - Hart, P E AU - Anonymous Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 1143 EP - 1144 PB - American Association of Petroleum Geologists, Tulsa, OK VL - 86 IS - 6 SN - 0149-1423, 0149-1423 KW - oceanic crust KW - geophysical surveys KW - extension tectonics KW - gravity anomalies KW - normal faults KW - sea-floor spreading KW - thickness KW - clastic wedges KW - Arctic Ocean KW - tectonics KW - faults KW - systems KW - continental margin KW - passive margins KW - geophysical methods KW - magnetic anomalies KW - reflection methods KW - Mackenzie River valley KW - seismic methods KW - grabens KW - Canada Basin KW - plate tectonics KW - Northwind Ridge KW - surveys KW - Northwind Escarpment KW - crust KW - 18:Solid-earth geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52076636?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=AAPG+Bulletin&rft.atitle=Geologic+structure+and+tectonic+evolution+of+the+Canada+Basin%2C+Arctic+Ocean&rft.au=Grantz%2C+Arthur%3BKovacs%2C+L+C%3BMcAdoo%2C+D+C%3BHart%2C+P+E%3BAnonymous&rft.aulast=Grantz&rft.aufirst=Arthur&rft.date=2002-06-01&rft.volume=86&rft.issue=6&rft.spage=1143&rft.isbn=&rft.btitle=&rft.title=AAPG+Bulletin&rft.issn=01491423&rft_id=info:doi/ L2 - http://aapgbull.geoscienceworld.org/ LA - English DB - GeoRef N1 - Conference title - AAPG Pacific Section and SPE Western Region conference; Energy frontiers; a 2002 perspective joint conference of geoscientists and petroleum engineers N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by American Association of Petroleum Geologists, Tulsa, OK, United States N1 - Date revised - 2002-01-01 N1 - PubXState - OK N1 - Last updated - 2012-06-07 N1 - CODEN - AABUD2 N1 - SubjectsTermNotLitGenreText - Arctic Ocean; Canada Basin; clastic wedges; continental margin; crust; extension tectonics; faults; geophysical methods; geophysical surveys; grabens; gravity anomalies; Mackenzie River valley; magnetic anomalies; normal faults; Northwind Escarpment; Northwind Ridge; oceanic crust; passive margins; plate tectonics; reflection methods; sea-floor spreading; seismic methods; surveys; systems; tectonics; thickness ER - TY - JOUR T1 - Crystal-size distributions of clays during episodic diagenesis; the Salton Sea geothermal system AN - 52074954; 2002-064837 AB - Crystal-size distributions (CSDs) for clay minerals with depth were measured from the Salton Sea Geothermal Field (SSGF) as a test for the presence and meaning of theoretical crystal-size distributions in a natural system. The SSGF is a classic open hydrothermal system, and crystals are forming directly without apparent modification of early-formed crystals, over a wide range of temperature. Thus, the measured CSDs are the actual distributions for a single episode in which all crystals grew at the same time from solution at different temperatures and depths, rather than through modifications of shallower samples. Some TEM images of ion-milled samples from a range of depths were used to measure the crystal thicknesses of illite, chlorite and biotite. Grain-size histograms flatten, broaden and shift to larger sizes with increasing depth. Values of alpha and beta were calculated and used to verify that the measured distributions are log normal. Reduced grain-size distributions for illite in SSGF samples obey steady-state constraints. The observations appear to be consistent with evolution of illite with increasing depth in the SSGF system by growth in an open system giving rise to log-normal distributions, followed by supply-controlled growth in an open system. Because crystals at different depths grew simultaneously under different temperature and fluid conditions as a function of depth, they do not represent different stages of a single evolving system. The relations imply that isochemical and isothermal systems which permit an evolving system to be sampled are rare or non-existent. The data for distributions for a given depth in the SSGF are consistent with growth in an open system. The collective relations therefore imply that caution should be used in interpreting conditions of crystal growth in natural systems even where CSDs give results which are necessary for, but not sufficient to prove, a given modeled mechanism. JF - Clays and Clay Minerals AU - Kim, Jin-wook AU - Peacor, Donald R Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 371 EP - 380 PB - Clay Minerals Society, Clarkson, NY VL - 50 IS - 3 SN - 0009-8604, 0009-8604 KW - United States KW - silicates KW - Salton Sea KW - closed systems KW - Imperial County California KW - grain size KW - clay mineralogy KW - Ostwald ripening KW - illite KW - recrystallization KW - TEM data KW - crystals KW - California KW - geothermal fields KW - size distribution KW - Salton Sea geothermal field KW - open systems KW - diagenesis KW - sheet silicates KW - 06A:Sedimentary petrology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52074954?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Clays+and+Clay+Minerals&rft.atitle=Crystal-size+distributions+of+clays+during+episodic+diagenesis%3B+the+Salton+Sea+geothermal+system&rft.au=Kim%2C+Jin-wook%3BPeacor%2C+Donald+R&rft.aulast=Kim&rft.aufirst=Jin-wook&rft.date=2002-06-01&rft.volume=50&rft.issue=3&rft.spage=371&rft.isbn=&rft.btitle=&rft.title=Clays+and+Clay+Minerals&rft.issn=00098604&rft_id=info:doi/10.1346%2F000986002760833747 L2 - http://www.ingentaconnect.com/content/cms/ccm LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 23 N1 - PubXState - NY N1 - Document feature - illus. incl. 1 table N1 - Last updated - 2012-06-07 N1 - CODEN - CLCMAB N1 - SubjectsTermNotLitGenreText - California; clay mineralogy; closed systems; crystals; diagenesis; geothermal fields; grain size; illite; Imperial County California; open systems; Ostwald ripening; recrystallization; Salton Sea; Salton Sea geothermal field; sheet silicates; silicates; size distribution; TEM data; United States DO - http://dx.doi.org/10.1346/000986002760833747 ER - TY - JOUR T1 - Aerogeophysical evidence for the rotational opening of the Canada Basin AN - 52072323; 2002-062460 AB - The availability of airborne gravimetry motivated the Navy's return to the Arctic to augment previous long-range aeromagnetic surveys of the ice-covered ocean basins. Additionally the new aerogeophysical surveys densify and obliquely cross the old tracks, allowing for a joint magnetics leveling. The improved maps provide insights into the tectonic evolution of the region. The gravity over the Canada Basin shows the same general structures as seen in the ERS derived gravity, but with somewhat better resolution. The linear central gravity low is located asymmetrically eastward of the center of a broad, wedge-shaped high in the center of the southern Canada basin. A bilaterally symmetric pattern of magnetic lineations 300 km wide flank the gravity low, strengthening the claim that this represents an extinct spreading axis. However, the fossil axis appears to have propagated southward into the basin replacing an earlier spreading center to the west. The asymmetry in location of the fossil axis with respect to the margins and the high gravity wedge are explained by this change in spreading pattern. The magnetic and gravity fabric changes again in the region between the Alaska margin and the southern Chukchi Borderlands, implying at least three stages of opening. In spite of the complexities, the overall pattern is consistent with the formation of the southern Canada Basin by rotation of the North Slope away from the Canadian margin, initially around a pole near the Mackenzie Delta, then some 500 km to the southwest, and finally 500 km south of the Delta. JF - AAPG Bulletin AU - Brozena, J M AU - Lawver, L A AU - Kovacs, L C AU - Childers, V A AU - Anonymous Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 1138 PB - American Association of Petroleum Geologists, Tulsa, OK VL - 86 IS - 6 SN - 0149-1423, 0149-1423 KW - United States KW - patterns KW - Mackenzie Delta KW - North Slope KW - geophysical surveys KW - geophysical methods KW - magnetic methods KW - Northwest Territories KW - Canada Basin KW - gravity methods KW - Chukchi Sea KW - Canada KW - Northern Alaska KW - sea-floor spreading KW - surveys KW - Arctic Ocean KW - Western Canada KW - Alaska KW - tectonics KW - 18:Solid-earth geophysics KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52072323?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=AAPG+Bulletin&rft.atitle=Aerogeophysical+evidence+for+the+rotational+opening+of+the+Canada+Basin&rft.au=Brozena%2C+J+M%3BLawver%2C+L+A%3BKovacs%2C+L+C%3BChilders%2C+V+A%3BAnonymous&rft.aulast=Brozena&rft.aufirst=J&rft.date=2002-06-01&rft.volume=86&rft.issue=6&rft.spage=1138&rft.isbn=&rft.btitle=&rft.title=AAPG+Bulletin&rft.issn=01491423&rft_id=info:doi/ L2 - http://aapgbull.geoscienceworld.org/ LA - English DB - GeoRef N1 - Conference title - AAPG Pacific Section and SPE Western Region conference; Energy frontiers; a 2002 perspective joint conference of geoscientists and petroleum engineers N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by American Association of Petroleum Geologists, Tulsa, OK, United States N1 - Date revised - 2002-01-01 N1 - PubXState - OK N1 - Last updated - 2012-06-07 N1 - CODEN - AABUD2 N1 - SubjectsTermNotLitGenreText - Alaska; Arctic Ocean; Canada; Canada Basin; Chukchi Sea; geophysical methods; geophysical surveys; gravity methods; Mackenzie Delta; magnetic methods; North Slope; Northern Alaska; Northwest Territories; patterns; sea-floor spreading; surveys; tectonics; United States; Western Canada ER - TY - JOUR T1 - Computer graphics visualization of mineral growth AN - 51722798; 2005-033293 JF - Rocks and Minerals AU - Gaber, B P AU - Anonymous Y1 - 2002/06// PY - 2002 DA - June 2002 SP - 170 EP - 171 PB - Heldref Publications, Washington, DC VL - 77 IS - 3 SN - 0035-7529, 0035-7529 KW - computer programs KW - visualization KW - technology KW - graphic display KW - data processing KW - crystal growth KW - minerals KW - observations KW - 01A:General mineralogy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51722798?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Rocks+and+Minerals&rft.atitle=Computer+graphics+visualization+of+mineral+growth&rft.au=Gaber%2C+B+P%3BAnonymous&rft.aulast=Gaber&rft.aufirst=B&rft.date=2002-06-01&rft.volume=77&rft.issue=3&rft.spage=170&rft.isbn=&rft.btitle=&rft.title=Rocks+and+Minerals&rft.issn=00357529&rft_id=info:doi/ L2 - http://www.rocksandminerals.org/ LA - English DB - GeoRef N1 - Conference title - 28th Rochester mineralogical symposium N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2005-01-01 N1 - PubXState - DC N1 - Last updated - 2012-06-07 N1 - CODEN - ROCMAR N1 - SubjectsTermNotLitGenreText - computer programs; crystal growth; data processing; graphic display; minerals; observations; technology; visualization ER - TY - JOUR T1 - Polar Ozone and Aerosol Measurement III measurements of water vapor in the upper troposphere and lowermost stratosphere AN - 18602699; 5464138 AB - We present water vapor measurements made by the Polar Ozone and Aerosol Measurement (POAM) III instrument since May 1998 in the upper troposphere and lowermost stratosphere. While POAM III is primarily a stratospheric instrument, many of the POAM III occultation measurements allow for the retrieval of water vapor in the upper troposphere. The Measurements of Ozone and Water Vapor by Airbus In-Service Aircraft (MOZAIC) instruments provide a large number of coincident measurements and thus offer the best opportunity to validate POAM measurements in the highly spatially variable regions of the upper troposphere-lowermost stratosphere, where the mixing ratios are much larger than those found throughout most of the stratosphere. The comparison shows that there is no statistically significant difference in the response of the two instruments to changes in water vapor and that in the regime where the MOZAIC measurements are thought to be most accurate, the water vapor mixing ratios measured by POAM are 10% higher. The POAM III Northern Hemisphere measurements are taken from 55 degree to 71 degree and show a qualitatively reasonable seasonal variation, with high mixing ratios in the upper troposphere in the summer and low mixing ratios in the winter. Comparisons of the seasonal variations of the POAM measurements with those from the upper tropospheric Microwave Limb Sounder (MLS) measurements from the early 1990s show qualitative similarities. The similar to 1 km vertical resolution of POAM measurements allows us to study in greater detail than other satellite instruments the complex variations in water vapor that occur in the upper troposphere and lowermost stratosphere. Among the interesting features observed is a rise in the level of the high-latitude hygropause from April through September. JF - Journal of Geophysical Research. D. Atmospheres AU - Nedoluha, GE AU - Bevilacqua, R M AU - Hoppel, K W AU - Lumpe, J D AU - Smit, H AD - Naval Research Laboratory, Washington, D.C., USA Y1 - 2002/05/27/ PY - 2002 DA - 2002 May 27 PB - American Geophysical Union, 2000 Florida Ave., N.W. Washington, DC 20009 USA, [mailto:cust--ser@kosmos.agu.org] VL - 107 IS - D9-D10 SN - 0148-0227, 0148-0227 KW - Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts KW - Citation No. 4103 KW - Ozone in troposphere KW - Ozone measurements KW - Ozone in stratosphere KW - Water vapor in the atmosphere KW - Water vapor in stratosphere KW - Water vapor measurement techniques KW - Polar Ozone and Aerosol Measurement Experiment (POAM-III) KW - M2 551.510.42:Air Pollution (551.510.42) KW - M2 551.510.534:Ozone Layer (551.510.534) KW - M2 551.510.412:Tropospheric (551.510.412) KW - M2 551.510.413.2:Stratospheric (551.510.413.2) KW - M2 551.507.352:Aircraft (551.507.352) KW - M2 551.510.4:Composition of the atmosphere (551.510.4) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18602699?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research.+D.+Atmospheres&rft.atitle=Polar+Ozone+and+Aerosol+Measurement+III+measurements+of+water+vapor+in+the+upper+troposphere+and+lowermost+stratosphere&rft.au=Nedoluha%2C+GE%3BBevilacqua%2C+R+M%3BHoppel%2C+K+W%3BLumpe%2C+J+D%3BSmit%2C+H&rft.aulast=Nedoluha&rft.aufirst=GE&rft.date=2002-05-27&rft.volume=107&rft.issue=D9-D10&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research.+D.+Atmospheres&rft.issn=01480227&rft_id=info:doi/10.1029%2F2001JD000793 LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Ozone in troposphere; Ozone measurements; Ozone in stratosphere; Water vapor in the atmosphere; Water vapor in stratosphere; Water vapor measurement techniques; Polar Ozone and Aerosol Measurement Experiment (POAM-III) DO - http://dx.doi.org/10.1029/2001JD000793 ER - TY - JOUR T1 - Monitoring anthrax vaccine safety in US military service members on active duty: surveillance of 1998 hospitalizations in temporal association with anthrax immunization AN - 18434684; 5411445 AB - We compared 1998 hospitalizations in active-duty US military personnel for possible temporal association with anthrax immunization. Immunization, demographic, and hospitalization data were analyzed using Cox proportional hazards modeling for hospitalization within 42 days of vaccination. Discharge diagnoses were aggregated into 14 International Classification of Disease, Ninth Revision, Clinical Modification (ICD-9-CM) categories. Approximately 11% of subjects received one or more doses of vaccine during 1998; those immunized were more likely to be younger and male. Lower hospitalization rates were observed across doses and diagnostic categories among the immunized. Adjusted risk ratios for hospitalization by diagnostic category suggest that immunized service members were at equal or lesser risk for hospitalization than the non-immunized. JF - Vaccine AU - Sato, P A AU - Reed, R J AU - Smith, T C AU - Wang, L AD - Department of Defense Center for Deployment Health Research, Naval Health Research Center, P.O. Box 85122, San Diego, CA 92186-5122, USA, reed@nhrc.navy.mil Y1 - 2002/05/22/ PY - 2002 DA - 2002 May 22 SP - 2369 EP - 2374 VL - 20 IS - 17-18 SN - 0264-410X, 0264-410X KW - anthrax KW - man KW - vaccines KW - Microbiology Abstracts B: Bacteriology; Health & Safety Science Abstracts; Immunology Abstracts KW - J 02834:Vaccination and immunization KW - F 06807:Active immunization KW - H 4000:Food and Drugs UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18434684?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Vaccine&rft.atitle=Monitoring+anthrax+vaccine+safety+in+US+military+service+members+on+active+duty%3A+surveillance+of+1998+hospitalizations+in+temporal+association+with+anthrax+immunization&rft.au=Sato%2C+P+A%3BReed%2C+R+J%3BSmith%2C+T+C%3BWang%2C+L&rft.aulast=Sato&rft.aufirst=P&rft.date=2002-05-22&rft.volume=20&rft.issue=17-18&rft.spage=2369&rft.isbn=&rft.btitle=&rft.title=Vaccine&rft.issn=0264410X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - Are Gulf War veterans experiencing illness due to exposure to smoke from Kuwaiti oil well fires? Examination of Department of Defense hospitalization data. AN - 71667596; 11994230 AB - There has been much concern among the public and veterans that specific environmental exposures incurred during the Gulf War were the cause of subsequent illness among Gulf War veterans. In this historical cohort study, the authors compared the postwar morbidity of US military personnel exposed to smoke from the 1991 Kuwaiti oil well fires with that of unexposed personnel. Complete exposure and demographic data were available for 405,142 active-duty Gulf War veterans who did not remain in the region after the war. The authors used data from all Department of Defense hospitals for the period August 1, 1991-July 31, 1999 to estimate rates of hospitalization due to any cause, hospitalization due to a diagnosis in one of 15 major categories, and hospitalization due to one of nine diagnoses likely to be manifestations of smoke exposure. Exposures to particulate matter from oil-well-fire smoke were based on the integration of meteorologic data, diffusion modeling, and troop location data. The authors constructed seven exposure groups combining duration and amount of exposure. In Cox modeling, three of the 25 models showed an increased adjusted risk of hospitalization. However, there was no evidence of a dose-response relation. Despite some limitations, these data do not support the hypothesis that Gulf War veterans have an increased risk of postwar morbidity from exposure to Kuwaiti oil-well-fire smoke. JF - American journal of epidemiology AU - Smith, Tyler C AU - Heller, Jack M AU - Hooper, Tomoko I AU - Gackstetter, Gary D AU - Gray, Gregory C AD - Department of Defense Center for Deployment Health Research, Naval Health Research Center, San Diego, CA 92186-5122, USA. Smith@nhrc.navy.mil Y1 - 2002/05/15/ PY - 2002 DA - 2002 May 15 SP - 908 EP - 917 VL - 155 IS - 10 SN - 0002-9262, 0002-9262 KW - Petroleum KW - 0 KW - Smoke KW - Index Medicus KW - Fires KW - Humans KW - Cohort Studies KW - Adult KW - Aged KW - Middle Aged KW - Kuwait KW - Hospitalization -- statistics & numerical data KW - Adolescent KW - United States -- epidemiology KW - Male KW - Female KW - Proportional Hazards Models KW - Smoke -- adverse effects KW - Veterans -- statistics & numerical data KW - Persian Gulf Syndrome -- epidemiology KW - Persian Gulf Syndrome -- etiology KW - Inhalation Exposure -- adverse effects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71667596?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+journal+of+epidemiology&rft.atitle=Are+Gulf+War+veterans+experiencing+illness+due+to+exposure+to+smoke+from+Kuwaiti+oil+well+fires%3F+Examination+of+Department+of+Defense+hospitalization+data.&rft.au=Smith%2C+Tyler+C%3BHeller%2C+Jack+M%3BHooper%2C+Tomoko+I%3BGackstetter%2C+Gary+D%3BGray%2C+Gregory+C&rft.aulast=Smith&rft.aufirst=Tyler&rft.date=2002-05-15&rft.volume=155&rft.issue=10&rft.spage=908&rft.isbn=&rft.btitle=&rft.title=American+journal+of+epidemiology&rft.issn=00029262&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-06-04 N1 - Date created - 2002-05-07 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - The Academic Market in Mexico: Reflections from the Sociology of Work TT - El mercado academico en Mexico: reflexiones desde la sociologia del trabajo AN - 60465321; 200316604 AB - This article discusses some considerations concerning the study of the academic market as a labor market. It is situated within the field of the sociology of work. The discussion is based on the analytical proposals of the theories of internal & dual labor markets. This article attempts to analyze the labor market of public universities in Mexico in opposition to the main characteristics to these sorts of markets. In order to approach this working environment, the case of the Metropolitan Autonomous U is taken to show some of the factors that allow this study from these sociological proposals. 5 Tables, 27 References. Adapted from the source document. JF - Sociologica AU - Rondero Lopez, Norma AD - Dept Sociologia, U Autonoma Metropolitana-Azcapotzalco nrl@correo.azc.uam.mx Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 205 EP - 229 VL - 17 IS - 49 SN - 0187-0173, 0187-0173 KW - Mexico KW - Employment Opportunities KW - Labor Market KW - Universities KW - College Faculty KW - article KW - 1020: social differentiation; sociology of occupations & professions KW - 0621: complex organization; jobs, work organization, workplaces, & unions UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60465321?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Asocabs&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Sociologica&rft.atitle=The+Academic+Market+in+Mexico%3A+Reflections+from+the+Sociology+of+Work&rft.au=Rondero+Lopez%2C+Norma&rft.aulast=Rondero+Lopez&rft.aufirst=Norma&rft.date=2002-05-01&rft.volume=17&rft.issue=49&rft.spage=205&rft.isbn=&rft.btitle=&rft.title=Sociologica&rft.issn=01870173&rft_id=info:doi/ LA - Spanish DB - Sociological Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - SOCIEU N1 - SubjectsTermNotLitGenreText - Labor Market; College Faculty; Mexico; Employment Opportunities; Universities ER - TY - JOUR T1 - Teaching ocean wave forecasting using computer-generated visualization and animation; Part 1, Sea forecasting AN - 52089252; 2002-055383 AB - Ocean waves are the most recognized phenomena in oceanography. Unfortunately, undergraduate study of ocean wave dynamics and forecasting involves mathematics and physics and therefore can pose difficulties with some students because of the subject's interrelated dependence on time and space. Verbal descriptions and two-dimensional illustrations are often insufficient for student comprehension. Computer-generated visualization and animation offer a visually intuitive and pedagogically sound medium to present geoscience, yet there are very few oceanographic examples. A two-part article series is offered to explain ocean wave forecasting using computer-generated visualization and animation. This paper, Part 1, addresses forecasting of sea wave conditions and serves as the basis for the more difficult topic of swell wave forecasting addressed in Part 2. Computer-aided visualization and animation, accompanied by oral explanation, are a welcome pedagogical supplement to more traditional methods of instruction. In this article, several MATLAB (super R) software programs have been written to visualize and animate development and comparison of wave spectra, wave interference, and forecasting of sea conditions. These programs also set the stage for the more advanced and difficult animation topics in Part 2. The programs are user-friendly, interactive, easy to modify, and developed as instructional tools. By using these software programs, teachers can enhance their instruction of these topics with colorful visualizations and animation without requiring an extensive background in computer programming. JF - Computers & Geosciences AU - Whitford, Dennis J Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 537 EP - 546 PB - Pergamon, New York-Oxford-Toronto VL - 28 IS - 4 SN - 0098-3004, 0098-3004 KW - data processing KW - prediction KW - education KW - information management KW - oceanography KW - data management KW - computer programs KW - visualization KW - college-level education KW - dynamics KW - ocean waves KW - curricula KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52089252?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Computers+%26+Geosciences&rft.atitle=Teaching+ocean+wave+forecasting+using+computer-generated+visualization+and+animation%3B+Part+1%2C+Sea+forecasting&rft.au=Whitford%2C+Dennis+J&rft.aulast=Whitford&rft.aufirst=Dennis&rft.date=2002-05-01&rft.volume=28&rft.issue=4&rft.spage=537&rft.isbn=&rft.btitle=&rft.title=Computers+%26+Geosciences&rft.issn=00983004&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5840&_auth=y&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=e5198452fad934c6346f38b57511c8e0 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 32 N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - CODEN - GGEOD5 N1 - SubjectsTermNotLitGenreText - college-level education; computer programs; curricula; data management; data processing; dynamics; education; information management; ocean waves; oceanography; prediction; visualization ER - TY - JOUR T1 - Using GPS to teach more than accurate positions AN - 52086222; 2002-058139 JF - Journal of Geoscience Education AU - Johnson, Marie C AU - Guth, Peter L Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 241 EP - 246 PB - National Association of Geoscience Teachers, Bellingham, WA VL - 50 IS - 3 SN - 1089-9995, 1089-9995 KW - United States KW - Global Positioning System KW - technology KW - geophysical surveys KW - Annapolis Maryland KW - field trips KW - education KW - qualitative analysis KW - Anne Arundel County Maryland KW - college-level education KW - topography KW - errors KW - quantitative analysis KW - sediments KW - Maryland KW - Great Sand Dunes National Monument KW - Atlantic Coastal Plain KW - sand KW - precision KW - clastic sediments KW - measurement KW - surveys KW - Colorado KW - instruments KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52086222?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geoscience+Education&rft.atitle=Using+GPS+to+teach+more+than+accurate+positions&rft.au=Johnson%2C+Marie+C%3BGuth%2C+Peter+L&rft.aulast=Johnson&rft.aufirst=Marie&rft.date=2002-05-01&rft.volume=50&rft.issue=3&rft.spage=241&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geoscience+Education&rft.issn=10899995&rft_id=info:doi/ L2 - http://www.nagt.org/nagt/jge/issues.html LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 15 N1 - PubXState - WA N1 - Document feature - illus. incl. 2 tables, sketch map N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Annapolis Maryland; Anne Arundel County Maryland; Atlantic Coastal Plain; clastic sediments; college-level education; Colorado; education; errors; field trips; geophysical surveys; Global Positioning System; Great Sand Dunes National Monument; instruments; Maryland; measurement; precision; qualitative analysis; quantitative analysis; sand; sediments; surveys; technology; topography; United States ER - TY - JOUR T1 - Teaching ocean wave forecasting using computer-generated visualization and animation; Part 2, Swell forecasting AN - 52084775; 2002-055384 AB - This paper, the second of a two-part series, introduces undergraduate students to ocean wave forecasting using interactive computer-generated visualization and animation. Verbal descriptions and two-dimensional illustrations are often insufficient for student comprehension. Fortunately, the introduction of computers in the geosciences provides a tool for addressing this problem. Computer-generated visualization and animation, accompanied by oral explanation, have been shown to be a pedagogical improvement to more traditional methods of instruction. Cartographic science and other disciplines using geographical information systems have been especially aggressive in pioneering the use of visualization and animation, whereas oceanography has not. This paper will focus on the teaching of ocean swell wave forecasting, often considered a difficult oceanographic topic due to the mathematics and physics required, as well as its interdependence on time and space. Several MATLAB (super R) software programs are described and offered to visualize and animate group speed, frequency dispersion, angular dispersion, propagation, and wave height forecasting of deep water ocean swell waves. Teachers may use these interactive visualizations and animations without requiring an extensive background in computer programming. JF - Computers & Geosciences AU - Whitford, Dennis J Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 547 EP - 554 PB - Pergamon, New York-Oxford-Toronto VL - 28 IS - 4 SN - 0098-3004, 0098-3004 KW - computer programs KW - visualization KW - college-level education KW - ocean waves KW - swells KW - marine geology KW - data processing KW - education KW - information management KW - oceanography KW - data management KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52084775?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Computers+%26+Geosciences&rft.atitle=Teaching+ocean+wave+forecasting+using+computer-generated+visualization+and+animation%3B+Part+2%2C+Swell+forecasting&rft.au=Whitford%2C+Dennis+J&rft.aulast=Whitford&rft.aufirst=Dennis&rft.date=2002-05-01&rft.volume=28&rft.issue=4&rft.spage=547&rft.isbn=&rft.btitle=&rft.title=Computers+%26+Geosciences&rft.issn=00983004&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5840&_auth=y&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=e5198452fad934c6346f38b57511c8e0 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 19 N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - CODEN - GGEOD5 N1 - SubjectsTermNotLitGenreText - college-level education; computer programs; data management; data processing; education; information management; marine geology; ocean waves; oceanography; swells; visualization ER - TY - JOUR T1 - Holocene mass wasting on upper non-Polar continental slopes, due to post-glacial ocean warming and hydrate dissociation? AN - 52007099; 2003-025393 JF - Geophysical Research Letters AU - Vogt, Peter R AU - Jung, Woo-Yeol Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 4 PB - American Geophysical Union, Washington, DC VL - 29 IS - 9 SN - 0094-8276, 0094-8276 KW - last glacial maximum KW - continental slope KW - lower Holocene KW - glaciation KW - gas hydrates KW - aliphatic hydrocarbons KW - paleo-oceanography KW - Storegga Slide KW - Europe KW - Norwegian Sea KW - Holocene KW - deglaciation KW - Cenozoic KW - mass movements KW - Arctic Ocean KW - ocean floors KW - methane KW - Western Europe KW - Quaternary KW - alkanes KW - slumping KW - sea-level changes KW - Scandinavia KW - organic compounds KW - hydrocarbons KW - glacial geology KW - continental shelf KW - Norway KW - slope stability KW - 24:Quaternary geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52007099?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Geophysical+Research+Letters&rft.atitle=Holocene+mass+wasting+on+upper+non-Polar+continental+slopes%2C+due+to+post-glacial+ocean+warming+and+hydrate+dissociation%3F&rft.au=Vogt%2C+Peter+R%3BJung%2C+Woo-Yeol&rft.aulast=Vogt&rft.aufirst=Peter&rft.date=2002-05-01&rft.volume=29&rft.issue=9&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Geophysical+Research+Letters&rft.issn=00948276&rft_id=info:doi/10.1029%2F2001GL013488 L2 - http://www.agu.org/journals/gl/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 26 N1 - PubXState - DC N1 - Document feature - illus. incl. geol. sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - GPRLAJ N1 - SubjectsTermNotLitGenreText - aliphatic hydrocarbons; alkanes; Arctic Ocean; Cenozoic; continental shelf; continental slope; deglaciation; Europe; gas hydrates; glacial geology; glaciation; Holocene; hydrocarbons; last glacial maximum; lower Holocene; mass movements; methane; Norway; Norwegian Sea; ocean floors; organic compounds; paleo-oceanography; Quaternary; Scandinavia; sea-level changes; slope stability; slumping; Storegga Slide; Western Europe DO - http://dx.doi.org/10.1029/2001GL013488 ER - TY - JOUR T1 - Evaluation of perfect paint assumptions in modeling of cathodic protection systems AN - 18912009; 5401981 AB - Computational modeling often involves making assumptions; assumptions about geometric features, material characterizations or loading conditions. The validity of these assumptions will directly impact accuracy. It is an accepted practice in computational modeling of impressed current cathodic protection (ICCP) systems to define painted surfaces as perfectly insulated (`perfect paint'). While many paint systems have a high resistance, the resistance is finite rather than infinite. In this work, painted surfaces are defined with varying material properties ranging from relatively high resistance (0.0001 of the polarization response of steel) to relatively low (steel). These different material properties are assigned to the painted surfaces of a previously validated shipboard ICCP system model. All other boundary conditions are held constant. A comparison of results quantifies the effects of large but finite paint resistance on computational results and validates use of the perfectly insulated surface assumption for painted surfaces. JF - Engineering Analysis with Boundary Elements AU - DeGiorgi, V G AD - System Design and Integration Section, Mechanics of Materials Branch, Naval Research Laboratory, Code 6353, Washington, DC 20375, USA, degiorgi@anvil.nrl.navy.mil Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 435 EP - 445 VL - 26 IS - 5 SN - 0955-7997, 0955-7997 KW - paints KW - Water Resources Abstracts KW - Cathodes KW - Corrosion Control KW - Model Studies KW - SW 6070:Materials UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18912009?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Engineering+Analysis+with+Boundary+Elements&rft.atitle=Evaluation+of+perfect+paint+assumptions+in+modeling+of+cathodic+protection+systems&rft.au=DeGiorgi%2C+V+G&rft.aulast=DeGiorgi&rft.aufirst=V&rft.date=2002-05-01&rft.volume=26&rft.issue=5&rft.spage=435&rft.isbn=&rft.btitle=&rft.title=Engineering+Analysis+with+Boundary+Elements&rft.issn=09557997&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-12-21 N1 - SubjectsTermNotLitGenreText - Cathodes; Corrosion Control; Model Studies ER - TY - JOUR T1 - Toluene Inhibits Muscarinic Receptor-Mediated Cytosolic Ca super(2+) Responses in Neural Precursor Cells AN - 18463598; 5433667 AB - Toluene is widely used as a component in industrial solvents and many toluene-containing products are abused via inhalation. While many studies have demonstrated its inhibitory effects on neuronal activity, the effects of toluene on receptor signaling in proliferating and differentiating neural precursor cells are presently unclear. Here, using digital video microscopy and Ca super(2+) imaging, we investigated the effects of acute exposure to toluene on the function of muscarinic acetylcholine receptors (mAChRs) expressed in neural precursor cells. The neural precursor cells were isolated from embryonic day 13 (E13) rat cortex and expanded in serum-free medium containing basic fibroblast growth factor (bFGF). We found that the acetylcholine (ACh) analog carbachol (CCh) induced a dose-dependent increase in cytosolic Ca super(2+), which was blocked by the muscarinic receptor antagonist atropine in a reversible manner. Toluene was added to the perfusion medium and concentrations of toluene in the medium were determined by gas chromatographic analysis. Following imaging, the cells were fixed and processed for 5-bromo-2'-deoxyuridine (BrdU, cell proliferation marker) and beta -tubulin (TuJ1, neuronal marker) immunostaining. In the 5 day culture, most cells continued to divide (BrdU super(+)), while a few cells differentiated into young neurons (TuJ1 super(+)). The CCh-induced Ca super(2+) elevations in proliferating (BrdU super(+)TuJ1 super(-)) neural precursor cells were significantly reduced by acute exposure to 0.15 mM toluene and completely blocked by 10 mM toluene. Toluene's inhibition of muscarinic receptor-mediated Ca super(2+) signaling was rapid, reversible and dose-dependent with an IC sub(50) value 0.5 mM. Since muscarinic receptors mediate cell proliferation and differentiation during neural precursor cell development, these results suggest that depression of muscarinic signaling may play a role in toluene's teratogenic effect on the developing nervous system. JF - Neurotoxicology AU - Ma, W AU - Shaffer, K M AU - Pancrazio, J J AU - O'Shaughnessy, T J AU - Stenger, DA AU - Zhang, L AU - Barker, J L AU - Maric, D AD - Naval Research Laboratory, Center for Bio/Molecular Science and Engineering, Code 6910, 4555 Overlook Avenue S.W., Washington, DC 20375, USA, wma@cbmse.nrl.navy.mil Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 61 EP - 68 VL - 23 IS - 1 SN - 0161-813X, 0161-813X KW - Calcium & Calcified Tissue Abstracts; CSA Neurosciences Abstracts; Toxicology Abstracts KW - X 24155:Biochemistry KW - N3 11101:General KW - T 20019:Cellular calcium, channels and currents UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18463598?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Neurotoxicology&rft.atitle=Toluene+Inhibits+Muscarinic+Receptor-Mediated+Cytosolic+Ca+super%282%2B%29+Responses+in+Neural+Precursor+Cells&rft.au=Ma%2C+W%3BShaffer%2C+K+M%3BPancrazio%2C+J+J%3BO%27Shaughnessy%2C+T+J%3BStenger%2C+DA%3BZhang%2C+L%3BBarker%2C+J+L%3BMaric%2C+D&rft.aulast=Ma&rft.aufirst=W&rft.date=2002-05-01&rft.volume=23&rft.issue=1&rft.spage=61&rft.isbn=&rft.btitle=&rft.title=Neurotoxicology&rft.issn=0161813X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - Searching for RNA genes using base-composition statistics AN - 18328584; 5379200 AB - The hypothesis that genomic regions rich in non-protein-coding RNAs (ncRNAs) can be identified using local variations in single-base and dinucleotide statistics has been investigated. (G+C)%, (G-C)% difference, (A-T)% difference and dinucleotide-frequency statistics were compared among seven classes of ncRNAs and three genomes. Significant variations were observed in (G+C)% and, in Methanococcus jannaschii, in the frequency of the dinucleotide `CG'. Screening programs based on these two base-composition statistics were developed. With (G+C)% screening alone, a 1% fraction of the M.jannaschii genome containing all 44 known transfer RNAs, ribosomal RNAs and signal recognition particle RNAs could be identified. When (G+C)% combined with CG dinucleotide-frequency screening was used, 43 of the 44 known M.jannaschii structural ncRNAs were again identified, while the number of presumably false hits overlapping a known or putative protein-coding gene was reduced from 15 to 6. In addition, 19 candidate ncRNAs were identified including one with significant homology to several known archaeal RNaseP RNAs. JF - Nucleic Acids Research AU - Schattner, P AD - Center for Biomolecular Science and Engineering, 227 Sinsheimer Laboratories, University of California, 1156 High Street, Santa Cruz, CA 95064, USA, schattner@cse.ucsc.edu Y1 - 2002/05/01/ PY - 2002 DA - 2002 May 01 SP - 2076 EP - 2082 VL - 30 IS - 9 SN - 0305-1048, 0305-1048 KW - ribonuclease P KW - signal recognition particle KW - Biochemistry Abstracts 2: Nucleic Acids; Microbiology Abstracts B: Bacteriology KW - tRNA KW - Statistical analysis KW - Methanococcus jannaschii KW - Base composition KW - rRNA KW - Genes KW - N 14510:Occurrence, isolation & assay KW - J 02726:RNA and ribosomes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18328584?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Nucleic+Acids+Research&rft.atitle=Searching+for+RNA+genes+using+base-composition+statistics&rft.au=Schattner%2C+P&rft.aulast=Schattner&rft.aufirst=P&rft.date=2002-05-01&rft.volume=30&rft.issue=9&rft.spage=2076&rft.isbn=&rft.btitle=&rft.title=Nucleic+Acids+Research&rft.issn=03051048&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Methanococcus jannaschii; Genes; Base composition; tRNA; rRNA; Statistical analysis ER - TY - JOUR T1 - Electron energy and electric field estimates in sprites derived from ionized and neutral N sub(2) emissions AN - 1531013521; 19638137 AB - During the EXL98 aircraft mission, sprites and blue jets were observed by narrow band cameras that measure the N sub(2) super(+) 1NG (0,1) band at 4278Aa and the N sub(2) 2PG (0,0) band at 3370Aa. We discuss the observations (1km resolution), instrumental and atmospheric corrections, and altitude profiles of ionized (1NG) and neutral (2PG) emission observed during a specific sprite. The ratio of ionized-to-neutral emission indicates a relative enhancement of ion emission below 55km. Characteristic electron energies (E sub(Ch)) and electric fields (E) are derived from these emission ratios using excitation rates computed from a model that solves the Boltzmann equation as a function of electric field. Up to 55km E follows the breakdown field (E sub(k)) and E sub(Ch) is 2.2eV. Above 55km E drops below E sub(k) and E sub(Ch) drops to 1.75eV near 60km. JF - Geophysical Research Letters AU - Morrill, J AU - Bucsela, E AU - Siefring, C AU - Heavner, M AU - Berg, S AU - Moudry, D AU - Slinker, S AU - Fernsler, R AU - Wescott, E AU - Sentman, D AU - Osborne, D AD - E. O Hulburt Center for Space Research, Naval Research Laboratory, Washington, DC, USA. Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 100 EP - 1-100-4 PB - American Geophysical Union, 2000 Florida Ave., N.W. Washington DC 20009 United States VL - 29 IS - 10 SN - 0094-8276, 0094-8276 KW - Solid State and Superconductivity Abstracts (SO); Environmental Engineering Abstracts (EN); CSA / ASCE Civil Engineering Abstracts (CE); Aerospace & High Technology Database (AH) KW - Sprites KW - Electron energy KW - Aircraft KW - Electric fields KW - Boltzmann equation KW - Geophysics KW - Emission KW - Mathematical analysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1531013521?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aenvironmentalengabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Geophysical+Research+Letters&rft.atitle=Electron+energy+and+electric+field+estimates+in+sprites+derived+from+ionized+and+neutral+N+sub%282%29+emissions&rft.au=Morrill%2C+J%3BBucsela%2C+E%3BSiefring%2C+C%3BHeavner%2C+M%3BBerg%2C+S%3BMoudry%2C+D%3BSlinker%2C+S%3BFernsler%2C+R%3BWescott%2C+E%3BSentman%2C+D%3BOsborne%2C+D&rft.aulast=Morrill&rft.aufirst=J&rft.date=2002-05-01&rft.volume=29&rft.issue=10&rft.spage=100&rft.isbn=&rft.btitle=&rft.title=Geophysical+Research+Letters&rft.issn=00948276&rft_id=info:doi/10.1029%2F2001GL014018 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2014-06-01 N1 - Last updated - 2017-01-05 DO - http://dx.doi.org/10.1029/2001GL014018 ER - TY - JOUR T1 - Potential hydrocarbon plays of the Gulf of Cadiz AN - 1282820524; 2013-012791 JF - Offshore Technology Conference AU - Lowrie, Allen AU - Somoza, Luis AU - Gardner, Joan M AU - Klekamp, Thomas L AU - Anonymous Y1 - 2002/05// PY - 2002 DA - May 2002 SP - 13 PB - Offshore Technology Conference, [Dallas, TX] VL - 34 KW - petroleum exploration KW - continental slope KW - Cretaceous KW - Spain KW - natural gas KW - source rocks KW - petroleum KW - Europe KW - Iberian Peninsula KW - Southern Europe KW - reservoir rocks KW - Cenozoic KW - sedimentary rocks KW - thermal maturity KW - mass movements KW - ocean floors KW - diapirs KW - chemically precipitated rocks KW - Quaternary KW - Upper Jurassic KW - Jurassic KW - shale KW - basement KW - evaporites KW - Miocene KW - Mesozoic KW - slumping KW - continental rise KW - Tertiary KW - plate tectonics KW - Neogene KW - Pliocene KW - Gulf of Cadiz KW - continental shelf KW - North Atlantic KW - clastic rocks KW - gravity flows KW - Atlantic Ocean KW - salt KW - 29A:Economic geology, geology of energy sources UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1282820524?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Offshore+Technology+Conference&rft.atitle=Potential+hydrocarbon+plays+of+the+Gulf+of+Cadiz&rft.au=Lowrie%2C+Allen%3BSomoza%2C+Luis%3BGardner%2C+Joan+M%3BKlekamp%2C+Thomas+L%3BAnonymous&rft.aulast=Lowrie&rft.aufirst=Allen&rft.date=2002-05-01&rft.volume=34&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Offshore+Technology+Conference&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Offshore technology conference N1 - Copyright - GeoRef, Copyright 2013, American Geosciences Institute. N1 - Date revised - 2013-01-01 N1 - Number of references - 11 N1 - PubXState - TX] N1 - Document feature - illus. incl. sects., geol. sketch map N1 - Last updated - 2013-02-05 N1 - CODEN - #07353 N1 - SubjectsTermNotLitGenreText - Atlantic Ocean; basement; Cenozoic; chemically precipitated rocks; clastic rocks; continental rise; continental shelf; continental slope; Cretaceous; diapirs; Europe; evaporites; gravity flows; Gulf of Cadiz; Iberian Peninsula; Jurassic; mass movements; Mesozoic; Miocene; natural gas; Neogene; North Atlantic; ocean floors; petroleum; petroleum exploration; plate tectonics; Pliocene; Quaternary; reservoir rocks; salt; sedimentary rocks; shale; slumping; source rocks; Southern Europe; Spain; Tertiary; thermal maturity; Upper Jurassic ER - TY - JOUR T1 - Two- and three-dimensional heterogeneity in carbonate sediments using resistivity imaging AN - 52110858; 2002-040537 AB - Volume heterogeneity was investigated in carbonate sediments using fine-scale electrical resistivity data, which are sensitive to porosity and to sediment macrostructure and microstructure. Variability in sediment density and porosity was assessed by X-radiographic and two-dimensional (2D) electrical resistivity measurements in 3-cm-thick slabs collected from the Dry Tortugas in the lower Florida Keys. A comparison of the 2D correlation lengths calculated from each assessment indicates that, using methods that differ in resolution, these two methods measure quite different horizontal and vertical fluctuations in sediment density and porosity. Other electrical resistivity experiments were conducted using a 2D network of resistivity electrodes on the surface of freshly collected box cores. The resulting three-dimensional (3D) resistivity data provide a unique insight into the spatial variability of sediment porosity and structure at the cm scale. Complementary X-radiograph cores provide 2D datasets of resistivity and porosity at higher resolution. These data are used to establish the porosity-resistivity-microstructure relationships for these carbonate sediments, with microstructure being described in terms of tortuosity. These relationships are used to extend our interpretation in terms of porosity and tortuosity to the corresponding 3D box core resistivity datasets. Sediment tortuosity is investigated by numerically modeling the flow of electrical currents through a range of pore morphologies in three dimensions. The results show particular sensitivity to the intra-particle porosity, particle shape and the relative sizes of pores and throats. The 3D methodology shows promise as a non-invasive measurement of buried inhomogeneities that could lead to improving models for predicting acoustic backscattering from the sediment volume. Abstract Copyright (2002) Elsevier, B.V. JF - Marine Geology AU - Jackson, Peter D AU - Briggs, Kevin B AU - Flint, Robert C AU - Holyer, R J AU - Sandidge, J C Y1 - 2002/04/10/ PY - 2002 DA - 2002 Apr 10 SP - 55 EP - 76 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - United States KW - Dry Tortugas KW - imagery KW - microstructure KW - Monroe County Florida KW - Florida KW - Gulf of Mexico KW - cores KW - marine sediments KW - sediments KW - heterogeneity KW - carbonate sediments KW - Florida Keys KW - numerical models KW - three-dimensional models KW - textures KW - grain size KW - correlation KW - resistivity KW - TEM data KW - porosity KW - two-dimensional models KW - North Atlantic KW - Atlantic Ocean KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52110858?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Two-+and+three-dimensional+heterogeneity+in+carbonate+sediments+using+resistivity+imaging&rft.au=Jackson%2C+Peter+D%3BBriggs%2C+Kevin+B%3BFlint%2C+Robert+C%3BHolyer%2C+R+J%3BSandidge%2C+J+C&rft.aulast=Jackson&rft.aufirst=Peter&rft.date=2002-04-10&rft.volume=182&rft.issue=1-2&rft.spage=55&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 36 N1 - Document feature - illus. incl. 2 tables, sketch map N1 - Last updated - 2014-03-14 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - Atlantic Ocean; carbonate sediments; cores; correlation; Dry Tortugas; Florida; Florida Keys; grain size; Gulf of Mexico; heterogeneity; imagery; marine sediments; microstructure; Monroe County Florida; North Atlantic; numerical models; porosity; resistivity; sediments; TEM data; textures; three-dimensional models; two-dimensional models; United States ER - TY - JOUR T1 - Numerical simulation of the microstructure and compression behavior of Eckernfoerde Bay sediments AN - 51359368; 2002-040535 AB - Transmission electron microscope (TEM) studies conducted on sediments recovered using diver-collected cores and gravity cores from Eckernforde Bay in the Baltic Sea, Germany, reveal that the sediments consist of silt- to clay-sized sediment, both free and bound into fecal pellets, organic matter, biogenic materials, methane gas and microorganisms. The microstructure of the upper 2 m of the sediment is complex, with the clay particles arranged in a very open structure with variable inter- and intra-domain pore space. In an effort to understand the relationship between microscopic variables (e.g., microfabric) and macroscopic geotechnical properties (e.g., compressibility), a numerical study was performed using the discrete element method. The objective of this study was to develop an understanding of the micro- to macro-linkage of mechanical properties. Specifically, one-dimensional compression behavior of the sediment was numerically simulated and compared with experimental data. Compositional parameters of the sediment were obtained from specific tests conducted at the Naval Research Laboratory and from tests conducted by other researchers participating in the project. Image analysis was used to quantify the microfabric parameters from TEM images of the sediment. The effect of organic matter was simulated by introducing inter-particle contact cementation. Results indicate that inter-particle bonding due to inter-particle cementation and/or the van der Waals attractive force (1) contributes to the apparent overconsolidation observed in the laboratory and (2) holds the highly porous, unstable microstructure together until a threshold stress level is reached. Change in void ratio during compression is due to inter-, rather than intra-domain movement. Abstract Copyright (2002) Elsevier, B.V. JF - Marine Geology AU - Anandarajah, A AU - Lavoie, Dawn L Y1 - 2002/04/10/ PY - 2002 DA - 2002 Apr 10 SP - 3 EP - 27 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - silicates KW - behavior KW - microstructure KW - Europe KW - simulation KW - cores KW - marine sediments KW - mineral composition KW - Central Europe KW - sediments KW - ocean floors KW - compression KW - Baltic Sea KW - compressibility KW - numerical models KW - textures KW - grain size KW - statistical analysis KW - TEM data KW - porosity KW - clay minerals KW - organic compounds KW - Eckernforde Bay KW - sheet silicates KW - North Atlantic KW - Germany KW - image analysis KW - consolidation KW - Atlantic Ocean KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51359368?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Numerical+simulation+of+the+microstructure+and+compression+behavior+of+Eckernfoerde+Bay+sediments&rft.au=Anandarajah%2C+A%3BLavoie%2C+Dawn+L&rft.aulast=Anandarajah&rft.aufirst=A&rft.date=2002-04-10&rft.volume=182&rft.issue=1-2&rft.spage=3&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 31 N1 - Document feature - illus. incl. 1 table N1 - SuppNotes - Includes appendix N1 - Last updated - 2014-03-14 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - Atlantic Ocean; Baltic Sea; behavior; Central Europe; clay minerals; compressibility; compression; consolidation; cores; Eckernforde Bay; Europe; Germany; grain size; image analysis; marine sediments; microstructure; mineral composition; North Atlantic; numerical models; ocean floors; organic compounds; porosity; sediments; sheet silicates; silicates; simulation; statistical analysis; TEM data; textures ER - TY - JOUR T1 - The utilization of risk assessments in tactical command decisions. AN - 71677328; 12013539 AB - Traditional risk assessments (as delineated by regulatory agencies) use health outcome endpoints of interest to society as a whole, and are based on broad assumptions about the demographics of the potentially exposed populations and the routes of exposure. Immediacy of impact is not normally a major consideration. In tactical situations, the commander must balance considerations of short-term health effects against mission accomplishment. Often the commander will decide to accept a risk that would not be considered under other circumstances. The traditional tools of human-health and environmental risk assessment may be used, but the risk levels and projected consequences must be adapted to the tactical scenario (i.e. the performance decrement associated with a short-term exposure tactical operation vs. the long-term health out-come for an exposed population under 'normal conditions'). Risk assessors and health professionals must learn to articulate risk in terms that the tactical commander can place in his operational risk management (ORM) process. The process may require that the commander weigh non-health related mission critical considerations against health outcome issues. This presentation is intended to begin a dialogue that will lead to a harmonization of the use of risk assessment tools and their application in ORM as seen by tactical commanders, and a clarification of the strengths and limits of their utility in such applications. JF - The Science of the total environment AU - Jederberg, Warren W AU - Still, Kenneth R AU - Briggs, G Bruce AD - OPNAV, Navy Pentagon, Washington, DC, USA. Y1 - 2002/04/08/ PY - 2002 DA - 2002 Apr 08 SP - 119 EP - 129 VL - 288 IS - 1-2 SN - 0048-9697, 0048-9697 KW - Hazardous Substances KW - 0 KW - Index Medicus KW - Environment KW - Endpoint Determination KW - Humans KW - Communication KW - Chemical Industry KW - Risk Assessment KW - Hazardous Substances -- adverse effects KW - Nuclear Warfare KW - Disaster Planning KW - Decision Making UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71677328?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Science+of+the+total+environment&rft.atitle=The+utilization+of+risk+assessments+in+tactical+command+decisions.&rft.au=Jederberg%2C+Warren+W%3BStill%2C+Kenneth+R%3BBriggs%2C+G+Bruce&rft.aulast=Jederberg&rft.aufirst=Warren&rft.date=2002-04-08&rft.volume=288&rft.issue=1-2&rft.spage=119&rft.isbn=&rft.btitle=&rft.title=The+Science+of+the+total+environment&rft.issn=00489697&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-10-23 N1 - Date created - 2002-05-15 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Acoustic and dynamic mechanical properties of a polyurethane rubber. AN - 85369079; pmid-12002862 AB - Acoustical and dynamic mechanical measurements were carried out on a commercial polyurethane rubber, DeSoto PR1547. The sound speed and attenuation were measured over the range from 12.5 to 75 kHz and 3.9 to 33.6 degrees C. Shear modulus was measured from 10(-4) to 2 Hz and -36 to 34 degrees C. The peak heights of the shear loss tangent varied with temperature, demonstrating thermorheological complexity. At higher temperatures, time-temperature superpositioning could be applied, with the shift factors following the Williams-Landel-Ferry equation. From the combined acoustical and mechanical measurements, values for the dynamic bulk modulus were determined. Moreover, superposition of the bulk modulus data was achieved using the shift factors determined from the dynamic mechanical shear measurements. Finally, this work illustrates the capability and the working rules of acoustical measurements in a small tank. JF - The Journal of the Acoustical Society of America AU - Mott, Peter H AU - Roland, C Michael AU - Corsaro, Robert D AD - Chemistry Division, Naval Research Laboratory, Washington, DC 20375-5320, USA. phm@xbt.nrl.navy.mil Y1 - 2002/04// PY - 2002 DA - Apr 2002 SP - 1782 EP - 1790 VL - 111 IS - 4 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85369079?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Acoustic+and+dynamic+mechanical+properties+of+a+polyurethane+rubber.&rft.au=Mott%2C+Peter+H%3BRoland%2C+C+Michael%3BCorsaro%2C+Robert+D&rft.aulast=Mott&rft.aufirst=Peter&rft.date=2002-02-01&rft.volume=111&rft.issue=2&rft.spage=729&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Introductory evaluation of an oral, killed whole cell enterotoxigenic Escherichia coli plus cholera toxin B subunit vaccine in Egyptian infants. AN - 71844414; 12075764 AB - We conducted the first trial to assess the safety and immunogenicity of an oral, killed enterotoxigenic Escherichia coli plus cholera toxin B-subunit vaccine in children <2 years old. Three doses of vaccine or killed E. coli K-12 control were given at 2-week intervals to 64 Egyptian infants, 6 to 18 months old, in a randomized, double blind manner. Adverse events were monitored for 3 days after each dose. Blood was collected before immunization and 7 to 10 days after each dose to assess vaccine-specific serologic responses. There was no statistically significant intergroup difference in the percentage of subjects reporting the primary safety endpoint (diarrhea or vomiting) after the first (31%, vaccine; 30%, control) or third (14%, vaccine; 18%, control) dose, whereas there was a trend toward greater reporting in the vaccine group after Dose 2 (36%, vaccine; 18%, control; P = 0.052). The percentage of children showing IgA seroconversion after any dose was higher in the vaccine than the control group for recombinant cholera toxin B-subunit (97% vs. 46%), colonization factor antigen I (61% vs. 18%) and coli surface antigen 4 (39% vs. 4%) (P < 0.001 for each comparison). IgG seroconversion rates in the vaccine and control groups were 97 and 21% to recombinant cholera toxin B-subunit (P < 0.001), 64 and 29% for colonization factor antigen I (P < 0.01), 53 and 21% for coli surface antigen 2 (P < 0.05) and 58 and 4% for coli surface antigen 4 (P < 0.001), respectively. The third vaccine dose was followed by augmented IgG antitoxin titers. The oral enterotoxigenic E. coli vaccine was safe and immunogenic in this setting in Egyptian infants. JF - The Pediatric infectious disease journal AU - Savarino, Stephen J AU - Hall, Eric R AU - Bassily, Samir AU - Wierzba, Thomas F AU - Youssef, Fouad G AU - Peruski, Leonard F AU - Abu-Elyazeed, Remon AU - Rao, Malla AU - Francis, Wagdy M AU - El Mohamady, Hanan AU - Safwat, Mohammed AU - Naficy, Abdollah B AU - Svennerholm, Ann-Mari AU - Jertborn, Marianne AU - Lee, Young J AU - Clemens, John D AU - Pride Study Group AD - US Naval Medical Research Unit Number 3, Cairo, Egypt. savarinos@nmrc.navy.mil ; Pride Study Group Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 322 EP - 330 VL - 21 IS - 4 SN - 0891-3668, 0891-3668 KW - Adjuvants, Immunologic KW - 0 KW - Escherichia coli Vaccines KW - Immunoglobulin A KW - Cholera Toxin KW - 9012-63-9 KW - Index Medicus KW - Infant KW - Egypt KW - Administration, Oral KW - Double-Blind Method KW - Diarrhea -- immunology KW - Dose-Response Relationship, Drug KW - Humans KW - Immunoglobulin A -- analysis KW - Antibody Formation KW - Male KW - Female KW - Diarrhea -- prevention & control KW - Escherichia coli Vaccines -- adverse effects KW - Escherichia coli Vaccines -- immunology KW - Escherichia coli Infections -- immunology KW - Adjuvants, Immunologic -- administration & dosage KW - Cholera Toxin -- immunology KW - Cholera Toxin -- administration & dosage KW - Escherichia coli Vaccines -- administration & dosage KW - Escherichia coli Infections -- prevention & control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71844414?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Pediatric+infectious+disease+journal&rft.atitle=Introductory+evaluation+of+an+oral%2C+killed+whole+cell+enterotoxigenic+Escherichia+coli+plus+cholera+toxin+B+subunit+vaccine+in+Egyptian+infants.&rft.au=Johnstone%2C+Peter+A+S%3BNiemtzow%2C+Richard+C%3BRiffenburgh%2C+Robert+H&rft.aulast=Johnstone&rft.aufirst=Peter+A&rft.date=2002-02-15&rft.volume=94&rft.issue=4&rft.spage=1151&rft.isbn=&rft.btitle=&rft.title=Cancer&rft.issn=0008543X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-10-16 N1 - Date created - 2002-06-21 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Watching the Watchers: The Nature and Content of Campaign Ad Watches AN - 60605086; 200213160 AB - Since David Broder issued a challenge to journalists after the 1988 presidential campaign to move from being "color commentators" to "referees," political campaign ad watches have proliferated. This article uses originally coded data to empirically document the growth, increasing diversity, & content of all original print ad watches from the 1992, 1996, & 2000 election cycles. Testing a series of standard political communication hypotheses, the analysis indicates that while ad watches have increased in frequency, source, & target, they have been molded more to emphasize the strategic aspect of advertising than to evaluate the veracity of content. Systematic bias emerges in the form of local sources' being easier on local incumbents, a penchant for carrying out ad watches on negative ads, & treating Democratic ads more favorably than Republican. 11 Figures, 23 References. [Copyright 2002 Sage Publications, Inc.] JF - Harvard International Journal of Press/Politics AU - Frantzich, Stephen AD - Dept Political Science, US Naval Academy, Annapolis, MD frantzic@usna.edu Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 34 EP - 57 VL - 7 IS - 2 SN - 1081-180X, 1081-180X KW - Political Campaigns KW - Elections KW - Journalists KW - Advertising KW - Bias KW - article KW - 9181: politics and communication; politics and communication UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60605086?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Harvard+International+Journal+of+Press%2FPolitics&rft.atitle=Watching+the+Watchers%3A+The+Nature+and+Content+of+Campaign+Ad+Watches&rft.au=Frantzich%2C+Stephen&rft.aulast=Frantzich&rft.aufirst=Stephen&rft.date=2002-04-01&rft.volume=7&rft.issue=2&rft.spage=34&rft.isbn=&rft.btitle=&rft.title=Harvard+International+Journal+of+Press%2FPolitics&rft.issn=1081180X&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Number of references - 23 N1 - Last updated - 2016-09-28 N1 - SubjectsTermNotLitGenreText - Journalists; Political Campaigns; Advertising; Elections; Bias ER - TY - JOUR T1 - Variability in the acoustic response of shallow-water marine sediments determined by normal-incident 30-kHz and 50-kHz sound AN - 52111362; 2002-040543 AB - To quantify the variability in the acoustic response of typical shallow-water marine sediments, a series of high-frequency (30 and 50 kHz), normal-incident measurements were made at six sites within the Ship Island Test Bed off Gulfport, MS, USA. These measurements were made using the Naval Research Laboratory's (NRL) Acoustic Seafloor Classification System (ASCS) in sediments ranging from silty clay to medium sand, and with sediment structures ranging from layered, to unlayered, and methane gas-charged. A broadband, narrow-beamwidth transducer was mounted on a remotely movable trolley suspended from a horizontal I-beam connected to a pair of legs at each end of the beam. This "swingset" was lowered to the seafloor with the transducer mounted at normal incidence and at an altitude of 3.0 m above the sediment surface. Measurements were made at both 30 and 50 kHz at each of up to eight positions 0.3 m apart along the beam. A coefficient of variation was calculated for each horizontally corresponding sample of the 16-bit, 125-kHz sample rate A/D at each of the positions along the transect. Variability was determined at approximately 6-mm depth intervals in the sediment to the limit of significant signal return. These measurements indicate that the greatest variability in acoustic response occurs in the upper 0.5 m of the sediment column with muds ranging from 18 to 31%, whereas sands ranged from 23 to 26%. Acoustic response variability was found to decrease with increased depth for both muds and sands. Below 1.0 m, the sediment depth limit of bioturbation variability, decreases to 6-13% for muds and to 18% for sands. Methane gas-charged sediment located approximately 3.0 m below the sediment-water interface produced a variability of 20%. For all sediment types, the 50-kHz acoustic response was consistently more variable than the 30-kHz acoustic response. JF - Marine Geology AU - Lambert, Douglas N AU - Kalcic, Maria T AU - Faas, Richard W A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 179 EP - 208 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - United States KW - shallow-water environment KW - sediment-water interface KW - geophysical surveys KW - acoustical properties KW - textures KW - grain size KW - Mississippi KW - marine geology KW - geophysical methods KW - Ship Island KW - Harrison County Mississippi KW - Gulf of Mexico KW - variations KW - acoustical methods KW - marine sediments KW - classification KW - sediments KW - Gulfport Mississippi KW - surveys KW - North Atlantic KW - sedimentary structures KW - Atlantic Ocean KW - 20:Applied geophysics KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52111362?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Variability+in+the+acoustic+response+of+shallow-water+marine+sediments+determined+by+normal-incident+30-kHz+and+50-kHz+sound&rft.au=Lambert%2C+Douglas+N%3BKalcic%2C+Maria+T%3BFaas%2C+Richard+W&rft.aulast=Lambert&rft.aufirst=Douglas&rft.date=2002-04-01&rft.volume=182&rft.issue=1-2&rft.spage=179&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 18 N1 - Document feature - illus. incl. 2 tables N1 - SuppNotes - Includes appendix N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical methods; acoustical properties; Atlantic Ocean; classification; geophysical methods; geophysical surveys; grain size; Gulf of Mexico; Gulfport Mississippi; Harrison County Mississippi; marine geology; marine sediments; Mississippi; North Atlantic; sediment-water interface; sedimentary structures; sediments; shallow-water environment; Ship Island; surveys; textures; United States; variations ER - TY - JOUR T1 - Geo-acoustic characterization of calcareous seabed in the Florida Keys AN - 52111330; 2002-040538 AB - Geotechnical and acoustic measurements on a set of 35 gravity cores and 11 box cores from two calcareous seabed locations in the lower Florida Keys that are characterized by contrasting environmental settings show significant differences in terms of vertical profiles of physical, acoustic, and geotechnical properties. The lower energy study site of the two is sheltered by the adjacent Dry Tortugas platform complex and reveals a higher porosity surface interval with significant changes in water content, density, and compressional wave velocity within the upper 25 cm. Sediment cores from open-water locations, such as those collected in the study area north of the Marquesas Keys, exhibit higher, less variable densities and lower velocities within the top 25 cm. This is attributed to consolidation associated with cyclic pressure variations from surface swells and strong tidal currents. Acoustic subbottom profiles display good correlation with shell-lag deposits observed in the gravity cores, although acoustic records lack the vertical resolution to detect variations in physical and acoustic properties on the order of those measured in this study. Calculated impedances at depths below 25 cm are significantly higher in the Dry Tortugas area and hence penetration of 4- and 15-kHz acoustic signals is less than at the Marquesas study site. From a geotechnical point of view, the sediments at both sites can be considered to behave like granular materials with little or no plasticity, no significant cementation, low compressibility, permeability highly dependent on void ratio, and moderate to high friction angles. A comparison with deep-sea sediments of mixed mineralogy shows that the effect of increasing calcium carbonate with decreasing clay content is to decrease plasticity and compressibility, and to increase friction angles. In other words, sediments shift from a cohesive to a granular nature as the carbonate content increases. JF - Marine Geology AU - Brandes, Horst G AU - Silva, Armand J AU - Walter, Donald J A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 77 EP - 102 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - United States KW - Dry Tortugas KW - shear strength KW - engineering properties KW - characterization KW - Monroe County Florida KW - Florida KW - Gulf of Mexico KW - cores KW - variations KW - marine sediments KW - French Polynesia KW - sediments KW - calcium carbonate KW - ocean circulation KW - Florida Keys KW - acoustical properties KW - mechanical properties KW - Marquesas Islands KW - tides KW - calcareous composition KW - physical properties KW - Oceania KW - Polynesia KW - North Atlantic KW - carbonates KW - permeability KW - Atlantic Ocean KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52111330?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Geo-acoustic+characterization+of+calcareous+seabed+in+the+Florida+Keys&rft.au=Brandes%2C+Horst+G%3BSilva%2C+Armand+J%3BWalter%2C+Donald+J&rft.aulast=Brandes&rft.aufirst=Horst&rft.date=2002-04-01&rft.volume=182&rft.issue=1-2&rft.spage=77&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 48 N1 - Document feature - illus. incl. sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical properties; Atlantic Ocean; calcareous composition; calcium carbonate; carbonates; characterization; cores; Dry Tortugas; engineering properties; Florida; Florida Keys; French Polynesia; Gulf of Mexico; marine sediments; Marquesas Islands; mechanical properties; Monroe County Florida; North Atlantic; ocean circulation; Oceania; permeability; physical properties; Polynesia; sediments; shear strength; tides; United States; variations ER - TY - JOUR T1 - In situ acoustic and laboratory ultrasonic sound speed and attenuation measured in heterogeneous soft seabed sediments; Eel River shelf, California AN - 52110187; 2002-040539 AB - We compared in situ and laboratory velocity and attenuation values measured in seafloor sediments from the shallow water delta of the Eel River, California. This region receives a substantial volume of fluvial sediment that is discharged annually onto the shelf. Additionally, a high input of fluvial sediments during storms generates flood deposits that are characterized by thin beds of variable grain-sizes between the 40- and 90-m isobaths. The main objectives of this study were (1) to investigate signatures of seafloor processes on geoacoustic and physical properties, and (2) to evaluate differences between geoacoustic parameters measured in situ at acoustic (7.5 kHz) and in the laboratory at ultrasonic (400 kHz) frequencies. The in situ acoustic measurements were conducted between 60 and 100 m of water depth. Wet-bulk density and porosity profiles were obtained to 1.15 m below seafloor (m bsf) using gravity cores of the mostly cohesive fine-grained sediments across- and along-shelf. Physical and geoacoustic properties from six selected sites obtained on the Eel margin revealed the following. (1) Sound speed and wet-bulk density strongly correlated in most cases. (2) Sediment compaction with depth generally led to increased sound speed and density, while porosity and in situ attenuation values decreased. (3) Sound speed was higher in coarser- than in finer-grained sediments, on a maximum average by 80 m s (super -1) . (4) In coarse-grained sediments sound speed was higher in the laboratory (1560 m s (super -1) ) than in situ (1520 m s (super -1) ). In contrast, average ultrasonic and in situ sound speed in fine-grained sediments showed only little differences (both approximately 1480 m s (super -1) ). (5) Greater attenuation was commonly measured in the laboratory (0.4 and 0.8 dB m (super -1) kHz (super -1) ) than in situ (0.02 and 0.65 dB m (super -1) kHz (super -1) ), and remained almost constant below 0.4 m bsf. We attributed discrepancies between laboratory ultrasonic and in situ acoustic measurements to a frequency dependence of velocity and attenuation. In addition, laboratory attenuation was most likely enhanced due to scattering of sound waves at heterogeneities that were on the scale of ultrasonic wavelengths. In contrast, high in situ attenuation values were linked to stratigraphic scattering at thin-bed layers that form along with flood deposits. JF - Marine Geology AU - Gorgas, Thomas J AU - Wilkens, Roy H AU - Fu, Shung S AU - Frazer, L Neil AU - Richardson, Mike D AU - Briggs, Kevin B AU - Lee, Homa J A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 103 EP - 119 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - United States KW - dispersivity KW - Northeast Pacific KW - density KW - stream sediments KW - California KW - laboratory studies KW - attenuation KW - acoustical methods KW - marine sediments KW - sediments KW - velocity KW - discharge KW - Eel River basin KW - East Pacific KW - experimental studies KW - in situ KW - acoustical properties KW - grain size KW - geophysical methods KW - ultrasonic methods KW - porosity KW - measurement KW - physical properties KW - heterogeneous materials KW - North Pacific KW - Humboldt County California KW - Pacific Ocean KW - continental shelf KW - fluvial environment KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52110187?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=In+situ+acoustic+and+laboratory+ultrasonic+sound+speed+and+attenuation+measured+in+heterogeneous+soft+seabed+sediments%3B+Eel+River+shelf%2C+California&rft.au=Gorgas%2C+Thomas+J%3BWilkens%2C+Roy+H%3BFu%2C+Shung+S%3BFrazer%2C+L+Neil%3BRichardson%2C+Mike+D%3BBriggs%2C+Kevin+B%3BLee%2C+Homa+J&rft.aulast=Gorgas&rft.aufirst=Thomas&rft.date=2002-04-01&rft.volume=182&rft.issue=1-2&rft.spage=103&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 56 N1 - Document feature - illus. incl. sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical methods; acoustical properties; attenuation; California; continental shelf; density; discharge; dispersivity; East Pacific; Eel River basin; experimental studies; fluvial environment; geophysical methods; grain size; heterogeneous materials; Humboldt County California; in situ; laboratory studies; marine sediments; measurement; North Pacific; Northeast Pacific; Pacific Ocean; physical properties; porosity; sediments; stream sediments; ultrasonic methods; United States; velocity ER - TY - JOUR T1 - The effects of sediment structure on geoacoustic properties AN - 52109568; 2002-040534 JF - Marine Geology A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 223 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - models KW - marine sediments KW - acoustical properties KW - sediments KW - ocean floors KW - variations KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52109568?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/GeoRef&rft_val_fmt=info:ofi/fmt:kev:mtx:book&rft.genre=book&rft.jtitle=&rft.atitle=&rft.au=&rft.aulast=&rft.aufirst=Warren&rft.date=2002-03-01&rft.volume=2002&rft.issue=&rft.spage=192&rft.isbn=&rft.btitle=&rft.title=Annual+Meeting+Expanded+Abstracts+-+American+Association+of+Petroleum+Geologists&rft.issn=00940038&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Document feature - illus. N1 - SuppNotes - Individual papers are cited separately N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical properties; marine sediments; models; ocean floors; sediments; variations ER - TY - JOUR T1 - Fine-scale sedimentary structure; implications for acoustic remote sensing AN - 52108331; 2002-040541 AB - Detailed measurements of sediment properties and acoustic scattering were made at a carbonate sand-silt-clay site off Dry Tortugas in the Florida Keys. The sediment is characterized by varying scales of biologically controlled random roughness and heterogeneity as well as surficial stratification on centimeter scales. The interface roughness was determined from stereo photogrammetric digitization and parameterized by a power spectrum, whereas sediment volume heterogeneity was determined from core measurements and parameterized by first-order autoregressive models for sound speed and density fluctuations. In contrast to previous investigations, fine-scale sediment bulk density fluctuations were examined in sediment cores with computerized tomography in addition to the standard gravimetric technique. Furthermore, the strongly delineated sediment density and sound velocity transition layer was parameterized by piecewise linear fits. These characterizations of the random and deterministic properties were used in acoustic scattering models in an effort to determine the feasibility of remotely measuring fine-scale features of the seafloor. The result was negative: older, low-resolution models gave moderately good fits to the acoustic data, but the fit did not improve for newer, higher-resolution models. It is suggested that scattering due to shell fragments must be included to account for all features observed in the scattering data at this site. JF - Marine Geology AU - Briggs, Kevin B AU - Williams, Kevin L AU - Jackson, D R AU - Jones, C D AU - Ivakin, A N AU - Orsi, Thomas H A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 141 EP - 159 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - United States KW - Dry Tortugas KW - density KW - data processing KW - characterization KW - Monroe County Florida KW - Florida KW - Gulf of Mexico KW - acoustical methods KW - marine sediments KW - sediments KW - sedimentary structures KW - Florida Keys KW - X-ray radiography KW - acoustical properties KW - biogenic structures KW - statistical analysis KW - sedimentation KW - geophysical methods KW - photogrammetry KW - radiography KW - ultrastructure KW - X-ray data KW - North Atlantic KW - computed tomography data KW - bioturbation KW - Atlantic Ocean KW - remote sensing KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52108331?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Fine-scale+sedimentary+structure%3B+implications+for+acoustic+remote+sensing&rft.au=Briggs%2C+Kevin+B%3BWilliams%2C+Kevin+L%3BJackson%2C+D+R%3BJones%2C+C+D%3BIvakin%2C+A+N%3BOrsi%2C+Thomas+H&rft.aulast=Briggs&rft.aufirst=Kevin&rft.date=2002-04-01&rft.volume=182&rft.issue=1-2&rft.spage=141&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 50 N1 - Document feature - illus. incl. 2 tables N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical methods; acoustical properties; Atlantic Ocean; biogenic structures; bioturbation; characterization; computed tomography data; data processing; density; Dry Tortugas; Florida; Florida Keys; geophysical methods; Gulf of Mexico; marine sediments; Monroe County Florida; North Atlantic; photogrammetry; radiography; remote sensing; sedimentary structures; sedimentation; sediments; statistical analysis; ultrastructure; United States; X-ray data; X-ray radiography ER - TY - JOUR T1 - Surficial seabed sediment properties derived from seismic profiler responses AN - 52107715; 2002-040544 AB - As a result of the complex and variable nature of sea floor sedimentary environments and the problems associated with obtaining representative samples of sea floor materials, it has long been accepted that geophysical methods hold the greatest potential for rapid assessment of sea floor sediment physical property variability. This paper presents results of two experimental geophysical studies aimed at developing in situ sea floor sediment classification methodologies applicable to siliciclastic environments. At one of the two study sites, Irvine Bay in the Clyde Sea, an area of approximately 10 km (super 2) was intensively surveyed using a boomer seismic profiler and digital data acquisition system. Three core samples recovered in the area were used to calibrate seabed reflection responses at spot locations, and once calibrated, the entire geophysical dataset was inverted to produce maps showing the spatial distribution of sediment physical properties (porosity, density and grain size distribution) at the seabed surface. Very good agreement was found between seismic predictions of sediment properties and physical measurements made on independent core and grab samples. Similar levels of agreement were found for seismo-acoustic predictions made after surveying a transect in the Southern Baltic Sea. On the basis of these experimental studies it appears that, with only limited ground truth information, it is possible to invert high-resolution seismic reflection data to produce quantitative information on the spatial distribution of sea floor sediment physical properties. JF - Marine Geology AU - Davis, Angela AU - Haynes, Ronald AU - Bennell, Jim AU - Huws, Dei A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 209 EP - 223 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - geophysical surveys KW - density KW - siliciclastics KW - Europe KW - Great Britain KW - cores KW - variations KW - size distribution KW - marine sediments KW - Irvine Bay KW - sediments KW - high-resolution methods KW - seismic profiles KW - Western Europe KW - acoustical properties KW - grain size KW - geophysical methods KW - reflection methods KW - United Kingdom KW - porosity KW - seismic methods KW - Scotland KW - Firth of Clyde KW - physical properties KW - surveys KW - geophysical profiles KW - 20:Applied geophysics KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52107715?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Surficial+seabed+sediment+properties+derived+from+seismic+profiler+responses&rft.au=Davis%2C+Angela%3BHaynes%2C+Ronald%3BBennell%2C+Jim%3BHuws%2C+Dei&rft.aulast=Davis&rft.aufirst=Angela&rft.date=2002-04-01&rft.volume=182&rft.issue=1-2&rft.spage=209&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 14 N1 - Document feature - illus. incl. sects., sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical properties; cores; density; Europe; Firth of Clyde; geophysical methods; geophysical profiles; geophysical surveys; grain size; Great Britain; high-resolution methods; Irvine Bay; marine sediments; physical properties; porosity; reflection methods; Scotland; sediments; seismic methods; seismic profiles; siliciclastics; size distribution; surveys; United Kingdom; variations; Western Europe ER - TY - JOUR T1 - Dust vertical distribution in the Caribbean during the Puerto Rico dust experiment AN - 51970720; 2003-050379 JF - Geophysical Research Letters AU - Reid, Jeffrey S AU - Westphal, Douglas L AU - Livingston, John M AU - Savoie, Dennis L AU - Maring, Hal B AU - Jonsson, Haflidi H AU - Eleuterio, Daniel P AU - Kinney, James E AU - Reid, Elizabeth A Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 4 PB - American Geophysical Union, Washington, DC VL - 29 IS - 7 SN - 0094-8276, 0094-8276 KW - Puerto Rico Dust Experiment KW - PRIDE KW - photometery KW - clastic sediments KW - environmental analysis KW - distribution KW - spatial distribution KW - dust KW - sediments KW - Africa KW - Sahara KW - wind transport KW - airborne methods KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51970720?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Geophysical+Research+Letters&rft.atitle=Dust+vertical+distribution+in+the+Caribbean+during+the+Puerto+Rico+dust+experiment&rft.au=Reid%2C+Jeffrey+S%3BWestphal%2C+Douglas+L%3BLivingston%2C+John+M%3BSavoie%2C+Dennis+L%3BMaring%2C+Hal+B%3BJonsson%2C+Haflidi+H%3BEleuterio%2C+Daniel+P%3BKinney%2C+James+E%3BReid%2C+Elizabeth+A&rft.aulast=Reid&rft.aufirst=Jeffrey&rft.date=2002-04-01&rft.volume=29&rft.issue=7&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Health+Care+Analysis&rft.issn=10653058&rft_id=info:doi/10.1023%2FA%3A1015622531388 L2 - http://www.agu.org/journals/gl/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 10 N1 - PubXState - DC N1 - Document feature - illus. incl. 1 table N1 - Last updated - 2012-06-07 N1 - CODEN - GPRLAJ N1 - SubjectsTermNotLitGenreText - Africa; airborne methods; clastic sediments; distribution; dust; environmental analysis; photometery; PRIDE; Puerto Rico Dust Experiment; Sahara; sediments; spatial distribution; wind transport DO - http://dx.doi.org/10.1029/2001GL014092 ER - TY - JOUR T1 - Diagenetic relationships of methanogenesis, nutrients, acoustic turbidity, pockmarks and freshwater seepages in Eckernfoerde Bay AN - 51362008; 2002-040536 AB - High organic loading (4-5 wt%) and sedimentation rates (1.4 mm yr (super -1) ) in Eckernforde Bay sediments lead to anaerobic conditions within the uppermost 15 cm. Intense bacterial sulphate reduction (0.011-0.15 mM SO (sub 4 red) (super 2-) yr (super -1) ) exhausts dissolved sulphate around 150 cm sediment depth, resulting in methanogenesis at greater sediment depth by carbonate reduction (1.8-8.5 mu M CH (sub 4) yr (super -1) ). Extensive regions of Eckernforde Bay are characterized by acoustically turbid sediments (>300 cm sediment depth), resulting from deeper sediments supersaturated in methane, forming free gas accumulation zones. Methane migrating upward into the sulphate reduction zone is effectively consumed by sulphate reducing bacteria at rates 3-10 times greater than methanogenesis, i.e. 46-95 mu M CH (sub 4 ox) yr (super -1) . The pathways of methane formation and anaerobic oxidation are confirmed by stable carbon and hydrogen isotope evidence. Pockmarks, i.e. shallow surface depressions in some Eckernforde Bay sediments, are not associated with gas ebullition; rather, these physical features result from the expulsion of freshwater. These episodic springs or seepages of groundwater from the underlying, Holocene glacial lags and sands into the basin at pockmark sites have characteristic low chloride and methane concentrations. The geochemical evidence indicates that the commercial accumulation of petroleum in the lower Cretaceous, Dogger-Beta-Hauptsandstein Schwedeneck field in Eckernforde Bay (1500 mbsf) has no surface manifestation and does not influence either the occurrence of acoustic turbidity or pockmarks. JF - Marine Geology AU - Whiticar, Michael J A2 - Briggs, Kevin B. A2 - Williams, Kevin L. A2 - Lavoie, Dawn L. Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 29 EP - 53 PB - Elsevier, Amsterdam VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - resources KW - isotopes KW - natural gas KW - halogens KW - aliphatic hydrocarbons KW - petroleum KW - Europe KW - stable isotopes KW - cores KW - marine sediments KW - chloride ion KW - sedimentation rates KW - Central Europe KW - carbon KW - sediments KW - alkalinity KW - organic carbon KW - geochemistry KW - Baltic Sea KW - chlorine KW - sulfate ion KW - methane KW - acoustical properties KW - isotope ratios KW - C-13/C-12 KW - sedimentation KW - alkanes KW - petroleum accumulation KW - nutrients KW - organic compounds KW - D/H KW - hydrogen KW - diagenesis KW - bacteria KW - hydrocarbons KW - Eckernforde Bay KW - turbidity KW - North Atlantic KW - Germany KW - Atlantic Ocean KW - 29A:Economic geology, geology of energy sources KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51362008?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Diagenetic+relationships+of+methanogenesis%2C+nutrients%2C+acoustic+turbidity%2C+pockmarks+and+freshwater+seepages+in+Eckernfoerde+Bay&rft.au=Whiticar%2C+Michael+J&rft.aulast=Whiticar&rft.aufirst=Michael&rft.date=2002-04-01&rft.volume=182&rft.issue=1-2&rft.spage=29&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 107 N1 - Document feature - illus. incl. sect., 1 table, sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - acoustical properties; aliphatic hydrocarbons; alkalinity; alkanes; Atlantic Ocean; bacteria; Baltic Sea; C-13/C-12; carbon; Central Europe; chloride ion; chlorine; cores; D/H; diagenesis; Eckernforde Bay; Europe; geochemistry; Germany; halogens; hydrocarbons; hydrogen; isotope ratios; isotopes; marine sediments; methane; natural gas; North Atlantic; nutrients; organic carbon; organic compounds; petroleum; petroleum accumulation; resources; sedimentation; sedimentation rates; sediments; stable isotopes; sulfate ion; turbidity ER - TY - JOUR T1 - Selection of phage displayed peptides for the detection of 2,4,6-trinitrotoluene in seawater AN - 19725046; 5595047 AB - We have selected for phage displayed peptides that showed specific binding to a 2,4,6-trinitrotoluene (TNT) derivative, 2,4,6-trinitrobenzene (TNB) in environmentally relevant conditions, and have integrated the selected phage into a continuous flow immunosensor platform for the detection of TNT. A library of 12 random amino acid peptides (12-mers) displayed on phage was panned against TNB coupled to the protein bovine serum albumin (BSA) in a solution of artificial seawater. Eight phage clones, seven of which share an identical amino acid sequence, bound selectively to TNB-BSA in artificial seawater as judged by enzyme-linked immunosorbent assay (ELISA). Addition of TNT, inhibited binding of the phage. Whole phage were labeled with the dye cyanine 5 (Cy5), and incorporated into a flow sensor platform. Labeled phage were loaded onto a TNB-affi-gel packed column, and a reproducible signal, at least five times greater than background, was observed on repeat injections of 10 mg/l TNT dissolved in seawater. This study presents one of the first examples of phage selection in a non-physiological medium, and the first demonstration that dye-labeled phage can be integrated into a continuous flow sensor. JF - Analytica Chimica Acta AU - Goldman, E R AU - Pazirandeh, M P AU - Charles, P T AU - Balighian, ED AU - Anderson, G P AD - Naval Research Laboratory, Center for Bio/Molecular Science and Engineering, Code 6900, 4555 Overlook Avenue SW, Washington, DC 20375 5438, USA Y1 - 2002/04// PY - 2002 DA - Apr 2002 SP - 13 EP - 19 VL - 457 IS - 1 SN - 0003-2670, 0003-2670 KW - 2,4,6-trinitrotoluene KW - Biosensors KW - Trinitrobenzene KW - peptides KW - trinitrobenzene KW - Biotechnology and Bioengineering Abstracts; Bioengineering Abstracts; Aqualine Abstracts; Water Resources Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Pollution Abstracts; ASFA Marine Biotechnology Abstracts KW - Phages KW - Sensors KW - Water sampling KW - Water Analysis KW - Seawater KW - Chemical Analysis KW - Water analysis KW - Serology KW - 2,4,6-Trinitrotoluene KW - Marine environment KW - ELISA KW - Marine KW - Bacteriophages KW - Amino Acids KW - Enzyme-linked immunosorbent assay KW - Pollution detection KW - Amino acids KW - Sea water KW - immunosensors KW - Bovine serum albumin KW - Dyes KW - Trinitrotoluene KW - Analytical techniques KW - Peptides KW - Explosives KW - Monitoring KW - Immunoassays KW - Chemical analysis KW - Amino acid sequence KW - SW 5010:Network design KW - P 1000:MARINE POLLUTION KW - Q4 27700:Molecular Techniques KW - W4 230:Biosensors, Bioelectronics & Bioindicators KW - Q5 08502:Methods and instruments KW - AQ 00003:Monitoring and Analysis of Water and Wastes KW - W 30965:Miscellaneous, Reviews UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/19725046?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Analytica+Chimica+Acta&rft.atitle=Selection+of+phage+displayed+peptides+for+the+detection+of+2%2C4%2C6-trinitrotoluene+in+seawater&rft.au=Goldman%2C+E+R%3BPazirandeh%2C+M+P%3BCharles%2C+P+T%3BBalighian%2C+ED%3BAnderson%2C+G+P&rft.aulast=Goldman&rft.aufirst=E&rft.date=2002-04-01&rft.volume=457&rft.issue=1&rft.spage=13&rft.isbn=&rft.btitle=&rft.title=Analytica+Chimica+Acta&rft.issn=00032670&rft_id=info:doi/10.1016%2FS0003-2670%2801%2901246-6 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2005-02-01 N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Bacteriophages; Sea water; Amino acids; Pollution detection; Dyes; Water sampling; Sensors; Analytical techniques; ELISA; Peptides; Explosives; Phages; Enzyme-linked immunosorbent assay; immunosensors; 2,4,6-Trinitrotoluene; Bovine serum albumin; Marine environment; Chemical analysis; Immunoassays; Amino acid sequence; Seawater; Trinitrotoluene; Chemical Analysis; Monitoring; Serology; Water analysis; Amino Acids; Water Analysis; Marine DO - http://dx.doi.org/10.1016/S0003-2670(01)01246-6 ER - TY - JOUR T1 - Transport, deposition and biodegradation of particle bound polycyclic aromatic hydrocarbons in a tidal basin of an industrial watershed AN - 19424494; 5386429 AB - Polycylic aromatic hydrocarbons (PAHs) are common contaminants in industrial watersheds. Their origin, transport and fate are important to scientists, environmental managers and citizens. The Philadelphia Naval Reserve Basin (RB) is a small semi-enclosed embayment near the confluence of the Schuylkill and Delaware Rivers in Pennsylvania (USA). We conducted a study at this site to determine the tidal flux of particles and particle-bound contaminants associated with the RB. Particle traps were placed at the mouth and inside the RB and in the Schuylkill and Delaware Rivers. There was net particle deposition into the RB, which was determined for three seasons. Spring and fall depositions were highest (1740 and 1230 kg of particles, respectively) while winter deposition was insignificant. PAH concentrations on settling particles indicated a net deposition of 12.7 g PAH in fall and 2.1 g PAH in spring over one tidal cycle. There was no significant PAH deposition in the winter. Biodegradation rates, calculated from super(14)C-labeled PAH substrate mineralization, could attenuate only about 0.25% of the PAH deposited during a tidal cycle in fall. However, in the spring, biodegradation could be responsible for degrading 50% of the settling PAHs. The RB appears to be a sink for PAHs in this watershed. JF - Environmental Monitoring and Assessment AU - Pohlman, J W AU - Coffin, R B AU - Mitchell, C S AU - Montgomery, M T AU - Spargo, B J AU - Steele, J K AU - Boyd, T J AD - Naval Research Laboratory Code 6115, SW, Washington DC 20375, USA Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 155 EP - 167 PB - Kluwer Academic Publishers, [mailto:sales@wkap.nl] VL - 75 IS - 2 SN - 0167-6369, 0167-6369 KW - PAH KW - Philadelphia Naval Reserve Basin KW - USA, Pennsylvania KW - seasonal variations KW - tidal basin KW - Biotechnology and Bioengineering Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Pollution Abstracts; Aqualine Abstracts; Water Resources Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology; Toxicology Abstracts KW - Contamination KW - Basins KW - Freshwater KW - Mineralization KW - Watersheds KW - Aromatic hydrocarbons KW - Seasonal variations KW - Environmental monitoring KW - Rivers KW - Aromatic Compounds KW - Pollutant deposition KW - Seasons KW - Traps KW - Contaminants KW - Biodegradation KW - Path of Pollutants KW - Water Pollution Sources KW - Pollution dispersion KW - Retinoblastoma protein KW - Particulates KW - Pollution (see also contamination) KW - Industrial wastes KW - Catchment areas KW - Industrial Wastes KW - Basins (Geographical) (see also Catchment areas) KW - USA, Pennsylvania, Delaware R. KW - Industrial pollution KW - Mouth KW - Polycyclic aromatic hydrocarbons KW - Pollution detection KW - Hydrocarbons KW - Fate of Pollutants KW - Suspended particulate matter KW - Fate KW - Particles KW - Biodegradation (see also Biological oxidation) KW - Contamination (see also Pollution) KW - Chemical pollutants KW - USA, Pennsylvania, Schuylkill R. KW - Q5 08503:Characteristics, behavior and fate KW - AQ 00007:Industrial Effluents KW - X 24190:Polycyclic hydrocarbons KW - W 30950:Waste Treatment & Pollution Clean-up KW - A 01063:Utilization KW - P 2000:FRESHWATER POLLUTION KW - SW 3020:Sources and fate of pollution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/19424494?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Monitoring+and+Assessment&rft.atitle=Transport%2C+deposition+and+biodegradation+of+particle+bound+polycyclic+aromatic+hydrocarbons+in+a+tidal+basin+of+an+industrial+watershed&rft.au=Pohlman%2C+J+W%3BCoffin%2C+R+B%3BMitchell%2C+C+S%3BMontgomery%2C+M+T%3BSpargo%2C+B+J%3BSteele%2C+J+K%3BBoyd%2C+T+J&rft.aulast=Pohlman&rft.aufirst=J&rft.date=2002-04-01&rft.volume=75&rft.issue=2&rft.spage=155&rft.isbn=&rft.btitle=&rft.title=Environmental+Monitoring+and+Assessment&rft.issn=01676369&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-12-01 N1 - Last updated - 2016-05-27 N1 - SubjectsTermNotLitGenreText - Rivers; Biodegradation; Pollution detection; Industrial wastes; Pollution dispersion; Basins; Aromatic hydrocarbons; Suspended particulate matter; Watersheds; Chemical pollutants; Fate; Environmental monitoring; Polycyclic aromatic hydrocarbons; Contamination; Retinoblastoma protein; Mineralization; Traps; Mouth; Industrial pollution; Contaminants; Seasonal variations; Pollutant deposition; Particulates; Particles; Biodegradation (see also Biological oxidation); Pollution (see also contamination); Catchment areas; Basins (Geographical) (see also Catchment areas); Seasons; Contamination (see also Pollution); Aromatic Compounds; Water Pollution Sources; Hydrocarbons; Path of Pollutants; Fate of Pollutants; Industrial Wastes; USA, Pennsylvania, Delaware R.; USA, Pennsylvania, Schuylkill R.; Freshwater ER - TY - JOUR T1 - Airborne remote sensing of breaking waves AN - 18568444; 5368028 AB - Airborne scanning laser ranging provides rapid measurements of the ocean wave topography. In addition to active ranging, the scanning optics can obtain passive measurements of the surface emissivity, yielding a digital image of the surface brightness. The brightness data contain information on the statistics and spatial distribution of whitecaps. Combining active measurements of the 3D surface topography and passive brightness data, the phase distribution of breaking events along a wave profile can be examined. From the phase distribution analysis, it is found that in deep water, the whitecap coverage in the windward phase is slightly higher than that in the leeward phase (51 plus or minus 17% vs. 49 plus or minus 14%), and more whitecaps are found on the crests than in the troughs (57 plus or minus 13% vs. 44 plus or minus 16%). Such quantitative information on wave breaking and whitecap coverage is important to remote sensing applications and air-sea interaction studies. JF - Remote Sensing of Environment AU - Hwang, P A AU - Wright, W AU - Krabill, W B AU - Swift, R N AD - Oceanography Division, Naval Research Laboratory, Stennis Space Center, MS 39529, USA, phwang@nrlssc.navy.mil Y1 - 2002/04// PY - 2002 DA - April 2002 SP - 65 EP - 75 VL - 80 IS - 1 SN - 0034-4257, 0034-4257 KW - scanning laser ranging KW - Meteorological & Geoastrophysical Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts KW - Remote Sensing KW - Whitecaps KW - Airborne sensing KW - Ocean wave measurement techniques KW - Surface water waves KW - Surface topography KW - Breaking waves KW - Remote sensing equipment KW - Surface radiation temperature KW - Air-sea interaction KW - Laser measurement of ocean waves KW - Laser uses in oceanography KW - Remote sensing of ocean waves KW - Oceans KW - Ocean-atmosphere system KW - Waves KW - Lasers KW - O 2090:Instruments/Methods KW - SW 5040:Data acquisition KW - Q2 09162:Methods and instruments KW - M2 551.466.2:Methods of interpreting and analyzing (ocean) wave observations. Wave spectra (551.466.2) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18568444?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Remote+Sensing+of+Environment&rft.atitle=Airborne+remote+sensing+of+breaking+waves&rft.au=Hwang%2C+P+A%3BWright%2C+W%3BKrabill%2C+W+B%3BSwift%2C+R+N&rft.aulast=Hwang&rft.aufirst=P&rft.date=2002-04-01&rft.volume=80&rft.issue=1&rft.spage=65&rft.isbn=&rft.btitle=&rft.title=Remote+Sensing+of+Environment&rft.issn=00344257&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Whitecaps; Air-sea interaction; Airborne sensing; Surface topography; Surface water waves; Ocean-atmosphere system; Breaking waves; Lasers; Remote sensing equipment; Surface radiation temperature; Laser uses in oceanography; Laser measurement of ocean waves; Ocean wave measurement techniques; Remote sensing of ocean waves; Remote Sensing; Oceans; Waves ER - TY - JOUR T1 - Initial Condition Sensitivity and Error Growth in Forecasts of the 25 January 2000 East Coast Snowstorm AN - 18561109; 5353486 AB - Short- and medium-range (24-96-h) forecasts of the January 2000 U.S. east coast cyclone and associated snowstorm are examined using the U.S. Navy global forecast model and adjoint system. Attention is given to errors on the synoptic scale, including forecast position and central pressure of the cyclone at the verification time of 1200 UTC 25 January 2000. There is a substantial loss of predictive skill in the 72- and 96-h forecasts, while the 24- and 48-h forecasts capture the synoptic-scale features of the cyclone development with moderate errors. Sensitivity information from the adjoint model suggests that the initial conditions for the 72-h forecast starting at 1200 UTC 22 January 2000 contained relatively small, but critical, errors in upper-air wind and temperature over a large upstream area, including part of the eastern Pacific and "well observed" areas of western and central North America. The rapid growth of these initial errors in a highly unstable flow regime (large singular-vector growth factors) is the most likely cause of the large errors that developed in operational short- and medium-range forecasts of the snowstorm. The large extent of the upstream sensitive area in this case would appear to make "targeting" a small set of new observations an impractical method to improve forecast skill. A diagnostic correction (derived from adjoint sensitivity information) of a part of the initial condition error in the 72-h forecast reduces the forecast error norm by 75% and improves a 1860-km error in cyclone position to a 105-km error. This demonstrates that the model is capable of making a skillful forecast starting from an initial state that is plausible and not far from the original initial conditions. It is also shown that forecast errors in this case propagate at speeds that are greater than those of the synoptic-scale trough and ridge features of the cyclone. JF - Monthly Weather Review AU - Langland, R H AU - Shapiro, MA AU - Gelaro, R AD - Naval Research Laboratory, 7 Grace Hopper Avenue, Monterey, CA 93940, USA, langland@nrlmry.navy.mil Y1 - 2002/04// PY - 2002 DA - Apr 2002 SP - 957 EP - 974 PB - American Meteorological Society, 45 Beacon St. Boston MA 02108-3693 USA VL - 130 IS - 4 SN - 0027-0644, 0027-0644 KW - North America KW - ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts KW - Q2 02242:Observations and measurements at sea KW - SW 0815:Precipitation KW - M2 551.509.1/.5:Forecasting (551.509.1/.5) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18561109?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Monthly+Weather+Review&rft.atitle=Initial+Condition+Sensitivity+and+Error+Growth+in+Forecasts+of+the+25+January+2000+East+Coast+Snowstorm&rft.au=Langland%2C+R+H%3BShapiro%2C+MA%3BGelaro%2C+R&rft.aulast=Langland&rft.aufirst=R&rft.date=2002-04-01&rft.volume=130&rft.issue=4&rft.spage=957&rft.isbn=&rft.btitle=&rft.title=Monthly+Weather+Review&rft.issn=00270644&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - Campylobacter Protein Glycosylation Affects Host Cell Interactions AN - 18280582; 5332748 AB - Campylobacter jejuni 81-176 pgl mutants impaired in general protein glycosylation showed reduced ability to adhere to and invade INT407 cells and to colonize intestinal tracts of mice. JF - Infection and Immunity AU - Szymanski, C M AU - Burr, D H AU - Guerry, P AD - Enteric Diseases Program, Naval Medical Research Center, 503 Robert Grant Ave., Silver Spring, MD 20910-7500., guerryp@nmrc.navy.mil Y1 - 2002/04// PY - 2002 DA - Apr 2002 SP - 2242 EP - 2244 VL - 70 IS - 4 SN - 0019-9567, 0019-9567 KW - mice KW - pg1 gene KW - Genetics Abstracts; Microbiology Abstracts B: Bacteriology KW - Campylobacter jejuni KW - Intestine KW - Glycosylation KW - Infection KW - Mutants KW - G 07320:Bacterial genetics KW - J 02846:Gastrointestinal tract UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18280582?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Infection+and+Immunity&rft.atitle=Campylobacter+Protein+Glycosylation+Affects+Host+Cell+Interactions&rft.au=Szymanski%2C+C+M%3BBurr%2C+D+H%3BGuerry%2C+P&rft.aulast=Szymanski&rft.aufirst=C&rft.date=2002-04-01&rft.volume=70&rft.issue=4&rft.spage=2242&rft.isbn=&rft.btitle=&rft.title=Infection+and+Immunity&rft.issn=00199567&rft_id=info:doi/10.1128%2FIAI.70.4.2242-2244.2002 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Campylobacter jejuni; Glycosylation; Mutants; Infection; Intestine DO - http://dx.doi.org/10.1128/IAI.70.4.2242-2244.2002 ER - TY - JOUR T1 - Nonlinear Dispersion of Surface Gravity Waves in Shallow Water AN - 1665490554; 5373110 AB - The nonlinear dispersion of random, directionally spread surface gravity waves in shallow water is examined with Boussinesq theory and field observations. A theoretical dispersion relationship giving a directionally averaged wavenumber magnitude as a function of frequency, the local water depth, and the local wave spectrum and bispectrum is derived for waves propagating over a gently sloping beach with straight and parallel depth contours. The linear, nondispersive shallow water relation is recovered as the first-order solution, with weak frequency and amplitude dispersion appearing as second-order corrections. Wavenumbers were estimated using four arrays of pressure sensors deployed in 2-6-m depth on a gently sloping sandy beach. When wave energy is low, the observed wavenumbers agree with the linear, finite-depth dispersion relation over a wide frequency range. In high energy conditions, the observed wavenumbers deviate from the linear dispersion relation by as much as 20%-30% in the frequency range from two to three times the frequency of the primary spectral peak, but agree well with the nonlinear Boussinesq dispersion relation, confirming that the deviations from linear theory are finite amplitude effects. In high energy conditions, the predicted frequency and amplitude dispersion tend to cancel, yielding a nearly nondispersive wave field in which waves of all frequencies travel with approximately the linear shallow water wave speed, consistent with the observations. The nonlinear Boussinesq theory wavenumber predictions (based on the assumption of irrotational wave motion) are accurate even within the surf zone, suggesting that wave breaking on gently sloping beaches has little effect on the dispersion relation. JF - Journal of Physical Oceanography AU - Herbers, THC AU - Elgar, S AU - Sarap, NA AU - Guza, R T AD - Department of Oceanography, Code OC/He, Naval Postgraduate School, Monterey, CA 93943-5122, USA, thherber@nps.navy.mil Y1 - 2002/04// PY - 2002 DA - Apr 2002 SP - 1181 EP - 1193 VL - 32 IS - 4 SN - 0022-3670, 0022-3670 KW - Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Marine KW - Nonlinear waves KW - Gravity wave dissipation KW - Shallow water KW - Surface water waves KW - Wave dispersion KW - Breaking waves KW - Gravity wave spectra KW - Wave shoaling KW - Q2 09168:Wind waves KW - O 2010:Physical Oceanography KW - M2 551.466.4:Effects of the bottom, of obstacles, of currents and of turbulence on sea and swell (551.466.4) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1665490554?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Physical+Oceanography&rft.atitle=Nonlinear+Dispersion+of+Surface+Gravity+Waves+in+Shallow+Water&rft.au=Herbers%2C+THC%3BElgar%2C+S%3BSarap%2C+NA%3BGuza%2C+R+T&rft.aulast=Herbers&rft.aufirst=THC&rft.date=2002-04-01&rft.volume=32&rft.issue=4&rft.spage=1181&rft.isbn=&rft.btitle=&rft.title=Journal+of+Physical+Oceanography&rft.issn=00223670&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Nonlinear waves; Shallow water; Surface water waves; Breaking waves; Wave dispersion; Gravity wave dissipation; Gravity wave spectra; Wave shoaling; Marine ER - TY - CPAPER T1 - Seasonal succession of the PAH-mineralizing bacteria in creosote-impacted intertidal sediments AN - 39530389; 3667257 AU - Montgomery, M T AU - Smith, D C AU - Mueller, J G AU - Boyd, T J Y1 - 2002/03/15/ PY - 2002 DA - 2002 Mar 15 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39530389?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Seasonal+succession+of+the+PAH-mineralizing+bacteria+in+creosote-impacted+intertidal+sediments&rft.au=Montgomery%2C+M+T%3BSmith%2C+D+C%3BMueller%2C+J+G%3BBoyd%2C+T+J&rft.aulast=Montgomery&rft.aufirst=M&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Association for Environmental Health Sciences, 150 Fearing Street, Amherst, MA 01002, USA; phone: 413-549-5170; fax: 413-549-0579; email: info@aehs.com; URL: www.aehs.com N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Multi-physics simulation of metal processing AN - 39473487; 3668787 AU - Samonds, M Y1 - 2002/03/15/ PY - 2002 DA - 2002 Mar 15 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39473487?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Multi-physics+simulation+of+metal+processing&rft.au=Samonds%2C+M&rft.aulast=Samonds&rft.aufirst=M&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: The Minerals, Metals & Materials Society, 184 Thorn Hill Road, Warrendale, Pennsylvania 15086, USA; phone: 724-776-9000; fax: 724-776-3770; URL: www.tms.org N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Scientific visualization of sediment dynamics in the bottom boundary layer AN - 39453671; 3660372 AU - Keen, T Y1 - 2002/03/15/ PY - 2002 DA - 2002 Mar 15 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39453671?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Scientific+visualization+of+sediment+dynamics+in+the+bottom+boundary+layer&rft.au=Keen%2C+T&rft.aulast=Keen&rft.aufirst=T&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: University of Rhode Island, Graduate School of Oceanography, Narragansett Bay Campus, Narragansett, RI 02882, USA; phone: 727-367-2771; fax: 727-367-8082; URL: www.oce.uri.edu/ecm7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Barotropic tidal modeling by data assimilation in the Yellow Sea and the Korea/Tsushima strait AN - 39409675; 3660501 AU - Book, J Y1 - 2002/03/15/ PY - 2002 DA - 2002 Mar 15 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39409675?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Barotropic+tidal+modeling+by+data+assimilation+in+the+Yellow+Sea+and+the+Korea%2FTsushima+strait&rft.au=Book%2C+J&rft.aulast=Book&rft.aufirst=J&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: University of Rhode Island, Graduate School of Oceanography, Narragansett Bay Campus, Narragansett, RI 02882, USA; phone: 727-367-2771; fax: 727-367-8082; URL: www.oce.uri.edu/ecm7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Circulation and mixing in Bay St. Louis, Mississippi AN - 39388699; 3660455 AU - Blain, CA Y1 - 2002/03/15/ PY - 2002 DA - 2002 Mar 15 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39388699?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Circulation+and+mixing+in+Bay+St.+Louis%2C+Mississippi&rft.au=Blain%2C+CA&rft.aulast=Blain&rft.aufirst=CA&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: University of Rhode Island, Graduate School of Oceanography, Narragansett Bay Campus, Narragansett, RI 02882, USA; phone: 727-367-2771; fax: 727-367-8082; URL: www.oce.uri.edu/ecm7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Applications of the incremental approach to Yellow Sea modeling AN - 39388603; 3660414 AU - Edwards, C Y1 - 2002/03/15/ PY - 2002 DA - 2002 Mar 15 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39388603?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Applications+of+the+incremental+approach+to+Yellow+Sea+modeling&rft.au=Edwards%2C+C&rft.aulast=Edwards&rft.aufirst=C&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: University of Rhode Island, Graduate School of Oceanography, Narragansett Bay Campus, Narragansett, RI 02882, USA; phone: 727-367-2771; fax: 727-367-8082; URL: www.oce.uri.edu/ecm7 N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - Maryland power plant cooling-water intake regulations and their application in evaluation of adverse environmental impact. AN - 72902898; 12806012 AB - Maryland's cooling-water intake and discharge regulations, the Code of Maryland Regulations (COMAR) 26.08.03, stem from Sections 316(a) and (b) of the Clean Water Act (CWA). COMAR 26.08.03.05 and litigative and administrative rulings stipulate that the location, design, construction, and capability of cooling-water intake structures must reflect the best technology available (BTA) for minimizing adverse environmental impacts (AEIs), providing that the costs of implementing the BTA are not wholly disproportionate to the expected environmental benefits. Maryland law exempts facilities that withdraw less than 10 million gallons/day (MGD) and less than 20% of stream or net flow by the intake. If not exempt, BTA must be installed if the cost of doing so is less than five times the value of fish impinged annually. Through site-specific studies and the use of a Spawning and Nursery Area of Consequence (SNAC) model applied to Representative Important Species, several power plants were evaluated to determine if they have had an adverse effect on spawning and nursery areas of consequence. Examples of application of the Maryland law to a number of power plants in the state are presented, together with the outcome of their evaluation. JF - TheScientificWorldJournal AU - McLean, Richard AU - Richkus, William A AU - Schreiner, Stephen P AU - Fluke, David AD - Power Plant Research Program, Mmaryland Department of Natural Resources, Annapolis, MD 21401, USA. Y1 - 2002/03/08/ PY - 2002 DA - 2002 Mar 08 SP - 1 EP - 11 VL - 2 Suppl 1 KW - Index Medicus KW - Environmental Monitoring KW - Ecosystem KW - Animals KW - Guideline Adherence KW - Maryland KW - Fishes -- physiology KW - Power Plants -- legislation & jurisprudence KW - Environment KW - Fresh Water KW - Seawater KW - Power Plants -- standards KW - Power Plants -- economics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72902898?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=TheScientificWorldJournal&rft.atitle=Maryland+power+plant+cooling-water+intake+regulations+and+their+application+in+evaluation+of+adverse+environmental+impact.&rft.au=McLean%2C+Richard%3BRichkus%2C+William+A%3BSchreiner%2C+Stephen+P%3BFluke%2C+David&rft.aulast=McLean&rft.aufirst=Richard&rft.date=2002-03-08&rft.volume=2+Suppl+1&rft.issue=&rft.spage=1&rft.isbn=&rft.btitle=&rft.title=TheScientificWorldJournal&rft.issn=1537-744X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2004-04-23 N1 - Date created - 2003-06-13 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - An ensemble source spectra model for merchant ship-radiated noise. AN - 85366696; pmid-11931298 AB - This paper presents an evaluation of the classical model for determining an ensemble of the broadband source spectra of the sound generated by individual ships and proposes an alternate model to overcome the deficiencies in the classical model. The classical model, proposed by Ross [Mechanics of Underwater Noise (Pergamon, New York, 1976)] postulates that the source spectrum for an individual ship is proportional to a baseline spectrum with the constant of proportionality determined by a power-law relationship on the ship speed and length. The model evaluation, conducted on an ensemble of 54 source spectra over a 30-1200-Hz to 1200-Hz frequency band, shows that this assumption yields large rms errors in the broadband source level for the individual ships and significantly overestimates the variability in the source level across the ensemble of source spectra. These deficiencies are a consequence of the negligible correlation between the source level and the ship speed and the source level and the ship length. The alternate model proposed here represents the individual ship spectra by a modified rational spectrum where the poles and zeros are restricted to the real axis and the exponents of the terms are not restricted to integer values. An evaluation of this model on the source spectra ensemble indicates that the rms errors are significantly less than those obtained with any model where the frequency dependence is represented by a single baseline spectrum. Furthermore, at high frequencies (400 to 1200 Hz), a single-term rational spectrum model is sufficient to describe the frequency dependence and, at the low frequencies (30 to 400 Hz), there is only a modest reduction in the rms error for a higher order model. Finally, a joint probability density on the two parameters of the single term model based on the measured histograms of these parameters is proposed. This probability density provides a mechanism for generating an ensemble of ship spectra. JF - The Journal of the Acoustical Society of America AU - Wales, Stephen C AU - Heitmeyer, Richard M AD - Acoustics Division, Naval Research Laboratory, Washington, DC 203 75-5350, USA. Y1 - 2002/03// PY - 2002 DA - Mar 2002 SP - 1211 EP - 1231 VL - 111 IS - 3 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85366696?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=An+ensemble+source+spectra+model+for+merchant+ship-radiated+noise.&rft.au=Wales%2C+Stephen+C%3BHeitmeyer%2C+Richard+M&rft.aulast=Wales&rft.aufirst=Stephen&rft.date=2002-03-01&rft.volume=111&rft.issue=3&rft.spage=1211&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Translation of polioviral mRNA is inhibited by cleavage of polypyrimidine tract-binding proteins executed by polioviral 3C(pro). AN - 71455531; 11836431 AB - The translation of polioviral mRNA occurs through an internal ribosomal entry site (IRES). Several RNA-binding proteins, such as polypyrimidine tract-binding protein (PTB) and poly(rC)-binding protein (PCBP), are required for the poliovirus IRES-dependent translation. Here we report that a poliovirus protein, 3C(pro) (and/or 3CD(pro)), cleaves PTB isoforms (PTB1, PTB2, and PTB4). Three 3C(pro) target sites (one major target site and two minor target sites) exist in PTBs. PTB fragments generated by poliovirus infection are redistributed to the cytoplasm from the nucleus, where most of the intact PTBs are localized. Moreover, these PTB fragments inhibit polioviral IRES-dependent translation in a cell-based assay system. We speculate that the proteolytic cleavage of PTBs may contribute to the molecular switching from translation to replication of polioviral RNA. JF - Journal of virology AU - Back, Sung Hoon AU - Kim, Yoon Ki AU - Kim, Woo Jae AU - Cho, Sungchan AU - Oh, Hoe Rang AU - Kim, Jung-Eun AU - Jang, Sung Key AD - NRL, Department of Life Science, Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang, Kyungbuk 790-784, Korea. Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 2529 EP - 2542 VL - 76 IS - 5 SN - 0022-538X, 0022-538X KW - Protein Isoforms KW - 0 KW - RNA, Messenger KW - RNA, Viral KW - RNA-Binding Proteins KW - Ribonucleoproteins KW - Viral Proteins KW - Polypyrimidine Tract-Binding Protein KW - 139076-35-0 KW - Cysteine Endopeptidases KW - EC 3.4.22.- KW - 3C proteases KW - EC 3.4.22.28 KW - Index Medicus KW - Mutagenesis, Site-Directed KW - Ribosomes -- metabolism KW - HeLa Cells KW - Protein Isoforms -- metabolism KW - Humans KW - Molecular Sequence Data KW - Subcellular Fractions KW - Amino Acid Sequence KW - RNA, Viral -- genetics KW - RNA, Viral -- metabolism KW - Cell Line KW - Viral Proteins -- genetics KW - Protein Biosynthesis KW - RNA-Binding Proteins -- metabolism KW - RNA, Messenger -- metabolism KW - Cysteine Endopeptidases -- metabolism KW - Poliovirus -- metabolism KW - Poliovirus -- genetics KW - Viral Proteins -- metabolism KW - Ribonucleoproteins -- metabolism KW - RNA, Messenger -- genetics KW - Cysteine Endopeptidases -- genetics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71455531?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+virology&rft.atitle=Translation+of+polioviral+mRNA+is+inhibited+by+cleavage+of+polypyrimidine+tract-binding+proteins+executed+by+polioviral+3C%28pro%29.&rft.au=Back%2C+Sung+Hoon%3BKim%2C+Yoon+Ki%3BKim%2C+Woo+Jae%3BCho%2C+Sungchan%3BOh%2C+Hoe+Rang%3BKim%2C+Jung-Eun%3BJang%2C+Sung+Key&rft.aulast=Back&rft.aufirst=Sung&rft.date=2002-03-01&rft.volume=76&rft.issue=5&rft.spage=2529&rft.isbn=&rft.btitle=&rft.title=Journal+of+virology&rft.issn=0022538X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-03-15 N1 - Date created - 2002-02-11 N1 - Date revised - 2017-01-13 N1 - SuppNotes - Cited By: RNA. 1995 Nov;1(9):924-38 [8548657] J Virol. 1996 Mar;70(3):1941-52 [8627720] Cold Spring Harb Symp Quant Biol. 1995;60:663-8 [8824440] Arch Med Res. 1996 Autumn;27(3):413-9 [8854403] Proc Natl Acad Sci U S A. 1996 Oct 1;93(20):11115-20 [8855318] EMBO J. 1996 Nov 1;15(21):5988-98 [8918476] Virology. 1996 Dec 15;226(2):318-26 [8955051] Mol Cell Biol. 1997 Jan;17(1):163-9 [8972196] Genes Dev. 1998 Aug 1;12(15):2293-304 [9694795] J Virol. 1999 Jan;73(1):709-17 [9847377] J Virol. 1999 Jan;73(1):718-27 [9847378] J Virol. 1999 Mar;73(3):2193-200 [9971802] Genes Dev. 1999 Feb 15;13(4):437-48 [10049359] Trends Microbiol. 1999 Feb;7(2):76-82 [10081085] RNA. 1999 Mar;5(3):344-59 [10094304] Virus Res. 1999 Aug;62(2):129-47 [10507323] J Virol. 1999 Dec;73(12):10104-12 [10559325] J Biol Chem. 1999 Dec 31;274(53):38163-70 [10608888] J Virol. 2000 Mar;74(5):2219-26 [10666252] J Virol. 2000 Mar;74(5):2383-92 [10666269] Annu Rev Biochem. 1988;57:701-54 [3052288] J Virol. 1988 Dec;62(12):4586-93 [2846872] J Virol. 1989 Mar;63(3):1054-8 [2536819] J Biol Chem. 1989 Jun 15;264(17):9738-41 [2542331] Curr Top Microbiol Immunol. 1990;161:49-87 [2169385] Cell. 1990 Oct 19;63(2):369-80 [2170027] Annu Rev Microbiol. 1990;44:603-23 [2252396] Genes Dev. 1990 Sep;4(9):1560-72 [2174810] J Gen Virol. 1990 Nov;71 ( Pt 11):2553-63 [2174954] Mol Cell Biol. 2000 Mar;20(5):1583-95 [10669736] J Mol Biol. 2000 May 5;298(3):395-405 [10772858] EMBO J. 2000 Jun 15;19(12):3132-41 [10856256] Trends Microbiol. 2000 Jul;8(7):330-5 [10878768] J Mol Biol. 2000 Nov 24;304(2):119-33 [11080450] EMBO J. 2001 Jan 15;20(1-2):240-9 [11226174] EMBO J. 2001 Mar 15;20(6):1439-48 [11250909] Mol Cell Biol. 2001 May;21(10):3281-8 [11313454] J Virol. 1997 Feb;71(2):1220-6 [8995645] J Cell Biol. 1997 Jun 2;137(5):965-74 [9166399] J Virol. 1997 Aug;71(8):6243-6 [9223526] RNA. 1997 Aug;3(8):882-92 [9257647] Exp Cell Res. 1997 Aug 25;235(1):300-4 [9281380] Biochemistry. 1997 Sep 30;36(39):11881-90 [9305981] RNA. 1997 Oct;3(10):1124-34 [9326487] J Virol. 1997 Nov;71(11):8330-9 [9343186] Virology. 1997 Dec 8;239(1):176-85 [9426457] Biochem J. 1998 Apr 1;331 ( Pt 1):169-75 [9512476] FEBS Lett. 1998 Apr 3;425(3):401-6 [9563502] RNA. 1998 Jun;4(6):626-38 [9622122] Mol Cell Biol. 2001 May;21(10):3364-74 [11313462] Nucleic Acids Res. 2001 Dec 15;29(24):5009-16 [11812831] J Mol Biol. 1968 Mar 14;32(2):359-68 [4171196] J Virol. 1980 Jul;35(1):150-6 [6251263] Nature. 1981 Jun 18;291(5816):547-53 [6264310] J Virol. 1982 Jan;41(1):244-9 [6283117] J Biol Chem. 1982 Dec 25;257(24):14806-10 [6294080] J Virol. 1984 Mar;49(3):873-80 [6321771] Cell. 1986 Jun 6;45(5):761-70 [3011278] Proc Natl Acad Sci U S A. 1987 Jan;84(1):21-5 [3467351] Proc Natl Acad Sci U S A. 1987 Jun;84(12):4002-6 [3035560] J Virol. 1987 Sep;61(9):2711-8 [3039165] Nature. 1988 Jul 28;334(6180):320-5 [2839775] Science. 1988 Jul 22;241(4864):445-8 [2839901] Genes Dev. 1991 Jul;5(7):1224-36 [1906035] Genes Dev. 1991 Jul;5(7):1237-51 [1906036] Trends Biochem Sci. 1991 Jun;16(6):214-20 [1716386] J Virol. 1991 Dec;65(12):6486-94 [1658355] J Virol. 1992 Jun;66(6):3330-8 [1316450] Nucleic Acids Res. 1992 Jul 25;20(14):3671-8 [1641332] Mol Cell Biol. 1993 Feb;13(2):1232-7 [8380894] J Virol. 1993 Jun;67(6):3326-31 [8388502] Proc Natl Acad Sci U S A. 1993 Aug 15;90(16):7642-6 [8395052] J Virol. 1993 Nov;67(11):6716-25 [8411373] J Virol. 1994 Feb;68(2):1066-74 [8289336] J Virol. 1994 Feb;68(2):941-50 [8289396] Arch Virol Suppl. 1994;9:181-94 [8032249] Methods Enzymol. 1994;244:583-95 [7845234] J Virol. 1995 Jun;69(6):3658-67 [7745714] Science. 1995 May 26;268(5214):1173-6 [7761834] Virology. 1995 Aug 20;211(2):451-61 [7645249] J Biol Chem. 1995 Sep 15;270(37):21975-83 [7665619] Curr Top Microbiol Immunol. 1995;203:65-83 [7555091] Curr Top Microbiol Immunol. 1995;203:85-98 [7555092] RNA. 1995 May;1(3):234-45 [7489496] N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Seafloor spreading in the Weddell Sea from magnetic and gravity data AN - 52101875; 2002-046082 AB - A re-compilation of magnetic data in the Weddell Sea is presented and compared with the gravity field recently derived from retracked satellite altimetry. The previously informally named "Anomaly-T," an east-west trending linear positive magnetic and gravity anomaly lying at about 69 degrees S, forms the southern boundary of the well-known Weddell Sea gravity herringbone. North of Anomaly-T, three major E-W linear magnetic lows are shown, and identified with anomalies c12r, c21-29(r) and c33r. On the basis of these, and following work by recent investigators, isochrons c13, c18, c20, c21, c30, c33 and c34 are identified and extended into the western Weddell Sea. Similarly, a linear magnetic low lying along the spine of the herringbone is shown and provisionally dated at 93-96 Ma. Anomaly-T is tentatively dated to be M5n, in agreement with recent tectonic models. Although current tectonic models are generally in good agreement to the north of T, to the south interpretations differ. Some plate tectonic models have only proposed essentially north-south spreading in the region, whilst others have suggested that a period of predominantly east-west motion (relative to present Antarctic geographic coordinates) occurred during the mid-Mesozoic spreading between East and West Gondwana. We identify an area immediately to the south of T which appears to be the southerly extent of N-S spreading in the herringbone. Following recent work, the extreme southerly extent of the N-S directed spreading of the herringbone is provisionally dated M9r/M10. In the oldest Weddell Sea, immediately to the north and east of the Antarctic shelf, we see subtle features in both the magnetic and gravity data that are consistent with predominantly N-S spreading in the Weddell Sea during the earliest opening of East and West Gondwana. In between, however, in a small region extending approximately from about 50 km south of T to about 70 degrees S and from approximately 40 degrees to 53 degrees W, the magnetic and gravity data appear to suggest well-correlated linear marine magnetic anomalies (possible isochrons) perpendicular to T, bounded and offset by less well-defined steps and linear lows in the gravity (possible fracture zones). These magnetic and gravity data southwest of T suggest that the crust here may record an E-W spreading episode between the two-plate system of East and West Gondwana prior to the initiation of the three-plate spreading system of South America, Africa and Antarctica. The E-W spreading record to the east of about 35 degrees W would then appear to have been cut off at about M10 time during the establishment of N-S three-plate spreading along the South American-Antarctic Ridge and then subducted under the Scotia Ridge. JF - Tectonophysics AU - Kovacs, Louis C AU - Morris, P AU - Brozena, J AU - Tikku, Anahita A A2 - von Frese, Ralph R. B. A2 - Taylor, Patrick T. A2 - Chiappini, Massimo Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 43 EP - 64 PB - Elsevier, Amsterdam VL - 347 IS - 1-3 SN - 0040-1951, 0040-1951 KW - Southern Ocean KW - geophysical surveys KW - Antarctic Ocean KW - geophysical methods KW - magnetic methods KW - magnetic anomalies KW - mapping KW - continental drift KW - gravity methods KW - gravity anomalies KW - plate tectonics KW - marine methods KW - sea-floor spreading KW - surveys KW - Gondwana KW - geophysical profiles KW - Weddell Sea KW - airborne methods KW - 18:Solid-earth geophysics KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52101875?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Tectonophysics&rft.atitle=Seafloor+spreading+in+the+Weddell+Sea+from+magnetic+and+gravity+data&rft.au=Kovacs%2C+Louis+C%3BMorris%2C+P%3BBrozena%2C+J%3BTikku%2C+Anahita+A&rft.aulast=Kovacs&rft.aufirst=Louis&rft.date=2002-03-01&rft.volume=347&rft.issue=1-3&rft.spage=43&rft.isbn=&rft.btitle=&rft.title=Tectonophysics&rft.issn=00401951&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00401951 LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 1999 spring meeting, Antarctic Digital Magnetic Anomaly Project (ADMAP) workshop III N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 47 N1 - Document feature - illus. incl. sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - TCTOAM N1 - SubjectsTermNotLitGenreText - airborne methods; Antarctic Ocean; continental drift; geophysical methods; geophysical profiles; geophysical surveys; Gondwana; gravity anomalies; gravity methods; magnetic anomalies; magnetic methods; mapping; marine methods; plate tectonics; sea-floor spreading; Southern Ocean; surveys; Weddell Sea ER - TY - JOUR T1 - An Early Cretaceous extinct spreading center in the northern Natal Valley AN - 52099100; 2002-046084 AB - We have identified an extinct E-W spreading center in the northern Natal valley on the basis of magnetic anomalies which was active from chron M11 ( approximately 133 Ma) to approximately 125.3 Ma, just before chron M2 ( approximately 124 Ma) in the Early Cretaceous. Seafloor spreading in the northern Natal valley accounts for approximately 170 km of north-south motion between the Mozambique Ridge and Africa. This extension resolves the predicted overlap of the continental (central and southern) Mozambique Ridge and Antarctica in the chron M2 to M11 reconstructions from Mesozoic finite rotation parameters for Africa and Antarctica. In addition, the magnetic data reveal that the Mozambique Ridge was an independent microplate from at least 133 to 125 Ma. The northern Natal valley extinct spreading center connects to the spreading center separating the Mozambique Basin and the Riiser-Larsen Sea to the east. It follows that the northern Mozambique Ridge was either formed after the emplacement of the surrounding oceanic crust or it is the product of a very robust spreading center. To the west the extinct spreading center connects to the spreading center separating the southern Natal valley and Georgia Basin via a transform fault. Prior to chron M11, there is still a problem with the overlap of Mozambique Ridge if it is assumed to be fixed with respect to either the African or Antarctic plates. Some of the overlap can be accounted for by Jurassic deformation of the Mozambique Ridge, Mozambique Basin, and Dronning Maud land. It appears though that the Mozambique Ridge was an independent microplate from the breakup of Gondwana, approximately 160 Ma, until it became part of the African plate, approximately 125 Ma. JF - Tectonophysics AU - Tikku, Anahita A AU - Marks, Karen M AU - Kovacs, Louis C A2 - von Frese, Ralph R. B. A2 - Taylor, Patrick T. A2 - Chiappini, Massimo Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 87 EP - 108 PB - Elsevier, Amsterdam VL - 347 IS - 1-3 SN - 0040-1951, 0040-1951 KW - oceanic crust KW - Cretaceous KW - East Africa KW - strike-slip faults KW - transform faults KW - sea-floor spreading KW - Gondwana KW - South Africa KW - ocean floors KW - spreading centers KW - faults KW - Lower Cretaceous KW - magnetic anomalies KW - KwaZulu-Natal South Africa KW - Queen Maud Land KW - Mesozoic KW - extension KW - plate tectonics KW - Antarctica KW - Mozambique KW - Southern Africa KW - microplates KW - Georgia Basin KW - Africa KW - reconstruction KW - Mozambique Ridge KW - crust KW - mid-ocean ridges KW - African Plate KW - 18:Solid-earth geophysics KW - 12:Stratigraphy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52099100?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Tectonophysics&rft.atitle=An+Early+Cretaceous+extinct+spreading+center+in+the+northern+Natal+Valley&rft.au=Tikku%2C+Anahita+A%3BMarks%2C+Karen+M%3BKovacs%2C+Louis+C&rft.aulast=Tikku&rft.aufirst=Anahita&rft.date=2002-03-01&rft.volume=347&rft.issue=1-3&rft.spage=87&rft.isbn=&rft.btitle=&rft.title=Tectonophysics&rft.issn=00401951&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00401951 LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 1999 spring meeting, Antarctic Digital Magnetic Anomaly Project (ADMAP) workshop III N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 55 N1 - Document feature - illus. incl. 1 table, sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - TCTOAM N1 - SubjectsTermNotLitGenreText - Africa; African Plate; Antarctica; Cretaceous; crust; East Africa; extension; faults; Georgia Basin; Gondwana; KwaZulu-Natal South Africa; Lower Cretaceous; magnetic anomalies; Mesozoic; microplates; mid-ocean ridges; Mozambique; Mozambique Ridge; ocean floors; oceanic crust; plate tectonics; Queen Maud Land; reconstruction; sea-floor spreading; South Africa; Southern Africa; spreading centers; strike-slip faults; transform faults ER - TY - JOUR T1 - A new magnetic map of the Weddell Sea and the Antarctic Peninsula AN - 52099060; 2002-046079 AB - As part of the Antarctic Digital Magnetic Mapping Project (ADMAP) workers from VNIIOkeangeologia (Russia), the British Antarctic Survey (UK) and the Naval Research Laboratory (USA) have brought together almost all of the available magnetic data in the area 0-120 degrees W, 60-90 degrees S. The final map covers the whole Weddell Sea and adjacent land areas, the Antarctic Peninsula and the seas to the west, an area comparable in size with that of the USA. This paper describes the methods used during the compilation of the map and reviews briefly some of the main features shown on it. Distinct magnetic provinces are associated with Precambrian rocks of the East Antarctic craton, highly extended continental crust in the Weddell Sea embayment, the arc batholith of the Antarctic Peninsula, and oceanic crust of the northern Weddell Sea, which was created as a direct consequence of South America-Antarctica plate motion and oceanic crust generated at the Pacific-Antarctic ridge. The magnetic anomaly map thus provides an overview of the fragmentation of south-western Gondwana and the tectonic development of the Weddell Sea sector of Antarctica. JF - Tectonophysics AU - Golynsky, A V AU - Morris, P AU - Kovacs, Louis C AU - Ferris, Julie K A2 - von Frese, Ralph R. B. A2 - Taylor, Patrick T. A2 - Chiappini, Massimo Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 3 EP - 11 PB - Elsevier, Amsterdam VL - 347 IS - 1-3 SN - 0040-1951, 0040-1951 KW - Southern Ocean KW - geophysical surveys KW - data handling KW - Antarctic Ocean KW - geophysical methods KW - data processing KW - magnetic methods KW - magnetic anomalies KW - international cooperation KW - mapping KW - East Antarctic Craton KW - cratons KW - Antarctic Peninsula KW - plate tectonics KW - Antarctica KW - ADMAP KW - surveys KW - Gondwana KW - Weddell Sea KW - crust KW - digitization KW - airborne methods KW - 18:Solid-earth geophysics KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52099060?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Tectonophysics&rft.atitle=A+new+magnetic+map+of+the+Weddell+Sea+and+the+Antarctic+Peninsula&rft.au=Golynsky%2C+A+V%3BMorris%2C+P%3BKovacs%2C+Louis+C%3BFerris%2C+Julie+K&rft.aulast=Golynsky&rft.aufirst=A&rft.date=2002-03-01&rft.volume=347&rft.issue=1-3&rft.spage=3&rft.isbn=&rft.btitle=&rft.title=Tectonophysics&rft.issn=00401951&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00401951 LA - English DB - GeoRef N1 - Conference title - American Geophysical Union 1999 spring meeting, Antarctic Digital Magnetic Anomaly Project (ADMAP) workshop III N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 37 N1 - Document feature - sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - TCTOAM N1 - SubjectsTermNotLitGenreText - ADMAP; airborne methods; Antarctic Ocean; Antarctic Peninsula; Antarctica; cratons; crust; data handling; data processing; digitization; East Antarctic Craton; geophysical methods; geophysical surveys; Gondwana; international cooperation; magnetic anomalies; magnetic methods; mapping; plate tectonics; Southern Ocean; surveys; Weddell Sea ER - TY - JOUR T1 - Surface roughness and slope measurements using polarimetric SAR data AN - 52072954; 2002-065820 AB - In this paper, the circular polarization coherence, rho (sub RRLL) , is investigated as a potential estimator of terrain surface roughness and small-scale slopes. The studies utilize microwave backscatter collected from 1) dielectric surfaces in an anechoic chamber and 2) a desert test site using P-, L-, and C-band NASA/JPL AIRSAR data. These experimental studies and supporting theory, indicate a sensitive decrease of rho (sub RRLL) with increasing surface roughness ks over a range 0 < or = ks < or = 1. For the present studies this decrease is caused largely by the depolarizing effects of small-scale surface slopes in the azimuth direction rather than by volume, or multiple scatter. For cases when the scatter is reflection symmetric, the value of rho (sub RRLL) depends on the surface roughness and on the local incidence angle. The dependence of rho (sub RRLL) on the local incidence angle is supported by theory and experimental results. For these same scattering cases, however, rho (sub RRLL) is independent of the surface dielectric constant. Estimation of the functional dependency of rho (sub RRLL) versus ks, for a mid-range incidence angle, has been carried out using roughness estimates derived from an empirical model. Further studies, involving more incidence angles, are required to develop a complete model to invert the data. Additional results show that the Re (sub [rho RRLL]) is often preferable over rho (sub RRLL) as a roughness estimator when scatter occurs from vegetated areas. A comparison between Re (sub [rho PRRLL]) and a related polarimetric parameter, the anisotropy A, indicates that for scatter having ks < or = 0.5, Re (sub [rho RRLL]) is a more sensitive estimator of surface roughness. JF - IEEE Transactions on Geoscience and Remote Sensing AU - Schuler, Dale L AU - Lee, Jong-Sen AU - Kasilingam, Dayalan AU - Nesti, Giuseppe Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 687 EP - 698 PB - IEEE Geoscience and Remote Sensing Society, New York, NY VL - 40 IS - 3 SN - 0196-2892, 0196-2892 KW - soils KW - surface properties KW - polarization KW - slopes KW - roughness KW - geophysical methods KW - radar methods KW - surficial geology KW - mathematical models KW - digital terrain models KW - measurement KW - microwave methods KW - topography KW - SAR KW - dielectric properties KW - surface features KW - electromagnetic methods KW - accuracy KW - anisotropy KW - airborne methods KW - 23:Geomorphology KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52072954?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Seasonal+succession+of+the+PAH-mineralizing+bacteria+in+creosote-impacted+intertidal+sediments&rft.au=Montgomery%2C+M+T%3BSmith%2C+D+C%3BMueller%2C+J+G%3BBoyd%2C+T+J&rft.aulast=Montgomery&rft.aufirst=M&rft.date=2002-03-15&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ L2 - http://ieeexplore.ieee.org/xpl/tocresult.jsp?isYear=2009&isnumber=5332062&Submit32=View+Contents LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 29 N1 - PubXState - NY N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - CODEN - IEGEAO N1 - SubjectsTermNotLitGenreText - accuracy; airborne methods; anisotropy; dielectric properties; digital terrain models; electromagnetic methods; geophysical methods; mathematical models; measurement; microwave methods; polarization; radar methods; roughness; SAR; slopes; soils; surface features; surface properties; surficial geology; topography ER - TY - JOUR T1 - Seasonal succession of the PAH-mineralizing bacteria in creosote-impacted intertidal sediments AN - 51713709; 2005-043615 JF - Annual West Coast Conference on Contaminated Soils, Sediments, and Water - Abstracts and Supplemental Information AU - Montgomery, Michael T AU - Smith, David C AU - Osburn, Chris L AU - Mueller, James G AU - Boyd, Thomas J AU - Kostecki, Paul T AU - Calabrese, Edward J AU - Bartell, Brenna Y1 - 2002/03// PY - 2002 DA - March 2002 PB - Association for Environmental Health and Sciences, Naval Facilities Engineering Command, San Diego, CA VL - 12 KW - concentration KW - biodegradation KW - marshes KW - naphthalene KW - creosote KW - pollution KW - rhizosphere KW - ecosystems KW - nearshore environment KW - carbon dioxide KW - phenanthrene KW - organic compounds KW - mires KW - intertidal environment KW - bacteria KW - sediments KW - hydrocarbons KW - polycyclic aromatic hydrocarbons KW - coastal environment KW - risk assessment KW - seasonal variations KW - aromatic hydrocarbons KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51713709?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annual+West+Coast+Conference+on+Contaminated+Soils%2C+Sediments%2C+and+Water+-+Abstracts+and+Supplemental+Information&rft.atitle=Seasonal+succession+of+the+PAH-mineralizing+bacteria+in+creosote-impacted+intertidal+sediments&rft.au=Montgomery%2C+Michael+T%3BSmith%2C+David+C%3BOsburn%2C+Chris+L%3BMueller%2C+James+G%3BBoyd%2C+Thomas+J%3BKostecki%2C+Paul+T%3BCalabrese%2C+Edward+J%3BBartell%2C+Brenna&rft.aulast=Montgomery&rft.aufirst=Michael&rft.date=2002-03-01&rft.volume=12&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Annual+West+Coast+Conference+on+Contaminated+Soils%2C+Sediments%2C+and+Water+-+Abstracts+and+Supplemental+Information&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Twelfth annual west coast conference on Contaminated soils, sediments, and water N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2005-01-01 N1 - PubXState - CA N1 - Last updated - 2012-06-07 N1 - CODEN - #06120 N1 - SubjectsTermNotLitGenreText - aromatic hydrocarbons; bacteria; biodegradation; carbon dioxide; coastal environment; concentration; creosote; ecosystems; hydrocarbons; intertidal environment; marshes; mires; naphthalene; nearshore environment; organic compounds; phenanthrene; pollution; polycyclic aromatic hydrocarbons; rhizosphere; risk assessment; seasonal variations; sediments ER - TY - JOUR T1 - Analysis of methane hydrate formation AN - 51703966; 2005-046936 AB - Methane hydrates are abundant in many regions of the world coastal ocean sediment. International research has commenced with a primary goal to obtain the methane in these hydrates as an energy source. Methane in hydrates originates from geothermal and biogenic sources. Characteristically the geothermal methane is associated with other gases ranging from ethane to hexane, while biogenic methane is 99% methane without the presence of heavy gases. As a result there is a difference in the hydrate structure during formation, where biogenic methane forms with structure I and thermogenic gases forms with structure II. Understanding the sources of the gas will provide necessary information for the approach to gas mining, gas purification and hydrate stability. Carbon isotope analysis is being used in hydrates and related carbon pools to show the variation in methane sources at different regions. Data from the Haakon-Mosby Mud Volcano in the Norwegian-Greenland Sea, Texas-Louisiana Shelf in the Gulf of Mexico, and the Cascadia Margin in the Pacific Ocean will be presented. Comparisons of stable and radio carbon isotope analyses from the different regions will be provided for methane in the hydrates, organic matter in sediments, carbonate in the sediments, and phospholipids extracted from the bacterial assemblage. JF - Annual Meeting Expanded Abstracts - American Association of Petroleum Geologists AU - Coffin, Richard B AU - Pohlman, John W AU - Grabowski, Kenneth S AU - Knies, David L AU - Anonymous Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 33 PB - American Association of Petroleum Geologists and Society of Economic Paleontologists and Mineralogists (AAPG), Tulsa, OK VL - 2002 SN - 0094-0038, 0094-0038 KW - hydrates KW - resources KW - methane KW - gas hydrates KW - isotopes KW - aliphatic hydrocarbons KW - petroleum KW - Norwegian Sea KW - alkanes KW - Gulf of Mexico KW - genesis KW - organic compounds KW - marine sediments KW - biogenic processes KW - geothermal systems KW - carbon KW - Pacific Ocean KW - sediments KW - hydrocarbons KW - Arctic Ocean KW - North Atlantic KW - chemical composition KW - Atlantic Ocean KW - 29A:Economic geology, geology of energy sources UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51703966?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annual+Meeting+Expanded+Abstracts+-+American+Association+of+Petroleum+Geologists&rft.atitle=Analysis+of+methane+hydrate+formation&rft.au=Coffin%2C+Richard+B%3BPohlman%2C+John+W%3BGrabowski%2C+Kenneth+S%3BKnies%2C+David+L%3BAnonymous&rft.aulast=Coffin&rft.aufirst=Richard&rft.date=2002-03-01&rft.volume=2002&rft.issue=&rft.spage=33&rft.isbn=&rft.btitle=&rft.title=Annual+Meeting+Expanded+Abstracts+-+American+Association+of+Petroleum+Geologists&rft.issn=00940038&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - AAPG annual convention with SEPM N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by American Association of Petroleum Geologists, Tulsa, OK, United States N1 - Date revised - 2005-01-01 N1 - PubXState - OK N1 - Last updated - 2012-06-07 N1 - CODEN - APGAB2 N1 - SubjectsTermNotLitGenreText - aliphatic hydrocarbons; alkanes; Arctic Ocean; Atlantic Ocean; biogenic processes; carbon; chemical composition; gas hydrates; genesis; geothermal systems; Gulf of Mexico; hydrates; hydrocarbons; isotopes; marine sediments; methane; North Atlantic; Norwegian Sea; organic compounds; Pacific Ocean; petroleum; resources; sediments ER - TY - JOUR T1 - Seismic modeling of near vertical heat and fluid flux conduits in the methane hydrate stability zone AN - 51652113; 2005-063266 AB - The distribution of natural methane hydrate in marine sediments is very likely controlled by near vertical fluid flux which concentrates biogenic or thermogenic methane in shallow (<500 m) sediments. When great enough, this flux perturbs the base of the methane hydrate stability field allowing gas to exist at shallower depths in the sediments than would be possible with no flux. The presence of gas, combined with offset in reflectors if the conduit is a fault, allows the detection of these conduits with the reflection seismic technique. However, the detection is problematic for conventional surface-towed systems due to the small size of many of these features (10's of meters wide), and their near vertical orientation. Numerical and physical modeling of the acoustic impedance contrasts associated with the conduits shows the significant sensitivity of the seismic response over these features to not only the frequency content, but also the proximity of the seismic source and receivers to the conduit. JF - Annual Meeting Expanded Abstracts - American Association of Petroleum Geologists AU - Wood, Warren T AU - Gettrust, Joseph F AU - Anonymous Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 192 PB - American Association of Petroleum Geologists and Society of Economic Paleontologists and Mineralogists (AAPG), Tulsa, OK VL - 2002 SN - 0094-0038, 0094-0038 KW - petroleum exploration KW - gas hydrates KW - natural gas KW - aliphatic hydrocarbons KW - petroleum KW - fluid phase KW - seepage KW - acoustical methods KW - marine sediments KW - heat flow KW - movement KW - sediments KW - faults KW - impedance KW - migration KW - methane KW - heat flux KW - geophysical methods KW - reflection methods KW - alkanes KW - seismic methods KW - models KW - organic compounds KW - biogenic processes KW - hydrocarbons KW - 29A:Economic geology, geology of energy sources KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51652113?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annual+Meeting+Expanded+Abstracts+-+American+Association+of+Petroleum+Geologists&rft.atitle=Seismic+modeling+of+near+vertical+heat+and+fluid+flux+conduits+in+the+methane+hydrate+stability+zone&rft.au=Wood%2C+Warren+T%3BGettrust%2C+Joseph+F%3BAnonymous&rft.aulast=Wood&rft.aufirst=Warren&rft.date=2002-03-01&rft.volume=2002&rft.issue=&rft.spage=192&rft.isbn=&rft.btitle=&rft.title=Annual+Meeting+Expanded+Abstracts+-+American+Association+of+Petroleum+Geologists&rft.issn=00940038&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - AAPG annual convention with SEPM N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by American Association of Petroleum Geologists, Tulsa, OK, United States N1 - Date revised - 2005-01-01 N1 - PubXState - OK N1 - Last updated - 2012-06-07 N1 - CODEN - APGAB2 N1 - SubjectsTermNotLitGenreText - acoustical methods; aliphatic hydrocarbons; alkanes; biogenic processes; faults; fluid phase; gas hydrates; geophysical methods; heat flow; heat flux; hydrocarbons; impedance; marine sediments; methane; migration; models; movement; natural gas; organic compounds; petroleum; petroleum exploration; reflection methods; sediments; seepage; seismic methods ER - TY - JOUR T1 - Sedimentation rates from Milankovitch periodicity in log and GRA bulk density records off Southwest Africa, sites 1081, 1082, and 1084 AN - 50494387; 2002-040466 JF - Proceedings of the Ocean Drilling Program, Scientific Results (CD ROM) AU - Gorgas, Thomas J AU - Kronen, J D, Jr AU - Wilkens, Roy H AU - Adams, Donald D AU - Anderson, Linda Davis AU - Andreasen, Dyke J AU - Bruechert, Volker AU - Cambray, Herve AU - Christensen, Beth A AU - Frost, Gina Marie AU - Giraudeau, Jacques AU - Hermelin, J Otto R AU - Jansen, J H Fred AU - Lange, Carina Beatriz AU - Laser, Bernd AU - Lin, Hui-Ling AU - Maslin, Mark A AU - Meyers, Philip A AU - Motoyama, Isao AU - Murray, Richard W AU - Perez, Maria Elena AU - Pufahl, Peir Kenneth AU - Spiess, Volkhard AU - Vidal, Laurence AU - Wigley, Rochelle AU - Yamazaki, Toshitsugu A2 - Berger, Wolfgang H. A2 - Wefer, Gerold A2 - Richter, Carl Y1 - 2002/03// PY - 2002 DA - March 2002 SP - 23 PB - Texas A&M University, Ocean Drilling Program, College Station, TX VL - 175 SN - 1096-2514, 1096-2514 KW - cycles KW - obliquity of the ecliptic KW - ODP Site 1084 KW - ODP Site 1081 KW - ODP Site 1082 KW - data processing KW - paleo-oceanography KW - paleoclimatology KW - upper Neogene KW - variations KW - eccentricity KW - Cenozoic KW - sedimentation rates KW - Fourier analysis KW - continental margin sedimentation KW - autocorrelation KW - gamma-ray spectra KW - spectra KW - depositional environment KW - continental margin KW - bulk density KW - Quaternary KW - statistical analysis KW - sedimentation KW - precession KW - Leg 175 KW - Tertiary KW - Southeast Atlantic KW - Neogene KW - Southern Africa KW - Milankovitch theory KW - Africa KW - South Atlantic KW - Ocean Drilling Program KW - Atlantic Ocean KW - 12:Stratigraphy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50494387?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Proceedings+of+the+Ocean+Drilling+Program%2C+Scientific+Results+%28CD+ROM%29&rft.atitle=Sedimentation+rates+from+Milankovitch+periodicity+in+log+and+GRA+bulk+density+records+off+Southwest+Africa%2C+sites+1081%2C+1082%2C+and+1084&rft.au=Gorgas%2C+Thomas+J%3BKronen%2C+J+D%2C+Jr%3BWilkens%2C+Roy+H%3BAdams%2C+Donald+D%3BAnderson%2C+Linda+Davis%3BAndreasen%2C+Dyke+J%3BBruechert%2C+Volker%3BCambray%2C+Herve%3BChristensen%2C+Beth+A%3BFrost%2C+Gina+Marie%3BGiraudeau%2C+Jacques%3BHermelin%2C+J+Otto+R%3BJansen%2C+J+H+Fred%3BLange%2C+Carina+Beatriz%3BLaser%2C+Bernd%3BLin%2C+Hui-Ling%3BMaslin%2C+Mark+A%3BMeyers%2C+Philip+A%3BMotoyama%2C+Isao%3BMurray%2C+Richard+W%3BPerez%2C+Maria+Elena%3BPufahl%2C+Peir+Kenneth%3BSpiess%2C+Volkhard%3BVidal%2C+Laurence%3BWigley%2C+Rochelle%3BYamazaki%2C+Toshitsugu&rft.aulast=Gorgas&rft.aufirst=Thomas&rft.date=2002-03-01&rft.volume=175&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Proceedings+of+the+Ocean+Drilling+Program%2C+Scientific+Results+%28CD+ROM%29&rft.issn=10962514&rft_id=info:doi/10.2973%2Fodp.proc.sr.175.208.2001 L2 - http://www-odp.tamu.edu/publications/175_SR/chap_09/chap_09.htm http://www-odp.tamu.edu/publications/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 25 N1 - PubXState - TX N1 - Document feature - illus. incl. sketch map N1 - SuppNotes - Data report; available only on CD-ROM in PDF format and on the Web in PDF or HTML; CD-ROM format, ISSN 1096-2514; WWW format, ISSN 1096-7451 N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Africa; Atlantic Ocean; autocorrelation; bulk density; Cenozoic; continental margin; continental margin sedimentation; cycles; data processing; depositional environment; eccentricity; Fourier analysis; gamma-ray spectra; Leg 175; Milankovitch theory; Neogene; obliquity of the ecliptic; Ocean Drilling Program; ODP Site 1081; ODP Site 1082; ODP Site 1084; paleo-oceanography; paleoclimatology; precession; Quaternary; sedimentation; sedimentation rates; South Atlantic; Southeast Atlantic; Southern Africa; spectra; statistical analysis; Tertiary; upper Neogene; variations DO - http://dx.doi.org/10.2973/odp.proc.sr.175.208.2001 ER - TY - JOUR T1 - Finite-Volume Model for Shallow-Water Flooding of Arbitrary Topography AN - 18560619; 5343795 AB - A model based on the finite-volume method is developed for unsteady, two-dimensional, shallow-water flow over arbitrary topography with moving lateral boundaries caused by flooding or recession. The model uses Roe's approximate Riemann solver to compute fluxes, while the monotone upstream scheme for conservation laws and predictor-corrector time stepping are used to provide a second-order accurate solution that is free from spurious oscillations. A robust, novel procedure is presented to efficiently and accurately simulate the movement of a wet/dry boundary without diffusing it. In addition, a new technique is introduced to prevent numerical truncation errors due to the pressure and bed slope terms from artificially accelerating quiescent water over an arbitrary bed. Model predictions compare favorably with analytical solutions, experimental data, and other numerical solutions for one- and two-dimensional problems. JF - Journal of Hydraulic Engineering AU - Bradford, S F AU - Sanders, B F AD - Image Science and Applications Branch, Naval Research Laboratory, Washington DC 20375, USA Y1 - 2002/03// PY - 2002 DA - Mar 2002 SP - 289 EP - 298 VL - 128 IS - 3 SN - 0733-9429, 0733-9429 KW - Meteorological & Geoastrophysical Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Aqualine Abstracts; Water Resources Abstracts KW - Q2 02162:Methods and instruments KW - SW 0835:Streamflow and runoff KW - M2 556.16:Runoff (556.16) KW - SW 6030:Hydraulic machinery KW - AQ 00003:Monitoring and Analysis of Water and Wastes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18560619?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Hydraulic+Engineering&rft.atitle=Finite-Volume+Model+for+Shallow-Water+Flooding+of+Arbitrary+Topography&rft.au=Bradford%2C+S+F%3BSanders%2C+B+F&rft.aulast=Bradford&rft.aufirst=S&rft.date=2002-03-01&rft.volume=128&rft.issue=3&rft.spage=289&rft.isbn=&rft.btitle=&rft.title=Journal+of+Hydraulic+Engineering&rft.issn=07339429&rft_id=info:doi/10.1061%2F%28ASCE%290733-9429%282002%29128%3A3%28289%29 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 DO - http://dx.doi.org/10.1061/(ASCE)0733-9429(2002)128:3(289) ER - TY - JOUR T1 - The West's Moral Obligation to Assist Developing Nations in the Fight Against HIV/AIDS AN - 1257737347; 17028984 AB - The HIV/AIDS epidemic is increasingly a diseaseof the disadvantaged, a destroyer of nations,and a threat to global security and well-being.But this need not be so: the world has thescientific knowledge, technologicalinnovations, and financial resources tosignificantly reduce the spread and sufferingcaused by the disease. This paper argues thatthe wealthy nations of the world, led by theUnited States, have a moral obligation to offermuch greater assistance to developing countrieswhere the epidemic is most severe. UsingZimbabwe as a case study, this essay examinesthe immediate and underlying factors behind theepidemic in order to make realistic andaffordable policy recommendations that includenew investments in global health care, debtrelief, and long-term economic development. Bydemonstrating our ability to dramaticallyaffect the future course and consequences ofthis unprecedented epidemic, the paperconcludes that greater action is not only inthe interest of public health, but is also amoral imperative. By investing the necessaryresources to improve public health and toreduce global poverty, we promote and extendthe fundamental rights and values that weprofess to hold dear. JF - Health Care Analysis AU - Nelson, Samuel H AD - History Department, U.S. Naval Academy, U.S. Naval Academy, Annapolis, MD, 21402, U.S.A. Y1 - 2002/03// PY - 2002 DA - Mar 2002 SP - 87 EP - 108 PB - Springer Science+Business Media, Van Godewijckstraat 30 Dordrecht 3311 GX Netherlands VL - 10 IS - 1 SN - 1065-3058, 1065-3058 KW - Virology & AIDS Abstracts; Health & Safety Science Abstracts KW - Rights KW - Acquired immune deficiency syndrome KW - Epidemics KW - Economic development KW - Development KW - Public health KW - Security KW - Case studies KW - Health care KW - Human immunodeficiency virus KW - Ethics KW - Economics KW - Developing countries KW - V 22360:AIDS and HIV KW - H 11000:Diseases/Injuries/Trauma UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1257737347?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Health+Care+Analysis&rft.atitle=The+West%27s+Moral+Obligation+to+Assist+Developing+Nations+in+the+Fight+Against+HIV%2FAIDS&rft.au=Nelson%2C+Samuel+H&rft.aulast=Nelson&rft.aufirst=Samuel&rft.date=2002-03-01&rft.volume=10&rft.issue=1&rft.spage=87&rft.isbn=&rft.btitle=&rft.title=Health+Care+Analysis&rft.issn=10653058&rft_id=info:doi/10.1023%2FA%3A1015622531388 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2012-12-01 N1 - Last updated - 2013-09-09 N1 - SubjectsTermNotLitGenreText - Acquired immune deficiency syndrome; Epidemics; Ethics; Economics; Development; Public health; Security; Rights; Case studies; Health care; Human immunodeficiency virus; Economic development; Developing countries DO - http://dx.doi.org/10.1023/A:1015622531388 ER - TY - JOUR T1 - ATMOS version 3 water vapor measurements: Comparisons with observations from two ER-2 Lyman- alpha hygrometers, MkIV, HALOE, SAGE II, MAS, and MLS AN - 1665493627; 5379707 AB - We have compared a new version of Atmospheric Trace Molecule Spectroscopy Experiment (ATMOS) retrievals (version 3) of stratospheric and mesospheric water vapor with observations from shuttleborne, satelliteborne, balloonborne, and aircraftborne instruments. These retrievals show agreement to within 5% with the MkIV observations in the middle and lower stratosphere. ATMOS agrees with the National Oceanic and Atmospheric Administration (NOAA) Lyman- alpha hygrometer to within 5% except for features with spatial scales less than the vertical resolution of ATMOS (such as the lower stratospheric seasonal cycle). ATMOS observations are 10-16% lower than measurements from the Harvard Lyman- alpha hygrometer in the lower stratosphere and are 7-14% higher than those from the Microwave Limb Sounder (MLS; prototype version 0104) throughout most of the stratosphere. Agreement is within 7% with the Millimeter-Wave Atmospheric Sounder (MAS; version 20) in the middle and upper stratosphere, but differences are closer to 13% in the lower stratosphere. Throughout the stratosphere, agreement is within 8% with the Halogen Occultation Experiment (HALOE; version 19). ATMOS data from 1994 show agreement with the Stratospheric Aerosol and Gas Experiment II (SAGE II; version 6) values to within 8% in the middle stratosphere, but ATMOS observations are systematically higher than those from SAGE II by as much as 41% in the lower stratosphere. In contrast, ATMOS 1985 values are systematically similar to 50% lower than SAGE II values from sunset occultations in the lower stratosphere near 70 hPa but appear to be in better agreement with sunrise occultations. Version 3 retrievals in the upper stratosphere and lower mesosphere are typically 5-10% lower than version 2 values between 1 and 0.05 hPa. This reduction improves agreement with HALOE, MAS, and MLS upper atmospheric observations, but ATMOS values still tend to be higher than values from these instruments in the middle mesosphere. Agreement among the instruments compared here (except for SAGE II) is generally within 15% in the middle to lower stratosphere and mesosphere and within 10% in the middle to upper stratosphere. At altitudes near 30 km, all instruments (including SAGE II) agree to within 10%. JF - Journal of Geophysical Research. D. Atmospheres AU - Michelsen, HA AU - Manney, G L AU - Irion, F W AU - Toon, G C AU - Gunson, M R AU - Rinsland, C P AU - Zander, R AU - Mahieu, E AU - Newchurch, MJ AU - Purcell, P N AU - Remsberg, EE AU - Russell, JM III AU - Pumphrey, H C AU - Waters, J W AD - Code 7220, Naval Research Laboratory, Washington, DC 20375, USA, bevilacq@poamb.nrl.navy.mil Y1 - 2002/02/16/ PY - 2002 DA - 2002 Feb 16 PB - American Geophysical Union, 2000 Florida Ave., N.W. Washington, DC 20009 USA, [mailto:cust--ser@kosmos.agu.org] VL - 107 IS - D3 SN - 0148-0227, 0148-0227 KW - Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts KW - Citation No. 4027 KW - Water vapor measurements KW - Mesospheric water vapor derived from satellites KW - Stratospheric water vapor measurement techniques KW - Lyman-alpha hygrometer KW - M2 551.510.53:Stratosphere (551.510.53) KW - M2 551.501.77:Methods of observation and computation of moisture [Unknown expansion] (551.501.77) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/1665493627?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research.+D.+Atmospheres&rft.atitle=ATMOS+version+3+water+vapor+measurements%3A+Comparisons+with+observations+from+two+ER-2+Lyman-+alpha+hygrometers%2C+MkIV%2C+HALOE%2C+SAGE+II%2C+MAS%2C+and+MLS&rft.au=Michelsen%2C+HA%3BManney%2C+G+L%3BIrion%2C+F+W%3BToon%2C+G+C%3BGunson%2C+M+R%3BRinsland%2C+C+P%3BZander%2C+R%3BMahieu%2C+E%3BNewchurch%2C+MJ%3BPurcell%2C+P+N%3BRemsberg%2C+EE%3BRussell%2C+JM+III%3BPumphrey%2C+H+C%3BWaters%2C+J+W&rft.aulast=Michelsen&rft.aufirst=HA&rft.date=2002-02-16&rft.volume=107&rft.issue=D3&rft.spage=%5Bna%5D&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research.+D.+Atmospheres&rft.issn=01480227&rft_id=info:doi/10.1029%2F2001JD000587 LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Water vapor measurements; Mesospheric water vapor derived from satellites; Stratospheric water vapor measurement techniques; Lyman-alpha hygrometer DO - http://dx.doi.org/10.1029/2001JD000587 ER - TY - JOUR T1 - Acupuncture for xerostomia: clinical update. AN - 71550821; 11920486 AB - In the authors' clinic, patients with xerostomia after radiation therapy for malignancy have been offered acupuncture as potential palliation of their symptoms since November 1999. Preliminary data revealed that many patients achieve relief, even for symptoms refractory to pilocarpine therapy. Acupuncture technique has been refined since the authors' previous publication. Originally described as a two-step process, a single treatment with eight needles is now used. Three points are treated in each ear, and one in the radial aspect of each index finger. Patients are also provided a sugar-free lozenge in the mouth to further stimulate salivation. Response is measured by the xerostomia inventory (XI). Fifty patients have undergone 318 treatments (median, 5; range, 2-15 treatments). Median follow-up since the first treatment is 224 days (range, 9-455 days). Median palliation as described by the XI was 9 points (range, 0-25 points). Response (defined as improvement of 10% or better over baseline XI values) occurred in 35 patients (70%). Twenty-four patients (48%) have received benefit of 10 points or greater on the XI. Duration of effect for 13 patients (26%) has exceeded 3 months. Acupuncture palliates xerostomia for many patients. A regimen of three to four weekly treatments followed by monthly sessions is now recommended, although some patients achieve lasting response without further therapy. Copyright 2002 American Cancer Society. DOI 10.1002/cncr.10348 JF - Cancer AU - Johnstone, Peter A S AU - Niemtzow, Richard C AU - Riffenburgh, Robert H AD - Radiation Oncology Service, Naval Medical Center, San Diego, California 92134-1014, USA. pajohnstone@nmcsd.navy.mil Y1 - 2002/02/15/ PY - 2002 DA - 2002 Feb 15 SP - 1151 EP - 1156 VL - 94 IS - 4 SN - 0008-543X, 0008-543X KW - Abridged Index Medicus KW - Index Medicus KW - Aged, 80 and over KW - Humans KW - Adult KW - Treatment Outcome KW - Retrospective Studies KW - Palliative Care KW - Aged KW - Middle Aged KW - Male KW - Female KW - Xerostomia -- etiology KW - Xerostomia -- therapy KW - Acupuncture Therapy -- methods KW - Radiotherapy -- adverse effects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71550821?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Cancer&rft.atitle=Acupuncture+for+xerostomia%3A+clinical+update.&rft.au=Johnstone%2C+Peter+A+S%3BNiemtzow%2C+Richard+C%3BRiffenburgh%2C+Robert+H&rft.aulast=Johnstone&rft.aufirst=Peter+A&rft.date=2002-02-15&rft.volume=94&rft.issue=4&rft.spage=1151&rft.isbn=&rft.btitle=&rft.title=Cancer&rft.issn=0008543X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-04-15 N1 - Date created - 2002-03-28 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - A wide angle and high Mach number parabolic equation. AN - 85358657; pmid-11865817 AB - Various parabolic equations for advected acoustic waves have been derived based on the assumptions of small Mach number and narrow propagation angles, which are of limited validity in atmospheric acoustics. A parabolic equation solution that does not require these assumptions is derived in the weak shear limit, which is appropriate for frequencies of about 0.1 Hz and above for atmospheric acoustics. When the variables are scaled appropriately in this limit, terms involving derivatives of the sound speed, density, and wind speed are small but can have significant cumulative effects. To obtain a solution that is valid at large distances from the source, it is necessary to account for linear terms in the first derivatives of these quantities [A. D. Pierce, J. Acoust. Soc. Am. 87, 2292-2299 (1990)]. This approach is used to obtain a scalar wave equation for advected waves. Since this equation contains two depth operators that do not commute with each other, it does not readily factor into outgoing and incoming solutions. An approximate factorization is obtained that is correct to first order in the commutator of the depth operators. JF - The Journal of the Acoustical Society of America AU - Lingevitch, Joseph F AU - Collins, Michael D AU - Dacol, Dalcio K AU - Drob, Douglas P AU - Rogers, Joel C W AU - Siegmann, William L AD - Naval Research Laboratory, Washington, DC 20375, USA. Y1 - 2002/02// PY - 2002 DA - Feb 2002 SP - 729 EP - 734 VL - 111 IS - 2 SN - 0001-4966, 0001-4966 KW - Index Medicus KW - National Library of Medicine KW - *Acoustics KW - Atmosphere KW - *Models, Theoretical UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85358657?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=A+wide+angle+and+high+Mach+number+parabolic+equation.&rft.au=Lingevitch%2C+Joseph+F%3BCollins%2C+Michael+D%3BDacol%2C+Dalcio+K%3BDrob%2C+Douglas+P%3BRogers%2C+Joel+C+W%3BSiegmann%2C+William+L&rft.aulast=Lingevitch&rft.aufirst=Joseph&rft.date=2002-02-01&rft.volume=111&rft.issue=2&rft.spage=729&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Integrating waveguide biosensor. AN - 85236824; pmid-11838701 AB - A capillary biosensor is demonstrated which uses the waveguiding properties of the capillary to integrate the signal over an increased surface area without simultaneously increasing the background noise from the detector. This biosensor achieves limits of detection of 30-50 pg/mL in immunoassays using a diode laser for excitation and a PMT for detection. This is approximately 2 orders of magnitude greater sensitivity than was achieved using the same immunoassay reagents in a fiber optic biosensor or a planar array biosensor. Two different approaches to using the capillaries as immunosensors are described, either of which could be adapted for multianalyte sensing. JF - Analytical Chemistry AU - Ligler, Frances S AU - Breimer Marc AU - Golden, Joel P AU - Nivens, Delana A AU - Dodson, James P AU - Green, Tiffanee M AU - Haders, Daniel P AU - Sadik, Omowunmi A AD - Center for Bio/Molecular Science & Engineering, Naval Research Laboratory, Washington, DC 20375-5348, USA. PY - 2002 SP - 713 EP - 719 VL - 74 IS - 3 SN - 0003-2700, 0003-2700 KW - Sensitivity and Specificity KW - Microchemistry KW - Animal KW - Proteins KW - Support, Non-U.S. Gov't KW - Support, U.S. Gov't, Non-P.H.S. KW - Lasers KW - Fiber Optics KW - Biosensing Techniques KW - Immunoassay UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85236824?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Analytical+Chemistry&rft.atitle=Integrating+waveguide+biosensor.&rft.au=Ligler%2C+Frances+S%3BBreimer+Marc%3BGolden%2C+Joel+P%3BNivens%2C+Delana+A%3BDodson%2C+James+P%3BGreen%2C+Tiffanee+M%3BHaders%2C+Daniel+P%3BSadik%2C+Omowunmi+A&rft.aulast=Ligler&rft.aufirst=Frances&rft.date=2002-02-01&rft.volume=74&rft.issue=3&rft.spage=713&rft.isbn=&rft.btitle=&rft.title=Analytical+Chemistry&rft.issn=00032700&rft_id=info:doi/ LA - eng DB - ComDisDome N1 - Last updated - 2010-05-07 ER - TY - JOUR T1 - Degradation of polycyclic aromatic hydrocarbons dissolved in Tween 80 surfactant solutions by Sphingomonas paucimobilis EPA 505. AN - 71616354; 11958568 AB - The degradation rates of mixtures of pyrene (PYR), fluoranthene (FLA), and phenanthrene (PHE) by Sphingomonas paucimobilis EPA 505 were measured in the presence of the nonionic surfactant Tween 80. For strain EPA 505, FLA and PHE are growth substrates, while PYR is not. Linear degradation rates ranging from 0.05 to 2.2 mg x L(-1) x h(-1) were observed for FLA, PYR, and PHE at approximately 10(7) colony-forming units (CFU)/mL. At lower biomass, PYR degradation exhibited lognormal degradation. The degradation rates of PYR, FLA, and PHE increased with increasing biomass and substrate concentration. At high FLA concentrations, FLA degradation rates were faster in the presence of surfactant than in the absence of surfactant, suggesting that some of the FLA was transported directly into the cell from the micellar phase. In mixtures, PHE was the preferred substrate and was utilized first, followed by FLA and then PYR. Once the competing substrates were degraded, the remaining substrate was degraded at the same rate or faster than the rate found in the single-substrate system. Based on the results with Tween 80, it appears that PHE, PYR, and FLA are competing for the same enzymatic sites. JF - Canadian journal of microbiology AU - Prak, Dianne J Luning AU - Pritchard, Parmely H AD - Naval Research Laboratory, Washington, DC 20357, USA. prak@usna.edu Y1 - 2002/02// PY - 2002 DA - February 2002 SP - 151 EP - 158 VL - 48 IS - 2 SN - 0008-4166, 0008-4166 KW - Fluorenes KW - 0 KW - Phenanthrenes KW - Polycyclic Compounds KW - Polysorbates KW - Pyrenes KW - Surface-Active Agents KW - fluoranthene KW - 360UOL779Z KW - phenanthrene KW - 448J8E5BST KW - pyrene KW - 9E0T7WFW93 KW - Index Medicus KW - Phenanthrenes -- metabolism KW - Solubility KW - Surface-Active Agents -- chemistry KW - Pyrenes -- metabolism KW - Polysorbates -- chemistry KW - Biodegradation, Environmental -- drug effects KW - Sphingomonas -- metabolism KW - Polycyclic Compounds -- metabolism UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71616354?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Canadian+journal+of+microbiology&rft.atitle=Degradation+of+polycyclic+aromatic+hydrocarbons+dissolved+in+Tween+80+surfactant+solutions+by+Sphingomonas+paucimobilis+EPA+505.&rft.au=Prak%2C+Dianne+J+Luning%3BPritchard%2C+Parmely+H&rft.aulast=Prak&rft.aufirst=Dianne+J&rft.date=2002-02-01&rft.volume=48&rft.issue=2&rft.spage=151&rft.isbn=&rft.btitle=&rft.title=Canadian+journal+of+microbiology&rft.issn=00084166&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-10-21 N1 - Date created - 2002-04-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Phase variation of Campylobacter jejuni 81-176 lipooligosaccharide affects ganglioside mimicry and invasiveness in vitro. AN - 71415255; 11796612 AB - The outer cores of the lipooligosaccharides (LOS) of many strains of Campylobacter jejuni mimic human gangliosides in structure. A population of cells of C. jejuni strain 81-176 produced a mixture of LOS cores which consisted primarily of structures mimicking GM(2) and GM(3) gangliosides, with minor amounts of structures mimicking GD(1b) and GD(2). Genetic analyses of genes involved in the biosynthesis of the outer core of C. jejuni 81-176 revealed the presence of a homopolymeric tract of G residues within a gene encoding CgtA, an N-acetylgalactosaminyltransferase. Variation in the number of G residues within cgtA affected the length of the open reading frame, and these changes in cgtA corresponded to a change in LOS structure from GM(2) to GM(3) ganglioside mimicry. Site-specific mutation of cgtA in 81-176 resulted in a major LOS core structure that lacked GalNAc and resembled GM(3) ganglioside. Compared to wild-type 81-176, the cgtA mutant showed a significant increase in invasion of INT407 cells. In comparison, a site-specific mutation of the neuC1 gene resulted in the loss of sialic acid in the LOS core and reduced resistance to normal human serum but had no affect on invasion of INT407 cells. JF - Infection and immunity AU - Guerry, Patricia AU - Szymanski, Christine M AU - Prendergast, Martina M AU - Hickey, Thomas E AU - Ewing, Cheryl P AU - Pattarini, Dawn L AU - Moran, Anthony P AD - Enteric Diseases Program, Naval Medical Research Center, Silver Spring, Maryland 20910, USA. guerryp@nmrc.navy.mil Y1 - 2002/02// PY - 2002 DA - February 2002 SP - 787 EP - 793 VL - 70 IS - 2 SN - 0019-9567, 0019-9567 KW - Antigens, Bacterial KW - 0 KW - Bacterial Proteins KW - DNA, Bacterial KW - G(M3) Ganglioside KW - Gangliosides KW - Lipopolysaccharides KW - lipid-linked oligosaccharides KW - ganglioside, GD1b KW - 19553-76-5 KW - G(M2) Ganglioside KW - 19600-01-2 KW - ganglioside, GD2 KW - 65988-71-8 KW - CgtA protein, bacteria KW - EC 3.6.1.- KW - Monomeric GTP-Binding Proteins KW - EC 3.6.5.2 KW - Index Medicus KW - Genes, Bacterial KW - Gene Expression KW - G(M2) Ganglioside -- chemistry KW - Sequence Analysis, DNA KW - Monomeric GTP-Binding Proteins -- genetics KW - Cloning, Molecular KW - Mutagenesis KW - Base Sequence KW - Spectrometry, Mass, Fast Atom Bombardment -- methods KW - Carbohydrate Sequence KW - G(M3) Ganglioside -- chemistry KW - Molecular Sequence Data KW - Campylobacter jejuni -- genetics KW - Genetic Variation KW - Gangliosides -- chemistry KW - Antigens, Bacterial -- analysis KW - Molecular Mimicry KW - Lipopolysaccharides -- analysis KW - Antigens, Bacterial -- genetics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71415255?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Infection+and+immunity&rft.atitle=Phase+variation+of+Campylobacter+jejuni+81-176+lipooligosaccharide+affects+ganglioside+mimicry+and+invasiveness+in+vitro.&rft.au=Guerry%2C+Patricia%3BSzymanski%2C+Christine+M%3BPrendergast%2C+Martina+M%3BHickey%2C+Thomas+E%3BEwing%2C+Cheryl+P%3BPattarini%2C+Dawn+L%3BMoran%2C+Anthony+P&rft.aulast=Guerry&rft.aufirst=Patricia&rft.date=2002-02-01&rft.volume=70&rft.issue=2&rft.spage=787&rft.isbn=&rft.btitle=&rft.title=Infection+and+immunity&rft.issn=00199567&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-02-21 N1 - Date created - 2002-01-17 N1 - Date revised - 2017-01-13 N1 - Genetic sequence - AF305571; GENBANK N1 - SuppNotes - Cited By: Infect Immun. 1997 Oct;65(10):4022-9 [9317002] Biochemistry. 1994 Jan 11;33(1):241-9 [8286348] Infect Immun. 1998 Mar;66(3):938-43 [9488379] Carbohydr Res. 1997 Dec;305(2):223-32 [9581276] Infect Immun. 1998 Aug;66(8):3649-55 [9673245] J Infect Dis. 1998 Nov;178(5):1549-51 [9780289] Mol Microbiol. 1998 Nov;30(4):767-75 [10094625] Infect Immun. 1999 Aug;67(8):4171-82 [10417189] J Biol Chem. 2000 Feb 11;275(6):3896-906 [10660542] Nature. 2000 Feb 10;403(6770):665-8 [10688204] Ann Neurol. 1994 Nov;36(5):791-3 [7526777] Mol Microbiol. 1994 Dec;14(5):883-93 [7715450] Mol Microbiol. 1995 Jun;16(5):847-53 [7476183] Infect Immun. 1996 Aug;64(8):2945-9 [8757818] Mol Microbiol. 2000 Mar;35(5):1120-34 [10712693] Infect Immun. 2000 Aug;68(8):4384-90 [10899834] Mol Microbiol. 2000 Aug;37(3):501-14 [10931344] Infect Immun. 2000 Dec;68(12):6656-62 [11083778] Mol Microbiol. 2001 May;40(3):769-77 [11359581] Proc Natl Acad Sci U S A. 1979 Apr;76(4):1648-52 [377280] J Bacteriol. 1983 Apr;154(1):269-77 [6187729] Infect Immun. 1984 Sep;45(3):544-9 [6432693] J Infect Dis. 1985 Feb;151(2):227-35 [3968449] J Infect Dis. 1985 Sep;152(3):592-6 [4031557] J Infect Dis. 1988 Mar;157(3):472-9 [3343522] Infect Immun. 1988 Apr;56(4):942-6 [3126149] J Bacteriol. 1990 Feb;172(2):949-55 [2404960] J Bacteriol. 1991 Jan;173(2):618-26 [1987154] Eur J Biochem. 1993 May 1;213(3):1017-27 [8240486] Eur J Biochem. 1993 May 1;213(3):1029-37 [8504799] Proc Natl Acad Sci U S A. 1993 Jul 15;90(14):6884-8 [8341714] Gene. 1993 Aug 16;130(1):127-30 [8344519] EMBO J. 1993 Nov;12(11):4043-51 [7693451] J Exp Med. 1993 Nov 1;178(5):1771-5 [8228822] Med Microbiol Immunol. 1997 Oct;186(2-3):159-66 [9403845] N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Sedimentation rates off SW Africa since the late Miocene deciphered from spectral analyses of borehole and GRA bulk density profiles; ODP sites 1081-1084 AN - 52128045; 2002-026682 AB - Sedimentation rates (SRs) off SW Africa were calculated by performing spectral analyses in the depth domain on borehole and gamma-ray attenuation (GRA) bulk density data from ODP Sites 1081-1084. Inversion and integration of SRs versus depth from spectral analysis yielded detailed SR profiles in the time domain. Our technique allowed the detection of excursions in calculated SRs that not only often differed from those established through coarse-scaled biostratigraphic data, but also revealed a greater regional variability in the sediment accumulation over time. High-resolution bulk density data exhibited distinct periodicity in the waveband of Milankovitch cycles (precession at 19-23 kyr; obliquity at 41 kyr; eccentricity at 100 kyr). The pronounced Milankovitch cyclicity suggests that climate variability and trends in SRs along the Benguela Current System (BCS) were responding to insolation patterns during the past 6 Myr. We find relatively low SRs when evolutive amplitude spectra are dominated by obliquity and eccentricity periods. In contrast, significant SR peaks at all sites often occur when strong precessional amplitudes coexist with obliquity and eccentricity cycles. Episodes of high SRs often coincide with peaks in organic carbon mass accumulation rates (MAR C (sub org) ) and reduced sea surface temperature (SST) in the southern Walvis Basin, which have been associated with increased regional upwelling. This suggests that the high SRs reflect high productivity (high MAR C (sub org) ) attributed to strong wind and upwelling intensity during cool climate periods (low SSTs) in accordance with orbital forcing patterns observed in our spectra. JF - Marine Geology AU - Gorgas, Thomas J AU - Wilkens, Roy H A2 - Christensen, Beth A. A2 - Giraudeau, Jacques Y1 - 2002/02// PY - 2002 DA - February 2002 SP - 29 EP - 47 PB - Elsevier, Amsterdam VL - 180 IS - 1-4 SN - 0025-3227, 0025-3227 KW - ODP Site 1083 KW - ODP Site 1084 KW - ODP Site 1081 KW - ODP Site 1082 KW - data processing KW - paleo-oceanography KW - paleocirculation KW - paleoclimatology KW - paleoecology KW - eccentricity KW - sedimentation rates KW - Fourier analysis KW - time domain analysis KW - ocean circulation KW - Quaternary KW - inverse problem KW - Leg 175 KW - Tertiary KW - Southern Africa KW - Milankovitch theory KW - insolation KW - Africa KW - South Atlantic KW - Ocean Drilling Program KW - Atlantic Ocean KW - upwelling KW - Cape Basin KW - obliquity of the ecliptic KW - density KW - orbital forcing KW - Cenozoic KW - Benguela Current KW - marine sediments KW - sediments KW - South Africa KW - climate forcing KW - productivity KW - currents KW - paleocurrents KW - gamma-ray methods KW - well logs KW - sedimentation KW - ocean currents KW - boreholes KW - Southeast Atlantic KW - Neogene KW - periodicity KW - sea-surface temperature KW - 12:Stratigraphy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52128045?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Sedimentation+rates+off+SW+Africa+since+the+late+Miocene+deciphered+from+spectral+analyses+of+borehole+and+GRA+bulk+density+profiles%3B+ODP+sites+1081-1084&rft.au=Gorgas%2C+Thomas+J%3BWilkens%2C+Roy+H&rft.aulast=Gorgas&rft.aufirst=Thomas&rft.date=2002-02-01&rft.volume=180&rft.issue=1-4&rft.spage=29&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00253227 LA - English DB - GeoRef N1 - Conference title - Evolution of major upwelling systems , American Geophysical Union 1999 fall meeting N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2002-01-01 N1 - Number of references - 63 N1 - Document feature - illus. incl. sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - MAGEA6 N1 - SubjectsTermNotLitGenreText - Africa; Atlantic Ocean; Benguela Current; boreholes; Cape Basin; Cenozoic; climate forcing; currents; data processing; density; eccentricity; Fourier analysis; gamma-ray methods; insolation; inverse problem; Leg 175; marine sediments; Milankovitch theory; Neogene; obliquity of the ecliptic; ocean circulation; ocean currents; Ocean Drilling Program; ODP Site 1081; ODP Site 1082; ODP Site 1083; ODP Site 1084; orbital forcing; paleo-oceanography; paleocirculation; paleoclimatology; paleocurrents; paleoecology; periodicity; productivity; Quaternary; sea-surface temperature; sedimentation; sedimentation rates; sediments; South Africa; South Atlantic; Southeast Atlantic; Southern Africa; Tertiary; time domain analysis; upwelling; well logs ER - TY - JOUR T1 - Photometry of Mercury from SOHO/LASCO and Earth; the phase function from 2 to 170 degrees AN - 51536530; 2006-076568 JF - Icarus AU - Mallama, Anthony AU - Wang, Dennis AU - Howard, Russell A Y1 - 2002/02// PY - 2002 DA - February 2002 SP - 253 EP - 264 PB - Elsevier, New York, NY VL - 155 IS - 2 SN - 0019-1035, 0019-1035 KW - albedo KW - laser methods KW - observations KW - terrestrial planets KW - planets KW - photometry KW - SOHO KW - Mercury Planet KW - surface features KW - LASCO KW - Hapke model KW - Large Angle Spectrometric Coronograph KW - regolith KW - 04:Extraterrestrial geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51536530?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Icarus&rft.atitle=Photometry+of+Mercury+from+SOHO%2FLASCO+and+Earth%3B+the+phase+function+from+2+to+170+degrees&rft.au=Mallama%2C+Anthony%3BWang%2C+Dennis%3BHoward%2C+Russell+A&rft.aulast=Mallama&rft.aufirst=Anthony&rft.date=2002-02-01&rft.volume=155&rft.issue=2&rft.spage=253&rft.isbn=&rft.btitle=&rft.title=Icarus&rft.issn=00191035&rft_id=info:doi/10.1006%2Ficar.2001.6723 L2 - http://www.sciencedirect.com/science/journal/00191035 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2006-01-01 N1 - Number of references - 35 N1 - PubXState - NY N1 - Document feature - illus. incl. 9 tables N1 - Last updated - 2012-06-07 N1 - CODEN - ICRSA5 N1 - SubjectsTermNotLitGenreText - albedo; Hapke model; Large Angle Spectrometric Coronograph; LASCO; laser methods; Mercury Planet; observations; photometry; planets; regolith; SOHO; surface features; terrestrial planets DO - http://dx.doi.org/10.1006/icar.2001.6723 ER - TY - JOUR T1 - The contribution of free-choice learning to public understanding of science AN - 19920764; 5386654 AB - There is no single right way to learn things, and no single place or even moment in which we learn. All learning happens continuously, from many different sources, and in many different ways. There are three main educational sectors, the formal education sector of schools and universities, the workplace, and the free-choice learning sector. Of the three, the most frequently over-looked is the free-choice learning sector. The free-choice learning sector includes museums, television, radio, the Internet, magazines, newspapers, books, parks, community organizations of all types: youth, adult, religious, environmental, health, sports and recreation. It is a vast educational infrastructure that helps to support the on-going and continuous learning of all citizens. Recent research suggests that nearly half of the public's science understanding and learning derives from the free-choice learning sector. Hence it is incumbent on science educational policy makers and practitioners to recognize the fundamental role that free-choice learning makes in public understanding of science.Original Abstract: No hay una sola manera de aprender, ni un solo lugar o momento en los cuales aprendemos. Todo aprendizaje tiene lugar continuamente, desde muchas fuentes y de muchas maneras diferentes. Existen tres sectores educativos principales, el sector educativo formal de escuelas y universidades, el lugar de trabajo, y el sector de libre aprendizaje. De los tres, el que mas frecuentemente es descuidado es el libre aprendizaje. Este ultimo sector de aprendizaje incluye museos, television, radio, la Internet, revistas, periodicos, libros, parques y organizaciones comunitarias de todo tipo: juveniles, de adultos, religiosas, ambientalistas, de salud, deportes y recreacion. Es una vasta infraestructura educativa que apoya el aprendizaje `sobre la marcha' y continuo de todos los ciudadanos. Investigaciones recientes sugieren que cerca de la mitad del aprendizaje y comprension de la ciencia por el publico proviene del sector del libre aprendizaje. Por ello es necesario que quienes formulan politicas educativas y quienes las llevan a la practica reconozcan el papel fundamental que tiene el libre aprendizaje en la comprension publica de la ciencia. JF - Interciencia AU - Falk, J H AD - Institute for Learning Innovation, 166 West Street, Annapolis, MD 21401, USA, falk@ilinet.org Y1 - 2002/02// PY - 2002 DA - Feb 2002 SP - 62 EP - 65 VL - 27 IS - 2 SN - 0378-1844, 0378-1844 KW - environmental education KW - Sustainability Science Abstracts; Health & Safety Science Abstracts; Human Population KW - Museums KW - Environmental health KW - Learning behavior KW - Environmental perception KW - Education KW - Schools KW - schools KW - Books KW - Television KW - community organizations KW - infrastructure KW - Internet KW - M3 1010:Issues in Sustainable Development KW - H 12000:Epidemiology and Public Health KW - M1 340:Environmental Advocacy, Education and Awareness UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/19920764?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Assamodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Interciencia&rft.atitle=The+contribution+of+free-choice+learning+to+public+understanding+of+science&rft.au=Falk%2C+J+H&rft.aulast=Falk&rft.aufirst=J&rft.date=2002-02-01&rft.volume=27&rft.issue=2&rft.spage=62&rft.isbn=&rft.btitle=&rft.title=Interciencia&rft.issn=03781844&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-07-01 N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Education; Schools; Learning behavior; Environmental perception; schools; Books; Television; Museums; Environmental health; infrastructure; community organizations; Internet ER - TY - JOUR T1 - Climate Change and Rice Yields in Diverse Agro-Environments of India. II. Effect of Uncertainties in Scenarios and Crop Models on Impact Assessment AN - 16129973; 5309678 AB - Estimates of impact of climate change on crop production could be biased depending upon the uncertainties in climate change scenarios, region of study, crop models used for impact assessment and the level of management. This study reports the results of a study where the impact of various climate change scenarios has been assessed on grain yields of irrigated rice with two popular crop simulation models- Ceres-Rice and ORYZA1N at different levels of N management. The results showed that the direct effect of climate change on rice crops in different agroclimatic regions in India would always be positive irrespective of the various uncertainties. Rice yields increased between 1.0 and 16.8% in pessimistic scenarios of climate change depending upon the level of management and model used. These increases were between 3.5 and 33.8% in optimistic scenarios. At current as well as improved level of management, southern and western parts of India which currently have relatively lower temperatures compared to northern and eastern regions, are likely to show greater sensitivity in rice yields under climate change. The response to climate change is small at low N management compared to optimal management. The magnitude of this impact can be biased upto 32% depending on the uncertainty in climate change scenario, level of management and crop model used. These conclusions are highly dependent on the specific thresholds of phenology and photosynthesis to change in temperature used in the models. Caution is needed in using the impact assessment results made with the average simulated grain yields and mean changes in climatic parameters. JF - Climatic Change AU - Aggarwal, P K AU - Mall, R K AD - Centre for Applications of Systems Simulation, NRL Building, Indian Agricultural Research Institute, New Delhi-110012, India Y1 - 2002/02// PY - 2002 DA - Feb 2002 SP - 331 EP - 343 PB - Kluwer Academic Publishers VL - 52 IS - 3 SN - 0165-0009, 0165-0009 KW - Rice KW - ASFA 3: Aquatic Pollution & Environmental Quality; Meteorological & Geoastrophysical Abstracts KW - Climate and agriculture KW - Rice fields KW - Rice field aquaculture KW - Climate change KW - Climatic changes KW - Oryza sativa KW - Production management KW - Ecosystem disturbance KW - India KW - Modelling KW - M2 551.588:Environmental Influences (551.588) KW - Q5 08521:Mechanical and natural changes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/16129973?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Climatic+Change&rft.atitle=Climate+Change+and+Rice+Yields+in+Diverse+Agro-Environments+of+India.+II.+Effect+of+Uncertainties+in+Scenarios+and+Crop+Models+on+Impact+Assessment&rft.au=Aggarwal%2C+P+K%3BMall%2C+R+K&rft.aulast=Aggarwal&rft.aufirst=P&rft.date=2002-02-01&rft.volume=52&rft.issue=3&rft.spage=331&rft.isbn=&rft.btitle=&rft.title=Climatic+Change&rft.issn=01650009&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-09-01 N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Rice field aquaculture; Climatic changes; Production management; Ecosystem disturbance; Modelling; Rice fields; Climate and agriculture; Climate change; Oryza sativa; India ER - TY - JOUR T1 - Climate Change and Rice Yields in Diverse Agro-Environments of India. I. Evaluation of Impact Assessment Models AN - 16129421; 5309677 AB - This paper reports results of a comparison of two popular rice growth models- Ceres-Rice and ORYZA1N for the same input conditions. Both models use different approaches for simulating growth and yield, are sensitive to climate change parameters, and represent two major schools of crop modelling. A dataset of 32 experiments consisting of 98 treatments was assembled from an extensive literature search. These experiments were conducted over the period of 1980-1993 in diverse Indian locations from 11 degree N-33 degree N. The treatments varied in N management, sowing dates, varieties and seasons. The flowering duration in the dataset varied between 37 and 86 days and grain yields between 2587 kg ha super(-1) and 8877 kg ha super(-1). Seven treatments from this dataset, one for each variety, were selected for calibration. The genetic coefficients of different varieties used in the analysis for both models were estimated from this short-listed dataset by repeated iterations until a close match between simulated and observed phenology and yield was obtained in these treatments. Similarly 11 treatments with zero or low N applications were used for calibration of initial soil N for different locations. The remaining 80 treatments were used for validation of the models. Both models predicted satisfactorily the trends of leaf area and dry matter growth, grain number, days to flowering and grain yields. Simulated yields were within +15% of the measurements. Considering that the field measurements also generally have 10-15% error and that the treatments widely varied in weather conditions, particularly in temperature, it was concluded that both models are adequate to simulate the effects of climate change on rice yields in diverse agro-environments of India that are free from all pests. JF - Climatic Change AU - Mall, R K AU - Aggarwal, P K AD - Centre for Applications of Systems Simulation, NRL Building, Indian Agricultural Research Institute, New Delhi-110012, India Y1 - 2002/02// PY - 2002 DA - Feb 2002 SP - 315 EP - 330 PB - Kluwer Academic Publishers VL - 52 IS - 3 SN - 0165-0009, 0165-0009 KW - Rice KW - ASFA 3: Aquatic Pollution & Environmental Quality; Meteorological & Geoastrophysical Abstracts KW - Climate and agriculture KW - Rice fields KW - Climate change KW - Climatic changes KW - Environmental impact KW - Oryza sativa KW - Ecosystem disturbance KW - India KW - Abiotic factors KW - M2 551.588:Environmental Influences (551.588) KW - Q5 08521:Mechanical and natural changes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/16129421?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Climatic+Change&rft.atitle=Climate+Change+and+Rice+Yields+in+Diverse+Agro-Environments+of+India.+I.+Evaluation+of+Impact+Assessment+Models&rft.au=Mall%2C+R+K%3BAggarwal%2C+P+K&rft.aulast=Mall&rft.aufirst=R&rft.date=2002-02-01&rft.volume=52&rft.issue=3&rft.spage=315&rft.isbn=&rft.btitle=&rft.title=Climatic+Change&rft.issn=01650009&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-09-01 N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Climatic changes; Environmental impact; Ecosystem disturbance; Abiotic factors; Rice fields; Climate and agriculture; Climate change; Oryza sativa; India ER - TY - JOUR T1 - Streptozotocin diabetes protects against arrhythmias in rat isolated hearts: role of hypothyroidism. AN - 71427485; 11821037 AB - We examined the contribution of hypothyroidism to streptozotocin diabetes-induced alterations in the arrhythmia susceptibility of ex vivo hearts to regional zero-flow ischaemia. Diabetic rats received either protamine zinc insulin (10 IU/kg/day, s.c.) or triiodothyronine (10 microg/kg/day, s.c.) for 8 weeks commencing 72 h after injection of streptozotocin (60 mg/kg, i.p.). Arrhythmias were determined in ex vivo Langendorff-perfused hearts, subjected to a 30-min main left coronary artery occlusion, followed by 30-min reperfusion. Serum free thyroxine concentrations, rectal temperature and ex vivo heart rate were significantly decreased in the 8-week diabetic group (P<0.001). These changes were prevented by administration of triiodothyronine or insulin. Ventricular fibrillation during reperfusion was abolished in hearts from diabetic rats. This protection was prevented by treatment with either triiodothyronine or insulin. Hearts from methimazole-hypothyroid rats also showed no ventricular fibrillation during reperfusion. The protection against ischaemia-reperfusion-arrhythmias observed in hearts from streptozotocin-diabetic rats may be due to diabetes-induced hypothyroidism. JF - European journal of pharmacology AU - Zhang, Liqun AU - Parratt, James R AU - Beastall, Graham H AU - Pyne, Nigel J AU - Furman, Brian L AD - Department of Physiology and Pharmacology, Strathclyde Institute of Biomedical Sciences, University of Strathclyde in Glasgow, 27 Taylor Street G4 ONR, Scotland, Glasgow, UK. Y1 - 2002/01/25/ PY - 2002 DA - 2002 Jan 25 SP - 269 EP - 276 VL - 435 IS - 2-3 SN - 0014-2999, 0014-2999 KW - Blood Glucose KW - 0 KW - Insulin KW - Thyroid Hormones KW - Triiodothyronine KW - 06LU7C9H1V KW - Methimazole KW - 554Z48XN5E KW - Streptozocin KW - 5W494URQ81 KW - Protein Kinase C KW - EC 2.7.11.13 KW - Index Medicus KW - Animals KW - Ventricular Fibrillation -- etiology KW - Disease Models, Animal KW - Insulin -- therapeutic use KW - Organ Size KW - Myocardial Ischemia -- physiopathology KW - Rats KW - Protein Kinase C -- metabolism KW - Body Weight KW - Rats, Sprague-Dawley KW - Heart Rate KW - Body Temperature KW - Long QT Syndrome KW - Triiodothyronine -- therapeutic use KW - Thyroid Hormones -- blood KW - Male KW - Myocardial Reperfusion Injury -- physiopathology KW - Arrhythmias, Cardiac -- prevention & control KW - Diabetes Mellitus, Experimental -- drug therapy KW - Hypothyroidism -- etiology KW - Heart -- physiology KW - Diabetes Mellitus, Experimental -- blood KW - Diabetes Mellitus, Experimental -- enzymology KW - Hypothyroidism -- chemically induced KW - Arrhythmias, Cardiac -- physiopathology KW - Diabetes Mellitus, Experimental -- physiopathology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71427485?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=European+journal+of+pharmacology&rft.atitle=Streptozotocin+diabetes+protects+against+arrhythmias+in+rat+isolated+hearts%3A+role+of+hypothyroidism.&rft.au=Zhang%2C+Liqun%3BParratt%2C+James+R%3BBeastall%2C+Graham+H%3BPyne%2C+Nigel+J%3BFurman%2C+Brian+L&rft.aulast=Zhang&rft.aufirst=Liqun&rft.date=2002-01-25&rft.volume=435&rft.issue=2-3&rft.spage=269&rft.isbn=&rft.btitle=&rft.title=European+journal+of+pharmacology&rft.issn=00142999&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-03-27 N1 - Date created - 2002-01-31 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - CPAPER T1 - Pathway ranking for in situ sediment management (PRISM) AN - 39558635; 3644071 AU - Apitz, SE AU - Chadwick, D B Y1 - 2002/01/08/ PY - 2002 DA - 2002 Jan 08 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39558635?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Pathway+ranking+for+in+situ+sediment+management+%28PRISM%29&rft.au=Apitz%2C+SE%3BChadwick%2C+D+B&rft.aulast=Apitz&rft.aufirst=SE&rft.date=2002-01-08&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: International Erosion Control Association, P.O. Box 774904, 1355 S Lincoln Ave, Steamboat Springs, CO 80477-4904, USA; phone: 970-879-3010; fax: 970-879-8563; email: ecinfo@ieca.org; URL: www.ieca.org N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Electrokinetic remediation of contaminated sediments AN - 39558091; 3643973 AU - Granade, S AU - Gent, D Y1 - 2002/01/08/ PY - 2002 DA - 2002 Jan 08 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39558091?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Electrokinetic+remediation+of+contaminated+sediments&rft.au=Granade%2C+S%3BGent%2C+D&rft.aulast=Granade&rft.aufirst=S&rft.date=2002-01-08&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: International Erosion Control Association, P.O. Box 774904, 1355 S Lincoln Ave, Steamboat Springs, CO 80477-4904, USA; phone: 970-879-3010; fax: 970-879-8563; email: ecinfo@ieca.org; URL: www.ieca.org N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Maximizing data utility for contaminated sediment management: Examples of some approaches AN - 39450446; 3644010 AU - Apitz, SE AU - Arias, E AU - Clawson, SA AU - Leather, J AU - Kirtay, V J Y1 - 2002/01/08/ PY - 2002 DA - 2002 Jan 08 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39450446?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Maximizing+data+utility+for+contaminated+sediment+management%3A+Examples+of+some+approaches&rft.au=Apitz%2C+SE%3BArias%2C+E%3BClawson%2C+SA%3BLeather%2C+J%3BKirtay%2C+V+J&rft.aulast=Apitz&rft.aufirst=SE&rft.date=2002-01-08&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: International Erosion Control Association, P.O. Box 774904, 1355 S Lincoln Ave, Steamboat Springs, CO 80477-4904, USA; phone: 970-879-3010; fax: 970-879-8563; email: ecinfo@ieca.org; URL: www.ieca.org N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Behavior of 3-5 ring PAHs in San Diego Bay Sediments: Implications AN - 39394202; 3644001 AU - Apitz, SE AU - Arias, E AU - Clawson, SA Y1 - 2002/01/08/ PY - 2002 DA - 2002 Jan 08 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39394202?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Behavior+of+3-5+ring+PAHs+in+San+Diego+Bay+Sediments%3A+Implications&rft.au=Apitz%2C+SE%3BArias%2C+E%3BClawson%2C+SA&rft.aulast=Apitz&rft.aufirst=SE&rft.date=2002-01-08&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: International Erosion Control Association, P.O. Box 774904, 1355 S Lincoln Ave, Steamboat Springs, CO 80477-4904, USA; phone: 970-879-3010; fax: 970-879-8563; email: ecinfo@ieca.org; URL: www.ieca.org N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Contaminant fluxes from sediments - Risk or recovery? AN - 39376871; 3643982 AU - Chadwick, D B AU - Rivera-Duarte, I AU - Hampton, T AU - Davidson, B AU - Crecelius, E Y1 - 2002/01/08/ PY - 2002 DA - 2002 Jan 08 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39376871?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Contaminant+fluxes+from+sediments+-+Risk+or+recovery%3F&rft.au=Chadwick%2C+D+B%3BRivera-Duarte%2C+I%3BHampton%2C+T%3BDavidson%2C+B%3BCrecelius%2C+E&rft.aulast=Chadwick&rft.aufirst=D&rft.date=2002-01-08&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: International Erosion Control Association, P.O. Box 774904, 1355 S Lincoln Ave, Steamboat Springs, CO 80477-4904, USA; phone: 970-879-3010; fax: 970-879-8563; email: ecinfo@ieca.org; URL: www.ieca.org N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - Sequential biological destruction of mixed recalcitrant groundwater contaminants AN - 855196572; 2011-025251 JF - International Conference on Remediation of Chlorinated and Recalcitrant Compounds AU - Liles, Chris AU - Collins, William E AU - Abedi, Hedy AU - Coons, Merry AU - Amiri, Ali S AU - Jackson, D A AU - de Waal, W A2 - Gavaskar, Arun R. A2 - Chen, Abraham S. C. Y1 - 2002 PY - 2002 DA - 2002 SP - Paper 2F EP - 04 PB - Battelle Press, Columbus, OH VL - 3 KW - United States KW - chlorinated hydrocarbons KW - aquifer vulnerability KW - degradation KW - contaminant plumes KW - waste disposal sites KW - pollution KW - trichloroethane KW - Coronado California KW - remediation KW - ground water KW - aquifers KW - San Diego California KW - California KW - volatiles KW - organic compounds KW - San Diego County California KW - volatile organic compounds KW - halogenated hydrocarbons KW - bioreactors KW - Naval Air Station KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/855196572?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Conference+on+Remediation+of+Chlorinated+and+Recalcitrant+Compounds&rft.atitle=Sequential+biological+destruction+of+mixed+recalcitrant+groundwater+contaminants&rft.au=Liles%2C+Chris%3BCollins%2C+William+E%3BAbedi%2C+Hedy%3BCoons%2C+Merry%3BAmiri%2C+Ali+S%3BJackson%2C+D+A%3Bde+Waal%2C+W&rft.aulast=Liles&rft.aufirst=Chris&rft.date=2002-01-01&rft.volume=3&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=International+Conference+on+Remediation+of+Chlorinated+and+Recalcitrant+Compounds&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Third international conference on Remediation of chlorinated and recalcitrant compounds N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2011-01-01 N1 - Number of references - 1 N1 - PubXState - OH N1 - Document feature - illus. incl. 5 tables, sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - #05518 N1 - SubjectsTermNotLitGenreText - aquifer vulnerability; aquifers; bioreactors; California; chlorinated hydrocarbons; contaminant plumes; Coronado California; degradation; ground water; halogenated hydrocarbons; Naval Air Station; organic compounds; pollution; remediation; San Diego California; San Diego County California; trichloroethane; United States; volatile organic compounds; volatiles; waste disposal sites ER - TY - JOUR T1 - Group A streptococcal toxic shock syndrome developing in the third trimester of pregnancy. AN - 72872737; 12648315 AB - Group A streptococcal (GAS) toxic shock syndrome (TSS) is an uncommon, but life-threatening infection during pregnancy and should be considered in rapid onset of shock. Most cases described in the literature have occurred in the puerperium. We report a case of GAS TSS occurring during the third trimester of pregnancy in a previously healthy woman. A 31-year-old female, who was 34 weeks pregnant, presented with fevers and a prodromal 'flu-like' illness. She rapidly developed shock and multiorgan failure. Blood cultures revealed GAS bacteremia and the patient met criteria for streptococcal TSS. Despite her eventual recovery, her infant died on postpartum day 15 as a consequence of the mother's TSS. This case is unusual in that there were no identifiable initiating events or source of the streptococcal infection, and the TSS developed during pregnancy rather than after delivery. Early recognition of GAS infections is important given the rapid onset and high morbidity and mortality associated with these infections. This is the first reported case utilizing intravenous immunoglobulin for GAS TSS in the puerperium. JF - Infectious diseases in obstetrics and gynecology AU - Crum, Nancy F AU - Chun, Helen M AU - Gaylord, Thomas G AU - Hale, Braden R AD - Internal Medicine Department, Naval Medical Center San Diego, San Diego, CA 92134, USA. nfcrum@nmcsd.med.navy.mil Y1 - 2002 PY - 2002 DA - 2002 SP - 209 EP - 216 VL - 10 IS - 4 SN - 1064-7449, 1064-7449 KW - Index Medicus KW - Fatal Outcome KW - Pregnancy Trimester, Third KW - Diagnosis, Differential KW - Humans KW - Adult KW - Infant, Newborn KW - Female KW - Pregnancy KW - Pregnancy Complications, Infectious -- microbiology KW - Pregnancy Complications, Infectious -- diagnosis KW - Streptococcal Infections -- microbiology KW - Shock, Septic -- microbiology KW - Streptococcal Infections -- diagnosis KW - Shock, Septic -- diagnosis KW - Streptococcus pyogenes -- isolation & purification UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72872737?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Infectious+diseases+in+obstetrics+and+gynecology&rft.atitle=Group+A+streptococcal+toxic+shock+syndrome+developing+in+the+third+trimester+of+pregnancy.&rft.au=Crum%2C+Nancy+F%3BChun%2C+Helen+M%3BGaylord%2C+Thomas+G%3BHale%2C+Braden+R&rft.aulast=Crum&rft.aufirst=Nancy&rft.date=2002-01-01&rft.volume=10&rft.issue=4&rft.spage=209&rft.isbn=&rft.btitle=&rft.title=Infectious+diseases+in+obstetrics+and+gynecology&rft.issn=10647449&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-04-17 N1 - Date created - 2003-03-21 N1 - Date revised - 2017-01-13 N1 - SuppNotes - Cited By: Infect Dis Obstet Gynecol. 1999;7(6):276-82 [10598916] Pharmacotherapy. 1999 Sep;19(9):1094-8 [10610017] Obstet Gynecol. 1999 Jul;94(1):153-7 [10389739] Am J Med. 1997 Jan;102(1):111-3 [9209207] Hum Pathol. 1997 Apr;28(4):509-12 [9104954] J Infect Dis. 1997 Mar;175(3):723-6 [9041354] Obstet Gynecol. 1996 Oct;88(4 Pt 2):728 [8841274] Clin Infect Dis. 1995 Dec;21(6):1469-70 [8749635] Obstet Gynecol. 1996 May;87(5 Pt 2):823-6 [8677102] Am J Obstet Gynecol. 1995 Jul;173(1):241-2 [7631696] Br J Obstet Gynaecol. 1994 May;101(5):447-8 [8018620] Am J Obstet Gynecol. 1993 Sep;169(3):571-2 [8372865] Int J Gynaecol Obstet. 1993 Mar;40(3):245-8 [8096477] Clin Infect Dis. 1992 Jan;14(1):2-11 [1571429] Obstet Gynecol. 1992 May;79(5 ( Pt 2)):894-6 [1565401] Obstet Gynecol. 1991 Sep;78(3 Pt 2):549-51 [1870820] Anaesth Intensive Care. 1991 Feb;19(1):108-10 [2012267] J Reprod Med. 1990 May;35(5):558-60 [2191134] N Engl J Med. 1989 Jul 6;321(1):1-7 [2659990] Arch Intern Med. 1988 Jun;148(6):1268-70 [3288156] J Infect. 1988 Jan;16(1):37-46 [3284952] Epidemiol Infect. 1988 Apr;100(2):257-69 [3128449] Mol Gen Genet. 1986 May;203(2):354-6 [3526093] Med J Aust. 1985 Sep 30;143(7):271-2 [3900655] Obstet Gynecol. 1972 Mar;39(3):474-82 [4553270] J Infect. 2001 Oct;43(3):173-6 [11798254] Scand J Infect Dis. 2001;33(10):734-7 [11728037] Obstet Gynecol. 2001 Nov;98(5 Pt 1):846-8 [11704180] Obstet Gynecol. 2001 Nov;98(5 Pt 1):721-3 [11704158] J Infect. 2001 Apr;42(3):195-200 [11545551] Clin Infect Dis. 1999 Apr;28(4):800-7 [10825042] Eur J Obstet Gynecol Reprod Biol. 2000 Jun;90(2):153-8 [10825634] Infect Dis Obstet Gynecol. 2000;8(5-6):217-9 [11220480] N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Stenotrophomonas maltophilia endocarditis. AN - 72842343; 12587628 AB - Stenotrophomonas maltophilia is a gram-negative bacillus that is increasingly associated with serious nosocomial infections, especially in immunocompromised patients; however, the occurrence of endocarditis due to this organism is rare. This report describes a case of S. maltophilia endocarditis associated with a central venous catheter. The literature on Stenotrophomonas endocarditis is reviewed. Given the high morbidity and mortality of these infections, early antibiotic therapy utilizing trimethoprim-sulfamethoxazole, along with a second agent and removal of prosthetic devices, is recommended. JF - Scandinavian journal of infectious diseases AU - Crum, Nancy F AU - Utz, Gregory C AU - Wallace, Mark R AD - Department of Internal Medicine, Infectious Diseases Division, Naval Medical Center San Diego, San Diego CA 92134, USA. nfcrum@nmcsd.med.navy.mil Y1 - 2002 PY - 2002 DA - 2002 SP - 925 EP - 927 VL - 34 IS - 12 SN - 0036-5548, 0036-5548 KW - Index Medicus KW - Drug Therapy, Combination KW - Humans KW - Middle Aged KW - Hyperkalemia -- chemically induced KW - Female KW - Endocarditis -- etiology KW - Gram-Negative Bacterial Infections -- diagnosis KW - Endocarditis -- drug therapy KW - Endocarditis -- diagnosis KW - Stenotrophomonas maltophilia -- isolation & purification KW - Gram-Negative Bacterial Infections -- etiology KW - Gram-Negative Bacterial Infections -- drug therapy KW - Gram-Negative Bacterial Infections -- microbiology KW - Endocarditis -- microbiology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72842343?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Scandinavian+journal+of+infectious+diseases&rft.atitle=Stenotrophomonas+maltophilia+endocarditis.&rft.au=Crum%2C+Nancy+F%3BUtz%2C+Gregory+C%3BWallace%2C+Mark+R&rft.aulast=Crum&rft.aufirst=Nancy&rft.date=2002-01-01&rft.volume=34&rft.issue=12&rft.spage=925&rft.isbn=&rft.btitle=&rft.title=Scandinavian+journal+of+infectious+diseases&rft.issn=00365548&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-03-31 N1 - Date created - 2003-02-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - A new paradigm in personal dosimetry using LiF:Mg,Cu,P. AN - 72185815; 12382701 AB - The United States Navy has been monitoring personnel for occupational exposure to ionising radiation since 1947. Film was exclusively used until 1973 when thermoluminescence dosemeters were introduced and used to the present time. In 1994, a joint research project between the Naval Dosimetry Center, Georgetown University, and Saint Gobain Crystals and Detectors (formerly Bicron RMP formerly Harshaw TLD) began to develop a state of the art thermoluminescent dosimetry system. The study was conducted from a large-scale dosimetry processor point of view with emphasis on a systems approach. Significant improvements were achieved by replacing the LiF:Mg,Ti with LiF:Mg,Cu,P TL elements due to the significant sensitivity increase, linearity, and negligible hiding. Dosemeter filters were optimised for gamma and X ray energy discrimination using Monte Carlo modelling (MCNP) resulting in significant improvement in accuracy and precision. Further improvements were achieved through the use of neural-network based dose calculation algorithms. Both back propagation and functional link methods were implemented and the data compared with essentially the same results. Several operational aspects of the system are discussed, including (1) background subtraction using control dosemeters, (2) selection criteria for control dosemeters, (3) optimisation of the TLD readers, (4) calibration methodology, and (5) the optimisation of the heating profile. JF - Radiation protection dosimetry AU - Cassata, J R AU - Moscovitch, M AU - Rotunda, J E AU - Velbeck, K J AD - US Naval Dosimetry Center, Bethesda, MD 20889, USA. JCassata@NavDosCen.med.navy.mil Y1 - 2002 PY - 2002 DA - 2002 SP - 27 EP - 42 VL - 101 IS - 1-4 SN - 0144-8420, 0144-8420 KW - Lithium Compounds KW - 0 KW - lithium fluoride KW - 1485XST65B KW - Phosphorus KW - 27YLU75U4W KW - Copper KW - 789U1901C5 KW - Magnesium KW - I38ZP9992A KW - Fluorides KW - Q80VPU408O KW - Index Medicus KW - Space life sciences KW - Non-programmatic KW - Luminescent Measurements KW - Environmental Exposure KW - Algorithms KW - Radiation, Ionizing KW - Models, Theoretical KW - Radiometry -- methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72185815?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Radiation+protection+dosimetry&rft.atitle=A+new+paradigm+in+personal+dosimetry+using+LiF%3AMg%2CCu%2CP.&rft.au=Cassata%2C+J+R%3BMoscovitch%2C+M%3BRotunda%2C+J+E%3BVelbeck%2C+K+J&rft.aulast=Cassata&rft.aufirst=J&rft.date=2002-01-01&rft.volume=101&rft.issue=1-4&rft.spage=27&rft.isbn=&rft.btitle=&rft.title=Radiation+protection+dosimetry&rft.issn=01448420&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-04-23 N1 - Date created - 2002-10-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Low temperature studies in LiF:Mg,Cu,P. AN - 72181530; 12382838 AB - Despite extensive investigations carried out in LiF:Mg,Cu,P, the nature of the emission centre is not clearly understood. Results of X ray excited emission in this material at room temperature and at 16 K are presented to obtain more data that can throw light on the emission characteristics of this material. At room temperature only a single emission peak is seen around 390 nm but at 16 K the emission appears to consist of more than one emission band. The emission spectra could be fitted with three bands with peaks at 332, 385 and 447 nm. The X ray excited emission at 16 K after annealing at 573 K for 5 min suppresses the 332 nm emission but enhances 447 nm emission. Moreover, annealing at 573 K greatly reduces the emission intensity, which signifies that the luminescent centres are also destroyed in this process. Temperature-dependent X ray excited fluorescence below room temperature provides evidence of the existence of shallow traps, which give rise to a thermoluminescence peak around 130 K. On the basis of the present investigations it is proposed that the complex nature of the emission may be related to the formation of donor-acceptor pairs in this material. The possible nature of this donor-acceptor complex is discussed. JF - Radiation protection dosimetry AU - Mathur, V K AU - Bandyopadhyay, P K AU - Barkyoumb, J H AU - Cai, G G AD - Naval Surface Warfare Center, Carderock Division, Bethesda, MD 20817, USA. mathurvk@nswccd.navy.mil Y1 - 2002 PY - 2002 DA - 2002 SP - 103 EP - 106 VL - 100 IS - 1-4 SN - 0144-8420, 0144-8420 KW - Lithium Compounds KW - 0 KW - lithium fluoride KW - 1485XST65B KW - Phosphorus KW - 27YLU75U4W KW - Copper KW - 789U1901C5 KW - Magnesium KW - I38ZP9992A KW - Fluorides KW - Q80VPU408O KW - Index Medicus KW - Radiochemistry KW - Phosphorus -- chemistry KW - X-Rays KW - Fluorescence KW - Spectrum Analysis KW - Temperature KW - Magnesium -- chemistry KW - Copper -- chemistry KW - Thermoluminescent Dosimetry -- methods KW - Lithium Compounds -- radiation effects KW - Lithium Compounds -- chemistry KW - Thermoluminescent Dosimetry -- statistics & numerical data KW - Fluorides -- radiation effects KW - Fluorides -- chemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72181530?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Numerical+simulation+of+the+microstructure+and+compression+behavior+of+Eckernfoerde+Bay+sediments&rft.au=Anandarajah%2C+A%3BLavoie%2C+Dawn+L&rft.aulast=Anandarajah&rft.aufirst=A&rft.date=2002-04-10&rft.volume=182&rft.issue=1-2&rft.spage=3&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-04-10 N1 - Date created - 2002-10-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Good pharmacovigilance practices: technology enabled. AN - 71831532; 12071777 AB - The assessment of spontaneous reports is most effective it is conducted within a defined and rigorous process. The framework for good pharmacovigilance process (GPVP) is proposed as a subset of good postmarketing surveillance process (GPMSP), a functional structure for both a public health and corporate risk management strategy. GPVP has good practices that implement each step within a defined process. These practices are designed to efficiently and effectively detect and alert the drug safety professional to new and potentially important information on drug-associated adverse reactions. These practices are enabled by applied technology designed specifically for the review and assessment of spontaneous reports. Specific practices include rules-based triage, active query prompts for severe organ insults, contextual single case evaluation, statistical proportionality and correlational checks, case-series analyses, and templates for signal work-up and interpretation. These practices and the overall GPVP are supported by state-of-the-art web-based systems with powerful analytical engines, workflow and audit trials to allow validated systems support for valid drug safety signalling efforts. It is also important to understand that a process has a defined set of steps and any one cannot stand independently. Specifically, advanced use of technical alerting methods in isolation can mislead and allow one to misunderstand priorities and relative value. In the end, pharmacovigilance is a clinical art and a component process to the science of pharmacoepidemiology and risk management. JF - Drug safety AU - Nelson, Robert C AU - Palsulich, Bruce AU - Gogolak, Victor AD - RCN Associates, Inc., Annapolis, Maryland 21403, USA. rcnelson@rcnrx.com Y1 - 2002 PY - 2002 DA - 2002 SP - 407 EP - 414 VL - 25 IS - 6 SN - 0114-5916, 0114-5916 KW - Index Medicus KW - Drug Monitoring -- methods KW - Pharmacoepidemiology -- standards KW - Reproducibility of Results KW - Drug Monitoring -- standards KW - Statistics as Topic -- standards KW - Humans KW - Risk Assessment -- standards KW - Databases, Factual -- standards KW - Product Surveillance, Postmarketing -- methods KW - Adverse Drug Reaction Reporting Systems -- standards KW - Technology, Pharmaceutical -- statistics & numerical data KW - Drug Evaluation, Preclinical -- standards KW - Product Surveillance, Postmarketing -- statistics & numerical data KW - Drug Evaluation -- standards KW - Technology, Pharmaceutical -- standards KW - Product Surveillance, Postmarketing -- standards UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71831532?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Drug+safety&rft.atitle=Good+pharmacovigilance+practices%3A+technology+enabled.&rft.au=Nelson%2C+Robert+C%3BPalsulich%2C+Bruce%3BGogolak%2C+Victor&rft.aulast=Nelson&rft.aufirst=Robert&rft.date=2002-01-01&rft.volume=25&rft.issue=6&rft.spage=407&rft.isbn=&rft.btitle=&rft.title=Drug+safety&rft.issn=01145916&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-09-06 N1 - Date created - 2002-06-19 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Acoustic seafloor characterization in Onslow Bay from EM 121A hydrophone data AN - 52123822; 2002-032915 JF - Journal of the Mississippi Academy of Sciences AU - Bentrem, Frank W AU - Sample, John A2 - Curry, Kenneth J. Y1 - 2002/01// PY - 2002 DA - January 2002 SP - 57 PB - Mississippi Academy of Sciences, Jackson, MS VL - 47 IS - 1 SN - 0076-9436, 0076-9436 KW - United States KW - grain size KW - marine geology KW - geophysical methods KW - inverse problem KW - calibration KW - acoustical methods KW - Onslow Bay KW - marine sediments KW - ground truth KW - North Carolina KW - classification KW - sediments KW - ocean floors KW - sonar methods KW - instruments KW - 20:Applied geophysics KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52123822?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+the+Mississippi+Academy+of+Sciences&rft.atitle=Acoustic+seafloor+characterization+in+Onslow+Bay+from+EM+121A+hydrophone+data&rft.au=Bentrem%2C+Frank+W%3BSample%2C+John&rft.aulast=Bentrem&rft.aufirst=Frank&rft.date=2002-01-01&rft.volume=47&rft.issue=1&rft.spage=57&rft.isbn=&rft.btitle=&rft.title=Journal+of+the+Mississippi+Academy+of+Sciences&rft.issn=00769436&rft_id=info:doi/ L2 - http://msacad.org/?page_id=25 LA - English DB - GeoRef N1 - Conference title - Sixty-sixth annual meeting N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - PubXState - MS N1 - Last updated - 2012-06-15 N1 - SubjectsTermNotLitGenreText - acoustical methods; calibration; classification; geophysical methods; grain size; ground truth; instruments; inverse problem; marine geology; marine sediments; North Carolina; ocean floors; Onslow Bay; sediments; sonar methods; United States ER - TY - JOUR T1 - A theoretical study of the effect of geomagnetic fluctuations and solar tides on the propagation of infrasonic waves in the upper atmosphere AN - 52084439; 2002-057645 JF - Geophysical Journal International AU - Garces, Milton AU - Drob, Douglas P AU - Picone, J Michael Y1 - 2002/01// PY - 2002 DA - January 2002 SP - 77 EP - 87 PB - Blackwell Science for the Royal Astronomical Society, the Deutsche Geophysikalische Gesellschaft and the European Geophysical Society VL - 148 IS - 1 SN - 0956-540X, 0956-540X KW - United States KW - solar wind KW - atmosphere KW - elastic waves KW - models KW - thermosphere KW - theoretical studies KW - detection KW - seismicity KW - traveltime KW - propagation KW - Alaska KW - infrasound KW - Comprehensive Test Ban Treaty KW - 19:Seismology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52084439?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Geophysical+Journal+International&rft.atitle=A+theoretical+study+of+the+effect+of+geomagnetic+fluctuations+and+solar+tides+on+the+propagation+of+infrasonic+waves+in+the+upper+atmosphere&rft.au=Garces%2C+Milton%3BDrob%2C+Douglas+P%3BPicone%2C+J+Michael&rft.aulast=Garces&rft.aufirst=Milton&rft.date=2002-01-01&rft.volume=148&rft.issue=1&rft.spage=77&rft.isbn=&rft.btitle=&rft.title=Geophysical+Journal+International&rft.issn=0956540X&rft_id=info:doi/ L2 - http://www.blackwellpublishing.com/journal.asp?ref=0956-540X LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 17 N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Alaska; atmosphere; Comprehensive Test Ban Treaty; detection; elastic waves; infrasound; models; propagation; seismicity; solar wind; theoretical studies; thermosphere; traveltime; United States ER - TY - JOUR T1 - Parabolic equation techniques for seismic waves AN - 52057164; 2002-076578 JF - Pure and Applied Geophysics AU - Jerzak, Wayne AU - Collins, Michael D AU - Evans, Richard B AU - Lingevitch, Joseph F AU - Siegmann, William L A2 - Psencik, Ivan A2 - Cerveny, Vlastislav Y1 - 2002 PY - 2002 DA - 2002 SP - 1681 EP - 1689 PB - Birkhaeuser Verlag, Basel VL - 159 IS - 7-8 SN - 0033-4553, 0033-4553 KW - anisotropic materials KW - geophysical methods KW - elastic waves KW - equations KW - seismic methods KW - marine methods KW - mathematical methods KW - velocity KW - propagation KW - lateral heterogeneity KW - seismic waves KW - accuracy KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52057164?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Pure+and+Applied+Geophysics&rft.atitle=Parabolic+equation+techniques+for+seismic+waves&rft.au=Jerzak%2C+Wayne%3BCollins%2C+Michael+D%3BEvans%2C+Richard+B%3BLingevitch%2C+Joseph+F%3BSiegmann%2C+William+L&rft.aulast=Jerzak&rft.aufirst=Wayne&rft.date=2002-01-01&rft.volume=159&rft.issue=7-8&rft.spage=1681&rft.isbn=&rft.btitle=&rft.title=Pure+and+Applied+Geophysics&rft.issn=00334553&rft_id=info:doi/ L2 - http://link.springer.de/link/service/journals/00024/index.htm LA - English DB - GeoRef N1 - Conference title - Seismic waves in laterally inhomogeneous media V N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 21 N1 - Document feature - illus. incl. sects. N1 - Last updated - 2012-06-07 N1 - CODEN - PAGYAV N1 - SubjectsTermNotLitGenreText - accuracy; anisotropic materials; elastic waves; equations; geophysical methods; lateral heterogeneity; marine methods; mathematical methods; propagation; seismic methods; seismic waves; velocity ER - TY - JOUR T1 - Applications of directional wavefield decomposition, phase space, and path integral methods to seismic wave propagation and inversion AN - 52057130; 2002-076577 JF - Pure and Applied Geophysics AU - Fishman, Louis A2 - Psencik, Ivan A2 - Cerveny, Vlastislav Y1 - 2002 PY - 2002 DA - 2002 SP - 1637 EP - 1679 PB - Birkhaeuser Verlag, Basel VL - 159 IS - 7-8 SN - 0033-4553, 0033-4553 KW - anisotropic materials KW - geophysical surveys KW - data processing KW - Europe KW - oil and gas fields KW - propagation KW - Western Europe KW - geophysical methods KW - inverse problem KW - Valhall Field KW - seismic methods KW - Scandinavia KW - marine methods KW - mathematical methods KW - ray tracing KW - surveys KW - Helmholtz equation KW - lateral heterogeneity KW - wave dispersion KW - Norway KW - North Sea KW - North Atlantic KW - accuracy KW - Atlantic Ocean KW - 29A:Economic geology, geology of energy sources KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52057130?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Engineering+Analysis+with+Boundary+Elements&rft.atitle=Evaluation+of+perfect+paint+assumptions+in+modeling+of+cathodic+protection+systems&rft.au=DeGiorgi%2C+V+G&rft.aulast=DeGiorgi&rft.aufirst=V&rft.date=2002-05-01&rft.volume=26&rft.issue=5&rft.spage=435&rft.isbn=&rft.btitle=&rft.title=Engineering+Analysis+with+Boundary+Elements&rft.issn=09557997&rft_id=info:doi/ L2 - http://link.springer.de/link/service/journals/00024/index.htm LA - English DB - GeoRef N1 - Conference title - Seismic waves in laterally inhomogeneous media V N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 17 N1 - Document feature - illus. incl. block diag. N1 - Last updated - 2012-06-07 N1 - CODEN - PAGYAV N1 - SubjectsTermNotLitGenreText - accuracy; anisotropic materials; Atlantic Ocean; data processing; Europe; geophysical methods; geophysical surveys; Helmholtz equation; inverse problem; lateral heterogeneity; marine methods; mathematical methods; North Atlantic; North Sea; Norway; oil and gas fields; propagation; ray tracing; Scandinavia; seismic methods; surveys; Valhall Field; wave dispersion; Western Europe ER - TY - JOUR T1 - Chromium tolerant microbial communities from the Chesapeake Bay watershed AN - 52027210; 2003-012158 AB - Chromium tolerant bacteria were enumerated from portions of the Chesapeake Bay watershed and examined for their potential to reduce Cr (VI). Water and sediment samples were collected from various locations in Baltimore Harbor and Bear Creek, as well as Sandy Point State Park in Maryland and the Anacostia River in Washington, DC. Samples were spread onto agar plates with CrO (sub 4) (super 2-) (5 ppm) as the sole terminal electron acceptor. Plates were incubated anaerobically and colony forming units (CFU) enumerated. CFU arising on minimal-CrO (sub 4) (super 2-) medium ranged from 10 (super 3) -10 (super 4) mL (super -1) or g (super -1) ? and community estimates from sites in proximity to Baltimore City were approximately 6-30X higher than distal sites. Bacterial identification by BIOLOG (super TM) or 16S rRNA sequencing indicated the presence of bacteria of the genera Klebsiella, Pseudomonas, Burkholderia, Kluyvera and others. Typical Cr (VI) reduction rates by these isolates were significantly lower than Shewanella oneidensis, a known metal-reducing bacterium. Results suggested that microbial communities in the Chesapeake Bay watershed, particularly in Baltimore Harbor and Bear Creek, had a high tolerance for Cr(VI) and/or could grow slowly with Cr(VI) as a terminal electron acceptor. However, the isolates did not rapidly degrade Cr(VI) in the laboratory. JF - Virginia Journal of Science AU - Lowe, Kristine L AU - Fliflet, Ruth E AU - Ly, Tony AU - Little, Brenda J AU - Jones-Meehan, Joanne Y1 - 2002 PY - 2002 DA - 2002 SP - 141 EP - 155 PB - Virginia Academy of Science, Richmond, VA VL - 53 IS - 3 SN - 0042-658X, 0042-658X KW - United States KW - hydrology KW - Baltimore Maryland KW - Chesapeake Bay KW - Baltimore County Maryland KW - Anacostia River KW - pollutants KW - watersheds KW - pollution KW - Pseudomonas KW - Burkholderia KW - bioremediation KW - environmental analysis KW - Sandy Point State Park KW - remediation KW - Kluyvera KW - Klebsiella KW - District of Columbia KW - metals KW - bacteria KW - Maryland KW - Bear Creek KW - chromium KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52027210?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Virginia+Journal+of+Science&rft.atitle=Chromium+tolerant+microbial+communities+from+the+Chesapeake+Bay+watershed&rft.au=Lowe%2C+Kristine+L%3BFliflet%2C+Ruth+E%3BLy%2C+Tony%3BLittle%2C+Brenda+J%3BJones-Meehan%2C+Joanne&rft.aulast=Lowe&rft.aufirst=Kristine&rft.date=2002-01-01&rft.volume=53&rft.issue=3&rft.spage=141&rft.isbn=&rft.btitle=&rft.title=Virginia+Journal+of+Science&rft.issn=0042658X&rft_id=info:doi/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 37 N1 - PubXState - VA N1 - Document feature - illus. incl. 3 tables, sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - VJSCAI N1 - SubjectsTermNotLitGenreText - Anacostia River; bacteria; Baltimore County Maryland; Baltimore Maryland; Bear Creek; bioremediation; Burkholderia; Chesapeake Bay; chromium; District of Columbia; environmental analysis; hydrology; Klebsiella; Kluyvera; Maryland; metals; pollutants; pollution; Pseudomonas; remediation; Sandy Point State Park; United States; watersheds ER - TY - JOUR T1 - The EuroSTARRS experiment over land surfaces (SMOS mission); first results AN - 51927107; 2003-070305 JF - International Geoscience and Remote Sensing Symposium AU - Calvert, Jean-Christophe AU - Pellarin, T AU - Wigneron, Jean-Pierre AU - Lopez Baeza, Ernesto AU - Saleh, K AU - Berger, Michael AU - Simmonds, Lester AU - Miller, J AU - LeDrew, Ellsworth Y1 - 2002 PY - 2002 DA - 2002 SP - 1155 EP - 1157 PB - Institute of Electrical and Electronics Engineers, New York, NY VL - 2002, Volume 2 KW - Spain KW - moisture KW - Europe KW - Iberian Peninsula KW - vegetation KW - salinity KW - Southern Europe KW - microwave methods KW - France KW - SAR KW - radiometers KW - conservation KW - world ocean KW - soils KW - forests KW - monitoring KW - Western Europe KW - geophysical methods KW - radar methods KW - interferometry KW - EuroSTARRS KW - surveys KW - remote sensing KW - airborne methods KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51927107?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Geoscience+and+Remote+Sensing+Symposium&rft.atitle=The+EuroSTARRS+experiment+over+land+surfaces+%28SMOS+mission%29%3B+first+results&rft.au=Calvert%2C+Jean-Christophe%3BPellarin%2C+T%3BWigneron%2C+Jean-Pierre%3BLopez+Baeza%2C+Ernesto%3BSaleh%2C+K%3BBerger%2C+Michael%3BSimmonds%2C+Lester%3BMiller%2C+J%3BLeDrew%2C+Ellsworth&rft.aulast=Calvert&rft.aufirst=Jean-Christophe&rft.date=2002-01-01&rft.volume=2002%2C+Volume+2&rft.issue=&rft.spage=1155&rft.isbn=078037536X&rft.btitle=&rft.title=International+Geoscience+and+Remote+Sensing+Symposium&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - 2002 IEEE international geoscience and remote sensing symposium and 24th Canadian symposium on Remote sensing N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 6 N1 - PubXState - NY N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - CODEN - #03424 N1 - SubjectsTermNotLitGenreText - airborne methods; conservation; Europe; EuroSTARRS; forests; France; geophysical methods; Iberian Peninsula; interferometry; microwave methods; moisture; monitoring; radar methods; radiometers; remote sensing; salinity; SAR; soils; Southern Europe; Spain; surveys; vegetation; Western Europe; world ocean ER - TY - JOUR T1 - A comparative analysis of Landsat TM and RADARSAT SAR signatures in restricted tidal channels AN - 51905369; 2004-005306 JF - International Geoscience and Remote Sensing Symposium AU - Donato, Timothy F AU - Lyzenga, David R AU - Yan, Xiao-Hai AU - LeDrew, Ellsworth Y1 - 2002 PY - 2002 DA - 2002 SP - 2841 EP - 2843 PB - Institute of Electrical and Electronics Engineers, New York, NY VL - 2002, Volume 5 KW - thematic mapper KW - shore features KW - imagery KW - tidal channels KW - monitoring KW - geophysical methods KW - radar methods KW - channels KW - mapping KW - satellite methods KW - environmental management KW - Landsat KW - topography KW - tidal flats KW - SAR KW - seasonal variations KW - geomorphology KW - RADARSAT KW - remote sensing KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51905369?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Geoscience+and+Remote+Sensing+Symposium&rft.atitle=A+comparative+analysis+of+Landsat+TM+and+RADARSAT+SAR+signatures+in+restricted+tidal+channels&rft.au=Donato%2C+Timothy+F%3BLyzenga%2C+David+R%3BYan%2C+Xiao-Hai%3BLeDrew%2C+Ellsworth&rft.aulast=Donato&rft.aufirst=Timothy&rft.date=2002-01-01&rft.volume=2002%2C+Volume+5&rft.issue=&rft.spage=2841&rft.isbn=&rft.btitle=&rft.title=International+Geoscience+and+Remote+Sensing+Symposium&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - 24th Canadian symposium on Remote Sensing N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2004-01-01 N1 - Number of references - 12 N1 - PubXState - NY N1 - Document feature - illus. incl. 1 table, sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - #03424 N1 - SubjectsTermNotLitGenreText - channels; environmental management; geomorphology; geophysical methods; imagery; Landsat; mapping; monitoring; radar methods; RADARSAT; remote sensing; SAR; satellite methods; seasonal variations; shore features; thematic mapper; tidal channels; tidal flats; topography ER - TY - JOUR T1 - Radiocarbon dating, chronologic framework, and changes in accumulation rates of Holocene estuarine sediments from Chesapeake Bay AN - 50906158; 2002-023428 JF - Quaternary Research AU - Colman, Steven M AU - Baucom, Pattie C AU - Bratton, John F AU - Cronin, Thomas M AU - McGeehin, John P AU - Willard, Debra A AU - Zimmerman, Andrew R AU - Vogt, Peter R Y1 - 2002/01// PY - 2002 DA - January 2002 SP - 58 EP - 70 PB - Academic Press, New York, NY VL - 57 IS - 1 SN - 0033-5894, 0033-5894 KW - United States KW - Chesapeake Bay KW - Quaternary KW - isotopes KW - sedimentation KW - Holocene KW - Cenozoic KW - estuarine sedimentation KW - radioactive isotopes KW - dates KW - sedimentation rates KW - carbon KW - sediments KW - absolute age KW - C-14 KW - Atlantic Coastal Plain KW - 24:Quaternary geology KW - 03:Geochronology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50906158?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Quaternary+Research&rft.atitle=Radiocarbon+dating%2C+chronologic+framework%2C+and+changes+in+accumulation+rates+of+Holocene+estuarine+sediments+from+Chesapeake+Bay&rft.au=Colman%2C+Steven+M%3BBaucom%2C+Pattie+C%3BBratton%2C+John+F%3BCronin%2C+Thomas+M%3BMcGeehin%2C+John+P%3BWillard%2C+Debra+A%3BZimmerman%2C+Andrew+R%3BVogt%2C+Peter+R&rft.aulast=Colman&rft.aufirst=Steven&rft.date=2002-01-01&rft.volume=57&rft.issue=1&rft.spage=58&rft.isbn=&rft.btitle=&rft.title=Quaternary+Research&rft.issn=00335894&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/00335894 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 33 N1 - PubXState - NY N1 - Document feature - illus. incl. 5 tables, sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - QRESAV N1 - SubjectsTermNotLitGenreText - absolute age; Atlantic Coastal Plain; C-14; carbon; Cenozoic; Chesapeake Bay; dates; estuarine sedimentation; Holocene; isotopes; Quaternary; radioactive isotopes; sedimentation; sedimentation rates; sediments; United States ER - TY - JOUR T1 - Navy operational models; ten years later AN - 50870922; 2007-128310 JF - Oceanography (Washington D.C.) Y1 - 2002 PY - 2002 DA - 2002 SP - 4 EP - 108 PB - Oceanography Society, Washington, DC VL - 15 IS - 1 SN - 1042-8275, 1042-8275 KW - programs KW - U. S. Navy KW - government agencies KW - U. S. Department of Defense KW - world ocean KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50870922?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Oceanography+%28Washington+D.C.%29&rft.atitle=Navy+operational+models%3B+ten+years+later&rft.au=&rft.aulast=&rft.aufirst=Marie&rft.date=2002-05-01&rft.volume=50&rft.issue=3&rft.spage=241&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geoscience+Education&rft.issn=10899995&rft_id=info:doi/ L2 - http://www.tos.org/oceanography/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2016, American Geosciences Institute. N1 - Date revised - 2007-01-01 N1 - PubXState - DC N1 - Document feature - illus. incl. tables, sketch maps N1 - SuppNotes - Individual papers within scope are cited separately N1 - Last updated - 2016-09-16 N1 - SubjectsTermNotLitGenreText - government agencies; programs; U. S. Department of Defense; U. S. Navy; world ocean ER - TY - JOUR T1 - Physisorbed water on silica at Mars temperatures AN - 50416935; 2009-056054 JF - Abstracts of Papers Submitted to the Lunar and Planetary Science Conference AU - Sutter, B AU - Sriwatanapongse, W AU - Quinn, R AU - Klug, C AU - Zent, A AU - Anonymous Y1 - 2002 PY - 2002 DA - 2002 EP - Abstract 1682 PB - Lunar and Planetary Science Conference, Houston, TX VL - 33 KW - water KW - diffusion KW - desorption KW - water vapor KW - Mars KW - relaxation KW - adsorption KW - NMR spectra KW - temperature KW - terrestrial planets KW - planets KW - silica KW - spectra KW - seasonal variations KW - diurnal variations KW - regolith KW - 04:Extraterrestrial geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50416935?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.atitle=Physisorbed+water+on+silica+at+Mars+temperatures&rft.au=Sutter%2C+B%3BSriwatanapongse%2C+W%3BQuinn%2C+R%3BKlug%2C+C%3BZent%2C+A%3BAnonymous&rft.aulast=Sutter&rft.aufirst=B&rft.date=2002-01-01&rft.volume=33&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.issn=&rft_id=info:doi/ L2 - http://www.lpi.usra.edu/meetings/lpsc2002/pdf/1682.pdf LA - English DB - GeoRef N1 - Conference title - Thirty-third lunar and planetary science conference N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2009-01-01 N1 - Number of references - 6 N1 - PubXState - TX N1 - Document feature - illus. incl. 1 table N1 - SuppNotes - Accessed on Jan. 27, 2009 N1 - Last updated - 2012-06-07 N1 - CODEN - #02179 N1 - SubjectsTermNotLitGenreText - adsorption; desorption; diffusion; diurnal variations; Mars; NMR spectra; planets; regolith; relaxation; seasonal variations; silica; spectra; temperature; terrestrial planets; water; water vapor ER - TY - JOUR T1 - Buried impact basins as constraints on the thickness of ridged plains and northern lowland plains on Mars AN - 50416906; 2009-056046 JF - Abstracts of Papers Submitted to the Lunar and Planetary Science Conference AU - Frey, H V AU - Roark, J H AU - Hohner, G J AU - Wernecke, A AU - Sakimoto, S E H AU - Anonymous Y1 - 2002 PY - 2002 DA - 2002 EP - Abstract 1894 PB - Lunar and Planetary Science Conference, Houston, TX VL - 33 KW - ridged plains KW - impact features KW - northern lowlands KW - Mars KW - Lunae Planum KW - terrestrial planets KW - quasi-circular depressions KW - planets KW - Xanthe Terra KW - topography KW - depressions KW - basins KW - thickness KW - MOLA KW - impact craters KW - buried features KW - 04:Extraterrestrial geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50416906?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.atitle=Buried+impact+basins+as+constraints+on+the+thickness+of+ridged+plains+and+northern+lowland+plains+on+Mars&rft.au=Frey%2C+H+V%3BRoark%2C+J+H%3BHohner%2C+G+J%3BWernecke%2C+A%3BSakimoto%2C+S+E+H%3BAnonymous&rft.aulast=Frey&rft.aufirst=H&rft.date=2002-01-01&rft.volume=33&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.issn=&rft_id=info:doi/ L2 - http://www.lpi.usra.edu/meetings/lpsc2002/pdf/1894.pdf LA - English DB - GeoRef N1 - Conference title - Thirty-third lunar and planetary science conference N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2009-01-01 N1 - Number of references - 5 N1 - PubXState - TX N1 - Document feature - sketch maps N1 - SuppNotes - Accessed on Jan. 27, 2009 N1 - Last updated - 2012-06-07 N1 - CODEN - #02179 N1 - SubjectsTermNotLitGenreText - basins; buried features; depressions; impact craters; impact features; Lunae Planum; Mars; MOLA; northern lowlands; planets; quasi-circular depressions; ridged plains; terrestrial planets; thickness; topography; Xanthe Terra ER - TY - JOUR T1 - Transmission electron microscopy of an in situ presolar silicon carbide grain AN - 50403135; 2009-065763 JF - Abstracts of Papers Submitted to the Lunar and Planetary Science Conference AU - Stroud, Rhonda M AU - O'Grady, Megan AU - Nittler, Larry R AU - Alexander, Conel M O'D AU - Anonymous Y1 - 2002 PY - 2002 DA - 2002 EP - Abstract 1785 PB - Lunar and Planetary Science Conference, Houston, TX VL - 33 KW - stony meteorites KW - in situ KW - microstructure KW - crystal structure KW - native elements KW - focused ion beam methods KW - carbonaceous chondrites KW - carbides KW - TEM data KW - Cold Bokkeveld Meteorite KW - meteorites KW - graphite KW - sample preparation KW - silicon carbide KW - presolar grains KW - alloys KW - CM chondrites KW - chondrites KW - 05B:Petrology of meteorites and tektites UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50403135?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.atitle=Transmission+electron+microscopy+of+an+in+situ+presolar+silicon+carbide+grain&rft.au=Stroud%2C+Rhonda+M%3BO%27Grady%2C+Megan%3BNittler%2C+Larry+R%3BAlexander%2C+Conel+M+O%27D%3BAnonymous&rft.aulast=Stroud&rft.aufirst=Rhonda&rft.date=2002-01-01&rft.volume=33&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.issn=&rft_id=info:doi/ L2 - http://www.lpi.usra.edu/meetings/lpsc2002/pdf/1785.pdf LA - English DB - GeoRef N1 - Conference title - Thirty-third lunar and planetary science conference N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. N1 - Date revised - 2009-01-01 N1 - Number of references - 11 N1 - PubXState - TX N1 - Document feature - illus. N1 - Last updated - 2014-03-14 N1 - CODEN - #02179 N1 - SubjectsTermNotLitGenreText - alloys; carbides; carbonaceous chondrites; chondrites; CM chondrites; Cold Bokkeveld Meteorite; crystal structure; focused ion beam methods; graphite; in situ; meteorites; microstructure; native elements; presolar grains; sample preparation; silicon carbide; stony meteorites; TEM data ER - TY - JOUR T1 - Polytype distribution in presolar SiC; microstructural characterization by transmission electron microscopy AN - 50399695; 2009-065764 JF - Abstracts of Papers Submitted to the Lunar and Planetary Science Conference AU - Daulton, T L AU - Bernatowicz, T J AU - Lewis, R S AU - Messenger, S AU - Stadermann, F J AU - Amari, S AU - Anonymous Y1 - 2002 PY - 2002 DA - 2002 EP - Abstract 1127 PB - Lunar and Planetary Science Conference, Houston, TX VL - 33 KW - stony meteorites KW - grain size KW - characterization KW - crystal structure KW - carbonaceous chondrites KW - carbides KW - TEM data KW - Murchison Meteorite KW - polytypism KW - ultrastructure KW - meteorites KW - size distribution KW - silicon carbide KW - presolar grains KW - alloys KW - CM chondrites KW - chondrites KW - 05B:Petrology of meteorites and tektites UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50399695?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.atitle=Polytype+distribution+in+presolar+SiC%3B+microstructural+characterization+by+transmission+electron+microscopy&rft.au=Daulton%2C+T+L%3BBernatowicz%2C+T+J%3BLewis%2C+R+S%3BMessenger%2C+S%3BStadermann%2C+F+J%3BAmari%2C+S%3BAnonymous&rft.aulast=Daulton&rft.aufirst=T&rft.date=2002-01-01&rft.volume=33&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Abstracts+of+Papers+Submitted+to+the+Lunar+and+Planetary+Science+Conference&rft.issn=&rft_id=info:doi/ L2 - http://www.lpi.usra.edu/meetings/lpsc2002/pdf/1127.pdf LA - English DB - GeoRef N1 - Conference title - Thirty-third lunar and planetary science conference N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2009-01-01 N1 - Number of references - 21 N1 - PubXState - TX N1 - Document feature - illus. incl. 1 table N1 - Last updated - 2012-06-07 N1 - CODEN - #02179 N1 - SubjectsTermNotLitGenreText - alloys; carbides; carbonaceous chondrites; characterization; chondrites; CM chondrites; crystal structure; grain size; meteorites; Murchison Meteorite; polytypism; presolar grains; silicon carbide; size distribution; stony meteorites; TEM data; ultrastructure ER - TY - JOUR T1 - Generation of mesoscopic patterns of viable Escherichia coli by ambient laser transfer AN - 18699957; 5583850 AB - We have generated mesoscopic patterns of viable Escherichia coli on Si(1 1 1), glass, and nutrient agar plates by using a novel laser-based transfer process termed matrix assisted pulsed laser evaporation direct write (MAPLE DW). We observe no alterations to the E. coli induced by the laser-material interaction or the shear forces during the transfer. Transferred E. coli patterns were observed by optical and electron microscopes, and cell viability was shown through green fluorescent protein (GFP) expression and cell culturing experiments. The transfer mechanism for our approach appears remarkably gentle and suggests that active biomaterials such as proteins, DNA and antibodies could be serially deposited adjacent to viable cells. Furthermore, this technique is a direct write technology and therefore does not involve the use of masks, etching, or other lithographic tools. JF - Biomaterials AU - Ringeisen, B R AU - Chrisey, D B AU - Pique, A AU - Young, H D AU - Modi, R AU - Bucaro, M AU - Jones-Meehan, J AU - Spargo, B J AD - Plasma Processing Section/Code 6372, Naval Research Laboratory, Washington, DC 20375, USA, ringeisn@ccs.nrl.navy.mil Y1 - 2002/01/01/ PY - 2002 DA - 2002 Jan 01 SP - 161 EP - 166 VL - 23 IS - 1 SN - 0142-9612, 0142-9612 KW - green fluorescent protein KW - Biotechnology and Bioengineering Abstracts; Bioengineering Abstracts; Microbiology Abstracts B: Bacteriology KW - J 02910:Miscellaneous topics KW - W 30965:Miscellaneous, Reviews KW - W4 320:Cell Culture & Batch Fermentation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18699957?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biomaterials&rft.atitle=Generation+of+mesoscopic+patterns+of+viable+Escherichia+coli+by+ambient+laser+transfer&rft.au=Ringeisen%2C+B+R%3BChrisey%2C+D+B%3BPique%2C+A%3BYoung%2C+H+D%3BModi%2C+R%3BBucaro%2C+M%3BJones-Meehan%2C+J%3BSpargo%2C+B+J&rft.aulast=Ringeisen&rft.aufirst=B&rft.date=2002-01-01&rft.volume=23&rft.issue=1&rft.spage=161&rft.isbn=&rft.btitle=&rft.title=Biomaterials&rft.issn=01429612&rft_id=info:doi/10.1016%2FS0142-9612%2801%2900091-6 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 DO - http://dx.doi.org/10.1016/S0142-9612(01)00091-6 ER - TY - JOUR T1 - Development and Validation of Corridor Flow Submodel for CFAST AN - 18658999; 5555839 AB - The modeling of fire and smoke spread is an evolving field. As knowledge is acquired and resources become available, models are enhanced to make their predictions more accurate and/or their computations faster. This paper will discuss the Consolidated Fire and Smoke Transport (CFAST) zone fire model, developed by the National Institute of Standards and Technology (NIST), and a recent addition to that model, referred to as the Corridor Flow Submodel. The goal of this new submodel is to more accurately predict the flow of smoke down a corridor which has an impact on fire protection issues such as detection and escape time. Prior to the addition of this new submodel, CFAST assumed that smoke traveled instantly from one side of a compartment to another. Development of the submodel will be discussed and then the enhanced CFAST, Version 4.0.1 (executable dated 3/8/00), will be used to model a real-scale experiment conducted onboard the ex-USS SHADWELL, the Navy's R&D Damage Control platform. JF - Journal of Fire Protection Engineering AU - Bailey, J L AU - Forney, G P AU - Tatem, P A AU - Jones, W W AD - Naval Research Laboratory, 4555 Overlook Ave. SW, Washington, D.C. 20375 USA, jbailey@castor.nrl.navy.mil Y1 - 2002 PY - 2002 DA - 2002 SP - 139 EP - 161 VL - 12 IS - 3 SN - 1042-3915, 1042-3915 KW - Health & Safety Science Abstracts KW - H 7000:Fire Safety UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18658999?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Fire+Protection+Engineering&rft.atitle=Development+and+Validation+of+Corridor+Flow+Submodel+for+CFAST&rft.au=Bailey%2C+J+L%3BForney%2C+G+P%3BTatem%2C+P+A%3BJones%2C+W+W&rft.aulast=Bailey&rft.aufirst=J&rft.date=2002-01-01&rft.volume=12&rft.issue=3&rft.spage=139&rft.isbn=&rft.btitle=&rft.title=Journal+of+Fire+Protection+Engineering&rft.issn=10423915&rft_id=info:doi/10.1106%2F104239102028761 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 DO - http://dx.doi.org/10.1106/104239102028761 ER - TY - JOUR T1 - Waves and Currents During a Winter Cold Front in the Mississippi Bight, Gulf of Mexico: Implications for Barrier Island Erosion AN - 18642531; 5538909 AB - This study uses numerical models to predict waves and currents in the Mississippi Bight, Gulf of Mexico, for the period 4 to 7 March 1997, during which time a cold front passed over the region. The models are validated using observations from the area. The simulated waves and currents are used to infer littoral transport paths along the soundside of the barrier islands fronting Mississippi Sound and Chandeleur Sound. Predicted waves along the soundside of the barriers reach heights of 0.9 m with wave periods less than 4 s. These steep waves are important for eroding the soundside of the barrier islands. Currents near the barrier islands within Mississippi Sound are dominated by tidal flow. Consequently, shoreface transport within this estuary is sensitive to the tidal stage as well as wind direction and strength. Wave-driven littoral transport cells within Mississippi Sound are inferred to have been eastward during the frontal passage phase and westward as the wind became northeasterly during the post-frontal phase. This result suggests that sediment eroded from the barrier islands was continuously transported into tidal inlets. The model results also suggest that a southward wave-driven longshore drift cell was established along the soundside margin of the Chandeleur Island chain, with spillover onto the Gulf side of the southern islands. JF - Journal of Coastal Research AU - Keen, T R AD - Naval Research Laboratory, Oceanography Division, Stennis Space Center, MS 39529, USA, keen@nrlssc.navy.mil Y1 - 2002///0, PY - 2002 DA - 0, 2002 SP - 622 EP - 636 VL - 18 IS - 4 SN - 0749-0208, 0749-0208 KW - Mexico Gulf KW - USA, Louisiana, Chandeleur Sound KW - USA, Mississippi Bight KW - USA, Mississippi Sound KW - ASFA 2: Ocean Technology Policy & Non-Living Resources; Oceanic Abstracts; Water Resources Abstracts KW - Mathematical Models KW - Winds KW - ASW, USA, Louisiana, Chandeleur Sound KW - Sounds KW - Waves KW - Sediment transport KW - ASW, USA, Mississippi Sound KW - Sediment Erosion KW - Sediment Transport KW - Marine KW - Weather KW - Coastal erosion KW - Bights KW - Water Currents KW - ASW, USA, Gulf Coast KW - ASW, USA, Mississippi Bight KW - Barrier Islands KW - Model Studies KW - ASW, Mexico Gulf KW - Ocean currents KW - Erosion KW - Wave action KW - Barrier islands KW - Q2 09264:Sediments and sedimentation KW - O 3050:Sediment Dynamics KW - SW 0870:Erosion and sedimentation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18642531?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Coastal+Research&rft.atitle=Waves+and+Currents+During+a+Winter+Cold+Front+in+the+Mississippi+Bight%2C+Gulf+of+Mexico%3A+Implications+for+Barrier+Island+Erosion&rft.au=Keen%2C+T+R&rft.aulast=Keen&rft.aufirst=T&rft.date=2002-01-01&rft.volume=18&rft.issue=4&rft.spage=622&rft.isbn=&rft.btitle=&rft.title=Journal+of+Coastal+Research&rft.issn=07490208&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Ocean currents; Weather; Erosion; Wave action; Coastal erosion; Winds; Sediment transport; Barrier islands; Sediment Transport; Sediment Erosion; Mathematical Models; Bights; Water Currents; Sounds; Waves; Model Studies; Barrier Islands; ASW, Mexico Gulf; ASW, USA, Gulf Coast; ASW, USA, Louisiana, Chandeleur Sound; ASW, USA, Mississippi Sound; ASW, USA, Mississippi Bight; Marine ER - TY - JOUR T1 - POR structural domains important for the enzyme activity in R. capsulatus complementation system AN - 18627643; 5536164 AB - NADPH:protochlorophyllide oxidoreductase (POR) catalyzes hydrogen transfer from NADPH to protochlorophyllide (PChlide) in the course of chlorophyll biosynthesis in photosynthetic organisms and is involved in the regulation of the development of photosynthetic apparatus in higher plants, algae and cyanobacteria. To approach molecular factors determining the enzyme activity in a living cell, several mutants of POR from pea (Pisum sativum) with site-directed modifications in different parts of the enzyme were generated. The mutant enzymes were expressed in a R. capsulatus mutant deficient in BChl biosynthesis, and their catalytic activity and ability to integrate in bacterial metabolism were analyzed. Our results demonstrate that in heterologous bacterial cell system, higher plant POR is integrated in the porphyrin biosynthesis network and its activity leads to the formation of photosynthetic chlorophyll-proteins (CPs). The study of POR mutants in R. capsulatus reveals several POR domains important for the association of the enzyme with other subcellular components and for its catalytic activity, including identification of putative enzyme reaction center and substrate binding site. The study also demonstrated that an unknown structural factor is important for the formation of the enzyme photoactive complex in etiolated plants. Moreover, our findings suggest that POR might be directly involved in the regulation of the metabolism of other porphyrins. JF - Photosynthesis Research AU - Lebedev, N AU - Timko, M P AD - Department of Biology, University of Virginia, Charlottesville, VA 22901, USA; Center for BioMolecular Science and Engineering, US Naval Research Laboratory, 4555 Overlook Ave., SW, Washington, DC 20375-5348, USA, ln4u@virginia.edu Y1 - 2002 PY - 2002 DA - 2002 SP - 153 EP - 163 PB - Kluwer Academic Publishers VL - 74 IS - 2 SN - 0166-8595, 0166-8595 KW - Protochlorophyllide reductase KW - structural domains KW - ASFA 1: Biological Sciences & Living Resources; Microbiology Abstracts B: Bacteriology KW - Porphyrins KW - Protein synthesis KW - Chlorophylls KW - Rhodobacter capsulatus KW - Photosynthesis KW - Enzymes KW - Active sites KW - Mutants KW - Q1 08206:Physiology, biochemistry, biophysics KW - J 02728:Enzymes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18627643?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Photosynthesis+Research&rft.atitle=POR+structural+domains+important+for+the+enzyme+activity+in+R.+capsulatus+complementation+system&rft.au=Lebedev%2C+N%3BTimko%2C+M+P&rft.aulast=Lebedev&rft.aufirst=N&rft.date=2002-01-01&rft.volume=74&rft.issue=2&rft.spage=153&rft.isbn=&rft.btitle=&rft.title=Photosynthesis+Research&rft.issn=01668595&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Chlorophylls; Protein synthesis; Porphyrins; Photosynthesis; Enzymes; Protochlorophyllide reductase; Active sites; Mutants; Rhodobacter capsulatus ER - TY - JOUR T1 - Coastal optical properties estimated from airborne sensors Reply to the comments by Hu and Carder AN - 18570406; 5353262 AB - Gould and Arnone [Remote Sens. Environ. 61 (1997) 290] characterized the spatial and temporal variability of inherent optical properties (water absorption and scattering coefficients) in a coastal region using in situ shipboard and moored optical data, and high-resolution aircraft ocean color imagery. Following atmospheric correction of the aircraft imagery, they applied a bio-optical model [Carder et al., 1999, J. Geophys. Res. 104 (C3) (1999) 5403] to the image data to produce surface maps of absorption and scattering coefficients. The results from the model were compared with in situ measurements and adjustments were made to two model parameters to force the model results to more closely match the in situ measurements. Hu and Carder [Remote Sens. Environ. (2001)] raise questions concerning (a) the atmospheric correction applied to the aircraft data and (b) the reason for adjusting the parameters of the bio-optical model. Here we respond to their comments. JF - Remote Sensing of Environment AU - Gould, R W AU - Arnone, R A AD - Naval Research Laboratory, Ocean Sciences Branch, Code 7333, Stennis Space Center, MS 39529, USA, gould@nrlssc.navy.mil Y1 - 2002/01// PY - 2002 DA - January 2002 SP - 138 EP - 142 VL - 79 IS - 1 SN - 0034-4257, 0034-4257 KW - Models KW - Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Remote Sensing KW - Buoy oceanographic measurements KW - Airborne sensing KW - Optical properties KW - Estuaries KW - Water Quality KW - Light scattering KW - Coastal waters KW - Color KW - Light absorption KW - Light absorption in seawater determination KW - Oceans KW - Analytical techniques KW - Optical properties of coastal waters KW - Shipborne radiometers KW - Optical Properties KW - Light scattering in sea KW - Airborne oceanographic instruments KW - Bio-optical properties of seawater KW - O 2090:Instruments/Methods KW - SW 5040:Data acquisition KW - M2 551.468:Coastal Oceanography (551.468) KW - Q2 09222:Methods and instruments KW - M2 551.463.5:Radiation and optical properties of sea water (551.463.5) KW - M2 551.460.083:Instruments for measuring physical quantities in sea water (551.460.083) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18570406?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Remote+Sensing+of+Environment&rft.atitle=Coastal+optical+properties+estimated+from+airborne+sensors+Reply+to+the+comments+by+Hu+and+Carder&rft.au=Gould%2C+R+W%3BArnone%2C+R+A&rft.aulast=Gould&rft.aufirst=R&rft.date=2002-01-01&rft.volume=79&rft.issue=1&rft.spage=138&rft.isbn=&rft.btitle=&rft.title=Remote+Sensing+of+Environment&rft.issn=00344257&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Light absorption; Airborne sensing; Optical properties; Analytical techniques; Light scattering; Coastal waters; Buoy oceanographic measurements; Light absorption in seawater determination; Shipborne radiometers; Optical properties of coastal waters; Light scattering in sea; Bio-optical properties of seawater; Airborne oceanographic instruments; Remote Sensing; Oceans; Estuaries; Water Quality; Optical Properties; Color ER - TY - JOUR T1 - Ship wakes and their radar images AN - 18564582; 5322606 AB - Remote observations of a surface ship wake using synthetic aperture radar (SAR) show distinct features such as a dark trailing centerline region, bright V-images aligned at some angle to the ship's path, and, sometimes, either the transverse or the diverging waves of the Kelvin-wave pattern. The dark region of relatively low radar backscatter is usually associated with a region that is relatively lacking in short wave components, whereas the bright line feature suggests a region of enhanced radar return within the apparent angular confines of the ship's usual Kelvin-wave pattern. This review provides a survey of remotely sensed wake images, the systems that have collected these images, and an overview of the theory of Kelvin wakes - a primary source of the phenomena that cause the dark centerline and bright V-images - with example predictions. The review concludes with a survey of the phenomena that cause the dark centerline returns and some example predictions of the radar reflectivity across these dark centerline returns. JF - Annual Review of Fluid Mechanics AU - Reed, A M AU - Milgram, J H AD - David Taylor Model Basin, Carderock Division, Naval Surface Warfare Center, West Bethesda, MD 20817, USA, ReedAM@nswccd.navy.mil Y1 - 2002 PY - 2002 DA - 2002 SP - 469 EP - 502 VL - 34 SN - 0066-4189, 0066-4189 KW - Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Ships KW - Marine KW - Wakes KW - Ship motion KW - Remote sensing KW - Brackish KW - Freshwater KW - Fluid Mechanics KW - Boats KW - Literature reviews KW - Synthetic aperture radar KW - Radar KW - Kelvin waves KW - SW 5040:Data acquisition KW - Q2 09301:Surface vehicles UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18564582?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Annual+Review+of+Fluid+Mechanics&rft.atitle=Ship+wakes+and+their+radar+images&rft.au=Reed%2C+A+M%3BMilgram%2C+J+H&rft.aulast=Reed&rft.aufirst=A&rft.date=2002-01-01&rft.volume=34&rft.issue=&rft.spage=469&rft.isbn=&rft.btitle=&rft.title=Annual+Review+of+Fluid+Mechanics&rft.issn=00664189&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Ships; Wakes; Boats; Literature reviews; Synthetic aperture radar; Ship motion; Remote sensing; Kelvin waves; Radar; Fluid Mechanics; Freshwater; Brackish; Marine ER - TY - JOUR T1 - Weighing the evidence of ecological risk from chemical contamination in the estuarine environment adjacent to the Portsmouth Naval Shipyard, Kittery, Maine, USA AN - 18403691; 5388681 AB - In characterizing ecological risks, considerable consensus building and professional judgments are required to develop conclusions about risk. This is because how to evaluate all the factors that determine ecological risk is not well defined and is subject to interpretation. Here we report on the application of a procedure to weigh the evidence of ecological risk and develop conclusions about risk that will incorporate the strengths and weaknesses of the assessment. The procedure was applied to characterize ecological risk of chemical contamination in nearshore areas adjacent to the Portsmouth Naval Shipyard, located at the mouth of the Great Bay Estuary, New Hampshire and Maine, USA. Measures of exposure and effect were used to interpret the magnitude of risk to the assessment endpoints of pelagic species, epibenthic species, the benthic community, eelgrass plants, the salt marsh community, and avian receptors. The evidence of chemical exposure from water, sediment, and tissue and the evidence of biological effects to representative pelagic, epibenthic, benthic, eelgrass, salt marsh, and avian species were weighed to characterize ecological risk. Individual measures were weighted by the quality and reliability of their data and risk was estimated from the preponderance, magnitude, extent, and strength of causal relationships between the data on exposure and effects. Relating evidence of risk to hypothesized pathways of exposure made it possible to estimate the magnitude of risk from sediment and water and express the confidence associated with the findings. Systematically weighing the evidence of risk rendered conclusions about risk in a manner that was clearly defined, objective, consistent, and did not rely solely on professional judgment. JF - Environmental Toxicology and Chemistry AU - Johnston, R K AU - Munns, WR Jr AU - Tyler, P L AU - Marajh-Whittemore, P AU - Finkelstein, K AU - Munney, K AU - Short, F T AU - Melville, A AU - Hahn, S P AD - Marine Environmental Support Office, Space and Naval Warfare Systems Center D3621, San Diego, California 92152-6326, USA, johnston@spawar.navy.mil Y1 - 2002/01// PY - 2002 DA - Jan 2002 SP - 182 EP - 194 VL - 21 IS - 1 SN - 0730-7268, 0730-7268 KW - Portsmouth Naval Shipyard KW - USA, Maine, Great Bay Estuary KW - USA, New Hampshire, Great Bay Estuary KW - ASFA 3: Aquatic Pollution & Environmental Quality; Oceanic Abstracts; Aqualine Abstracts; Ecology Abstracts; Pollution Abstracts; Toxicology Abstracts; Water Resources Abstracts KW - Marine KW - X 24240:Miscellaneous KW - O 4020:Pollution - Organisms/Ecology/Toxicology KW - D 04803:Pollution effects KW - P 1000:MARINE POLLUTION KW - AQ 00008:Effects of Pollution KW - SW 3030:Effects of pollution KW - Q5 01504:Effects on organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18403691?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Toxicology+and+Chemistry&rft.atitle=Weighing+the+evidence+of+ecological+risk+from+chemical+contamination+in+the+estuarine+environment+adjacent+to+the+Portsmouth+Naval+Shipyard%2C+Kittery%2C+Maine%2C+USA&rft.au=Johnston%2C+R+K%3BMunns%2C+WR+Jr%3BTyler%2C+P+L%3BMarajh-Whittemore%2C+P%3BFinkelstein%2C+K%3BMunney%2C+K%3BShort%2C+F+T%3BMelville%2C+A%3BHahn%2C+S+P&rft.aulast=Johnston&rft.aufirst=R&rft.date=2002-01-01&rft.volume=21&rft.issue=1&rft.spage=182&rft.isbn=&rft.btitle=&rft.title=Environmental+Toxicology+and+Chemistry&rft.issn=07307268&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Marine ER - TY - JOUR T1 - Antimicrobial constituents from the stem bark of Feronia limonia AN - 18383413; 5349507 AB - The stem bark of Feronia limonia (Fam. Rutaceae) yielded (-)-(2S)-5,3'-dihydroxy-4'-methoxy-6 double prime , 6 double prime -dimethylchromeno-(7,8,2 double prime ,3 double prime )-flavanone along with several known compounds including an alkaloid, five coumarins, a flavanone, a lignan, three sterols and a triterpene. The structures of these compounds were determined by spectroscopic methods, mainly 1D and 2D NMR. The antimicrobial screening of compounds by a microdilution technique resulted in MICs in the range 25-100 mu g/ml. Other biological activities of the known compounds are also discussed. JF - Phytochemistry AU - Rahman, M M AU - Gray, AI AD - Department of Pharmaceutical Sciences, University of Strathclyde, SIBS Building, 27 Taylor Street, Glasgow G4 ONR, UK, a.i.gray@strath.ac.uk Y1 - 2002/01// PY - 2002 DA - Jan 2002 SP - 73 EP - 77 VL - 59 IS - 1 SN - 0031-9422, 0031-9422 KW - Microbiology Abstracts A: Industrial & Applied Microbiology KW - A 01069:Antimicrobial & microbiocidal UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18383413?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Phytochemistry&rft.atitle=Antimicrobial+constituents+from+the+stem+bark+of+Feronia+limonia&rft.au=Rahman%2C+M+M%3BGray%2C+AI&rft.aulast=Rahman&rft.aufirst=M&rft.date=2002-01-01&rft.volume=59&rft.issue=1&rft.spage=73&rft.isbn=&rft.btitle=&rft.title=Phytochemistry&rft.issn=00319422&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - The effects of biological and hydrodynamic processes on physical and acoustic properties of sediments off the Eel River, California AN - 18381445; 5370341 AB - The spatial trends in surficial sediment macro- and microstructure and the resultant values of sediment physical and geoacoustic properties are controlled by the water-depth-dependent interplay of biological, depositional and hydrodynamic processes along shore-normal (25-100 m water depth) and shore-parallel (70-m contour) transects north of the Eel River, northern California. Values of sediment compressional and shear wave speed, porosity, bulk density, mean grain size, and shear strength cluster within reasonably well defined surficial sediment facies: inshore sands (21-42 m water depth), offshore muds (90-100 m), flood deposits (57-80 m), and transition sediments between flood deposits and inshore sands (47-57 m). Statistical relationships among seafloor impedance (calculated from in situ and laboratory measurements or measured remotely by acoustic methods), sediment physical properties, and geoacoustic properties are sufficiently robust to allow prediction with confidence. The high local spatial variability in values of sediment physical and geoacoustic properties reflects the variability in macro- and microstructure exhibited in X-radiographs and CT imagery. Large-scale distribution of sedimentary facies is controlled by flood deposition from the Eel River and subsequent remobilization by hydrodynamic processes. High local variability in sediment properties occurs where no single process is consistently dominant (transition sediments). The high variability of seafloor properties in flood deposits reflects the high structural heterogeneity associated with the interaction among numerous flood deposits, resuspension and redeposition of flood deposits by surface gravity waves, and mixing by bioturbation. Faunal reworking of sediments rapidly (<1 yr) compacts the sediment, destroys surficial layering, subdues vertical gradients in sediment properties created from flood deposits, and breaches flood layer horizons. High sediment permeability (created by numerous burrows and tubes) promotes sediment dewatering and exchange of pore fluids, the respective consequences of which are rapid consolidation of the sediment after deposition of flood deposits. JF - Marine Geology AU - Richardson, MD AU - Briggs, K B AU - Bentley, S J AU - Walter, D J AD - Seafloor Sciences Branch, Naval Research Laboratory, 39529 Stennis Space Center, MS USA Y1 - 2001/12/30/ PY - 2001 DA - 2001 Dec 30 SP - 121 EP - 139 PB - Elsevier Science VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Oceanic Abstracts KW - Marine KW - O 3050:Sediment Dynamics KW - Q2 02264:Sediments and sedimentation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18381445?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=The+effects+of+biological+and+hydrodynamic+processes+on+physical+and+acoustic+properties+of+sediments+off+the+Eel+River%2C+California&rft.au=Richardson%2C+MD%3BBriggs%2C+K+B%3BBentley%2C+S+J%3BWalter%2C+D+J&rft.aulast=Richardson&rft.aufirst=MD&rft.date=2001-12-30&rft.volume=182&rft.issue=1-2&rft.spage=121&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Marine ER - TY - JOUR T1 - Sediment facies determination using acoustic techniques in a shallow-water carbonate environment, Dry Tortugas, Florida AN - 18379678; 5370343 AB - Two high-frequency acoustic seafloor classification systems (12- and 15-kHz) were used in conjunction with sediment core analysis to characterize sediment facies at a study site near Garden Key in Dry Tortugas, Florida. The acoustic system uses echo return amplitude to compute acoustic impedance that is then correlated with sampled sediment impedance values calculated from wet bulk density and compressional wave velocity. Several bottom provinces were identified using the 15-kHz data to construct a real-time map of ship tracks in colors that represent the surficial sediment facies type. Sediment facies over the entire study site (36 km super(2)) range from sandy silts to exposed limestone rock and coral reef structures. Color contour maps using the 12-kHz data, created after correlating acoustic impedance predictions with core measured sediment properties, validates the initial facies pattern predictions made in real-time. The sediment facies patterns indicate a long-term pattern of deposition of fine-grained, silt-sized, surficial sediments in an area adjacent to the emergent carbonate embankment. Two-dimensional acoustic profiles along survey tracklines also provide cross-sectional views of seafloor and subbottom stratigraphy that confirm the buildup of these fine sediments in the northwest corner of the study site. A generous supply of sediment resulting from an abundance of benthic green algae (Halimeda sp.) on adjacent shallow platforms form a thick sequence of fine sandy silt at the base of the southeastern edge of the embankment and fringing reef. Sediment cover over the limestone bedrock thins and becomes coarse southeast of Garden and Bush Keys, suggesting the likely existence of a dominant flow around the shallow carbonate embankment that restricts export of fine sediments out of the area. JF - Marine Geology AU - Walter, D J AU - Lambert, D N AU - Young, D C AD - Naval Research Laboratory, Marine Geosciences Division/Code 7431, 39529 Stennis Space Center, MS USA Y1 - 2001/12/30/ PY - 2001 DA - 2001 Dec 30 SP - 161 EP - 177 PB - Elsevier Science VL - 182 IS - 1-2 SN - 0025-3227, 0025-3227 KW - Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Oceanic Abstracts KW - Marine KW - O 3050:Sediment Dynamics KW - Q2 02265:Sedimentary structures and stratigraphy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18379678?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geology&rft.atitle=Sediment+facies+determination+using+acoustic+techniques+in+a+shallow-water+carbonate+environment%2C+Dry+Tortugas%2C+Florida&rft.au=Walter%2C+D+J%3BLambert%2C+D+N%3BYoung%2C+D+C&rft.aulast=Walter&rft.aufirst=D&rft.date=2001-12-30&rft.volume=182&rft.issue=1-2&rft.spage=161&rft.isbn=&rft.btitle=&rft.title=Marine+Geology&rft.issn=00253227&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Marine ER - TY - JOUR T1 - Interpretation of the spectra of energy scattered by dispersed anchovies. AN - 85364896; pmid-11785792 AB - The spectra of backscattered energy by dispersed anchovies, which were reported by Holliday (1972), reveal several peaks at frequencies that correspond to theoretically calculated resonance frequencies of year classes of anchovies. Theoretical calculations are based on concurrent measurements of distributions of swim bladder dimensions and a modified form of Minnaert's (1933) equation. Differences between calculated and measured values of the mean lengths of the second-, third-, and fourth-year classes are within experimental uncertainties (+/-8%). The calculated mean lengths of juvenile anchovies are in good agreement with historical measurements of the bounds on this parameter (Butler, 1989). Matching of theoretical calculations and measurements of backscattered energy level versus frequency yields estimates of the total Q of the spectral line, QT, and the relative number density per year class. The resultant estimate of QT of adult anchovies is approximately 4.4. This value of QT is consistent with laboratory measurements of the Q of individual anchovies. Q0 (approximately 7 at 15 m) and measurements of length distributions of year classes and depth distributions. Resultant estimates of relative number densities of year classes were consistent with historical measurements of the relative number densities of year classes of anchovies in the Southern California Bight. JF - The Journal of the Acoustical Society of America AU - Diachok, O AD - Naval Research Laboratory, Washington, DC 20375, USA. orest@wave.nrl.navy.mil Y1 - 2001/12// PY - 2001 DA - Dec 2001 SP - 2917 EP - 2923 VL - 110 IS - 6 SN - 0001-4966, 0001-4966 KW - Index Medicus KW - National Library of Medicine KW - Acoustics KW - Animals KW - *Energy Metabolism: physiology KW - *Energy Transfer: physiology KW - *Fishes: physiology KW - *Models, Biological UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85364896?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Interpretation+of+the+spectra+of+energy+scattered+by+dispersed+anchovies.&rft.au=Diachok%2C+O&rft.aulast=Diachok&rft.aufirst=O&rft.date=2001-12-01&rft.volume=110&rft.issue=6&rft.spage=2917&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Small-slope scattering from rough elastic ocean floors: general theory and computational algorithm. AN - 85362555; pmid-11785790 AB - In this article acoustic scattering by a random rough interface that separates a fluid incident medium from an underlying uniform scattering medium, either fluid or elastic solid, in cases for which the Bragg scale lies within the power-law tail of the roughness spectrum is dealt with. The physical foundation is an inherently reciprocity-preserving, local small-slope theory. A fully bistatic formulation is developed for the scattering strength, together with a robust numerical implementation that allows a wide range of spectral exponent values. The practical result for ocean acoustics is a significantly improved description of the interface component of sea floor scattering. Calculations are presented to demonstrate the advantage of this approach over perturbation theory, and to illustrate its dependence on frequency and environmental parameters as well as its operation in bistatic geometries. JF - The Journal of the Acoustical Society of America AU - Gragg, R F AU - Wurmser, D AU - Gauss, R C AD - Naval Research Laboratory, Washington, DC 20375-5350, USA. robert.gragg@nrl.navy.mil Y1 - 2001/12// PY - 2001 DA - Dec 2001 SP - 2878 EP - 2901 VL - 110 IS - 6 SN - 0001-4966, 0001-4966 KW - Index Medicus KW - National Library of Medicine KW - Acoustics KW - *Algorithms KW - *Elasticity KW - *Models, Theoretical KW - Oceans and Seas KW - *Water UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85362555?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Small-slope+scattering+from+rough+elastic+ocean+floors%3A+general+theory+and+computational+algorithm.&rft.au=Gragg%2C+R+F%3BWurmser%2C+D%3BGauss%2C+R+C&rft.aulast=Gragg&rft.aufirst=R&rft.date=2001-12-01&rft.volume=86&rft.issue=6&rft.spage=1143&rft.isbn=&rft.btitle=&rft.title=AAPG+Bulletin&rft.issn=01491423&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - On the relative role of sea-surface roughness and bubble plumes in shallow-water propagation in the low-kilohertz region. AN - 85170429; pmid-11785794 AB - In the low-kilohertz frequency range, acoustic transmission in shallow water deteriorates as wind speed increases. Although the losses can be attributed to two environmental factors, the rough sea surface and the bubbles produced when breaking- or spilling waves are present, the relative role of each is still uncertain. For simplicity, in terms of an average bubble population, the time- and space-varying assemblage of microbubbles is usually assumed to be uniform in range and referred to as "the subsurface bubble layer." However the bubble population is range- and depth-dependent. In this article, results of an experiment [Weston et al., Philos. Trans. R. Soc. London, Ser. A 265, 507-606 (1969)] involving fixed source and receivers, and observations during an extended period of time under varying weather conditions are re-examined by exercising a numerical model that allows for the dissection of the problem. Calculations are made at 2- and 4-kHz. It is shown that at these frequencies and at wind speeds capable of generating breaking waves the main mechanism responsible for the excess loss in the shallow-water waveguide is the patchy nature of the subsurface bubble field. Refraction and attenuation within the pockets of high void fraction are minor contributors to the losses. JF - The Journal of the Acoustical Society of America AU - Norton, G V AU - Novarini, J C AD - Naval Research Laboratory, Stennis Space Center, Mississippi 39529-5004, USA. PY - 2001 SP - 2946 EP - 2955 VL - 110 IS - 6 SN - 0001-4966, 0001-4966 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85170429?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=On+the+relative+role+of+sea-surface+roughness+and+bubble+plumes+in+shallow-water+propagation+in+the+low-kilohertz+region.&rft.au=Norton%2C+G+V%3BNovarini%2C+J+C&rft.aulast=Norton&rft.aufirst=G&rft.date=2001-12-01&rft.volume=110&rft.issue=6&rft.spage=2946&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English DB - ComDisDome N1 - Last updated - 2010-05-07 ER - TY - JOUR T1 - Stable carbon and nitrogen isotope analysis of TNT: two-dimensional source identification. AN - 72353811; 11764148 AB - Data from a combination of laboratory and fieldwork is presented to initiate testing of stable carbon and nitrogen isotope ratios to trace sources of TNT in contaminated soil and groundwater. Evaluation of these extraction methods resulted in 99.9 and 99.8% recovery of TNT with Soxhlet and solid-phase extraction (SPE), respectively. As a result of the high extraction efficiency, isotope fractionation did not occur, thus providing an accurate stable isotope value on TNT from laboratory and field samples. Subsequent experiments evaluated the stability of isotope signatures through incubations lasting up to four weeks with a 70% decline in the TNT concentration. During these experiments, no significant variation in stable carbon and nitrogen isotope ratios was measured. Five different sources of TNT, compared for stable carbon and nitrogen isotope ratios, showed a range of 4.2 and 15%, respectively. This large range in the isotope ratios suggests excellent potential to trace sources in a complex environment. Finally, a site was surveyed for concentrations and isotope values of TNT extracted from groundwaters. Values from this site were substantially different relative to the variation measured on standards and in laboratory incubation experiments. The data set indicates good potential to use stable isotopes to determine TNT sources and fate in the environment. JF - Environmental toxicology and chemistry AU - Coffin, R B AU - Miyares, P H AU - Kelley, C A AU - Cifuentes, L A AU - Reynolds, C M AD - Environmental Quality Sciences Section, Naval Research Laboratory, Washington, DC 20375, USA. rcoffin@ccf.nrl.navy.mil Y1 - 2001/12// PY - 2001 DA - December 2001 SP - 2676 EP - 2680 VL - 20 IS - 12 SN - 0730-7268, 0730-7268 KW - Carbon Isotopes KW - 0 KW - Nitrogen Isotopes KW - Soil Pollutants KW - Water Pollutants, Chemical KW - Trinitrotoluene KW - 118-96-7 KW - Index Medicus KW - Environmental Monitoring KW - Reference Values KW - Trinitrotoluene -- chemistry KW - Nitrogen Isotopes -- analysis KW - Water Pollutants, Chemical -- analysis KW - Nitrogen Isotopes -- chemistry KW - Carbon Isotopes -- chemistry KW - Carbon Isotopes -- analysis KW - Soil Pollutants -- analysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72353811?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+toxicology+and+chemistry&rft.atitle=Stable+carbon+and+nitrogen+isotope+analysis+of+TNT%3A+two-dimensional+source+identification.&rft.au=Coffin%2C+R+B%3BMiyares%2C+P+H%3BKelley%2C+C+A%3BCifuentes%2C+L+A%3BReynolds%2C+C+M&rft.aulast=Coffin&rft.aufirst=R&rft.date=2001-12-01&rft.volume=20&rft.issue=12&rft.spage=2676&rft.isbn=&rft.btitle=&rft.title=Environmental+toxicology+and+chemistry&rft.issn=07307268&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-03-28 N1 - Date created - 2001-12-14 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - High geothermal heat flow, basal melt, and the origin of rapid ice flow in central Greenland AN - 52132174; 2002-024705 AB - Age-depth relations from internal layering reveal a large region of rapid basal melting in Greenland. Melt is localized at the onset of rapid ice flow in the large ice stream that drains north off the summit dome and other areas in the northeast quadrant of the ice sheet. Locally, high melt rates indicate geothermal fluxes 15 to 30 times continental background. The southern limit of melt coincides with magnetic anomalies and topography that suggest a volcanic origin. JF - Science AU - Fahnestock, Mark AU - Abdalati, Waleed AU - Joughin, Ian AU - Brozena, John AU - Gogineni, Prasad Y1 - 2001/12// PY - 2001 DA - December 2001 SP - 2338 EP - 2342 PB - American Association for the Advancement of Science, Washington, DC VL - 294 IS - 5550 SN - 0036-8075, 0036-8075 KW - strain KW - Arctic region KW - Greenland ice sheet KW - radar methods KW - magnetic anomalies KW - ice cover KW - ice sheets KW - measurement KW - ice movement KW - Greenland KW - topography KW - melting KW - SAR KW - volcanism KW - sounding KW - heat flow KW - movement KW - thickness KW - glacial geology KW - central Greenland KW - meltwater KW - 24:Quaternary geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52132174?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Science&rft.atitle=High+geothermal+heat+flow%2C+basal+melt%2C+and+the+origin+of+rapid+ice+flow+in+central+Greenland&rft.au=Fahnestock%2C+Mark%3BAbdalati%2C+Waleed%3BJoughin%2C+Ian%3BBrozena%2C+John%3BGogineni%2C+Prasad&rft.aulast=Fahnestock&rft.aufirst=Mark&rft.date=2001-12-01&rft.volume=294&rft.issue=5550&rft.spage=2338&rft.isbn=&rft.btitle=&rft.title=Science&rft.issn=00368075&rft_id=info:doi/10.1126%2Fscience.1065370 L2 - http://www.sciencemag.org/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 32 N1 - PubXState - DC N1 - Document feature - illus. incl. sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - SCIEAS N1 - SubjectsTermNotLitGenreText - Arctic region; central Greenland; glacial geology; Greenland; Greenland ice sheet; heat flow; ice cover; ice movement; ice sheets; magnetic anomalies; measurement; melting; meltwater; movement; radar methods; SAR; sounding; strain; thickness; topography; volcanism DO - http://dx.doi.org/10.1126/science.1065370 ER - TY - JOUR T1 - Importance of solar subsurface heating in ocean general circulation models AN - 50152767; 2005-063070 AB - The importance of subsurface heating on surface mixed layer properties in an ocean general circulation model (OGCM) is examined using attenuation of solar irradiance with depth below the ocean surface. The depth-dependent attenuation of subsurface heating is given by global monthly mean fields for the attenuation of photosynthetically available radiation (PAR), k (sub PAR) . These global fields of k (sub PAR) are derived from Sea-viewing Wide Field-of-view Sensor (SeaWiFS) data on the spectral diffuse attenuation coefficient at 490 nm (k (sub 490) ), and have been processed to have the smoothly varying and continuous coverage necessary for use in OGCM applications. These monthly fields provide the first complete global data sets of subsurface optical fields that can be used for OGCM applications of subsurface heating and bio-optical processes. The effect on global OGCM prediction of sea surface temperature (SST) and surface mixed layer depth (MLD) is examined when solar heating, as given by monthly mean k (sub PAR) and PAR fields, is included in the model. It is found that subsurface heating yields a marked increase in the SST predictive skill of the OGCM at low latitudes. No significant improvement in MLD predictive skill is obtained when including subsurface heating. Use of the monthly mean k (sub PAR) produces an SST decrease of up to 0.8 degrees C and a MLD increase of up to only 4-5 m for climatological surface forcing, with this primarily confined to the equatorial regions. Remarkably, a constant k (sub PAR) value of 0.06 m (super -1) , which is indicative of optically clear open ocean conditions, is found to serve very well for OGCM prediction of SST and MLD over most of the global ocean. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Rochford, Peter A AU - Kara, A Birol AU - Wallcraft, Alan J AU - Arnone, Robert A Y1 - 2001/12// PY - 2001 DA - December 2001 SP - 30 EP - 30,938 PB - American Geophysical Union, Washington, DC VL - 106 IS - C12 SN - 0148-0227, 0148-0227 KW - models KW - general circulation models KW - sea water KW - mixing KW - SeaWiFS KW - heating KW - sea-surface temperature KW - solar activity KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50152767?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Importance+of+solar+subsurface+heating+in+ocean+general+circulation+models&rft.au=Rochford%2C+Peter+A%3BKara%2C+A+Birol%3BWallcraft%2C+Alan+J%3BArnone%2C+Robert+A&rft.aulast=Rochford&rft.aufirst=Peter&rft.date=2001-12-01&rft.volume=106&rft.issue=C12&rft.spage=30&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC000355 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2005-01-01 N1 - Number of references - 62 N1 - PubXState - DC N1 - Document feature - illus. incl. 2 tables, 7 plates N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - general circulation models; heating; mixing; models; sea water; sea-surface temperature; SeaWiFS; solar activity DO - http://dx.doi.org/10.1029/2000JC000355 ER - TY - JOUR T1 - Determining liver stage parasite burden by real time quantitative PCR as a method for evaluating pre-erythrocytic malaria vaccine efficacy AN - 18424329; 5409274 AB - The detection and quantitation of blood stage parasitaemia is typically used as a surrogate endpoint for estimating the efficacy of vaccines targeted against the hepatic stage, as well as the erythrocytic stage, of the parasite. However, this does not provide an adequate means of evaluating the efficacy of vaccines, which may be only partially effective at the liver-stage. This is a particular concern for effective evaluation of immune enhancement strategies for candidate pre-erythrocytic stage vaccines. Here, we have developed and validated a method for detecting and quantitating liver stage parasites, using the TaqMan registered fluorescent real-time quantitative PCR system (PE Applied Biosystems). This method uses TaqMan registered primers designed to the Plasmodium yoelii 18S rRNA gene and rodent GAPDH to amplify products from infected mouse liver cDNA. The technique is highly reproducible as demonstrated with plasmid controls and capable of efficiently quantitating liver-stage parasite burden following a range of sporozoite challenge doses in strains of mice, which differ in their susceptibility to sporozoite infection. We have further demonstrated the capacity of this technique to evaluate the efficacy of a range of pre-erythrocytic stage vaccines. Our data establish this quantitative real-time PCR assay to be a fast and reproducible way of accurately assessing liver stage parasite burden and vaccine efficacy in rodent malaria models. JF - Molecular and Biochemical Parasitology AU - Witney, A A AU - Doolan, D L AU - Anthony, R M AU - Weiss, W R AU - Hoffman, S L AU - Carucci, D J AD - Malaria Program, Naval Medical Research Center, 503 Robert Grant Avenue, Room 3A4O Silver Spring, MD 20910-7500, USA, caruccid@nmrc.navy.mil Y1 - 2001/12// PY - 2001 DA - Dec 2001 SP - 233 EP - 245 VL - 118 IS - 2 SN - 0166-6851, 0166-6851 KW - mice KW - rRNA 18S KW - Microbiology Abstracts C: Algology, Mycology & Protozoology; Biochemistry Abstracts 2: Nucleic Acids; ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources KW - K 03086:Immunology & vaccination KW - Q5 01524:Public health, medicines, dangerous organisms KW - N 14610:Occurrence, isolation & assay KW - Q1 01484:Species interactions: parasites and diseases UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18424329?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Molecular+and+Biochemical+Parasitology&rft.atitle=Determining+liver+stage+parasite+burden+by+real+time+quantitative+PCR+as+a+method+for+evaluating+pre-erythrocytic+malaria+vaccine+efficacy&rft.au=Witney%2C+A+A%3BDoolan%2C+D+L%3BAnthony%2C+R+M%3BWeiss%2C+W+R%3BHoffman%2C+S+L%3BCarucci%2C+D+J&rft.aulast=Witney&rft.aufirst=A&rft.date=2001-12-01&rft.volume=118&rft.issue=2&rft.spage=233&rft.isbn=&rft.btitle=&rft.title=Molecular+and+Biochemical+Parasitology&rft.issn=01666851&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - CONF T1 - National indicator study: is an international approach feasible? AN - 18392843; 5385239 AB - The National Indicator Study (NIS) was established in the United States in 1989 with the purpose of improving the shellfish classification systems for molluscan shellfish growing waters using the latest technological advances in microbiological and epidemiological methods. A total of ten methods development projects were completed, eight addressing indicators of pathogens associated with molluscan shellfish and two with direct detection of specific viral pathogens, Norwalk and hepatitis A. In 1993, the results of all ten projects were submitted to peer review by a panel of scientists. Two of these candidate indicators were selected for further development: particulate-bound secretory immunoglobulin (sIgA) and the male-specific coliphage. This paper reviews the funded projects, the Literature Review and Manual of Methods that were funded by the study, and raises the question: should an international indicator study be pursued, by whom, and through what sources of funding? Unfortunately, the NIS was discontinued in 1994 before it achieved any quantitative information on the efficacy of these new or existing indicator methods as they might relate to the improvement of water classification procedures or health risks to consumers. JF - Journal of Shellfish Research AU - Leonard, D L Y1 - 2001/12// PY - 2001 DA - Dec 2001 SP - 1293 EP - 1298 PB - National Shellfisheries Association VL - 20 IS - 3 KW - Hepatitus A virus KW - Indicator methods KW - NOAA KW - Norwalk virus KW - ASFA Aquaculture Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources; Microbiology Abstracts A: Industrial & Applied Microbiology; Oceanic Abstracts KW - Marine KW - Q5 01524:Public health, medicines, dangerous organisms KW - Q3 01587:Diseases of Cultured Organisms KW - O 5040:Processing, Products and Marketing KW - A 01017:Human foods KW - Q1 01583:Shellfish culture UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18392843?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Shellfish+Research&rft.atitle=National+indicator+study%3A+is+an+international+approach+feasible%3F&rft.au=Leonard%2C+D+L&rft.aulast=Leonard&rft.aufirst=D&rft.date=2001-12-01&rft.volume=20&rft.issue=3&rft.spage=1293&rft.isbn=&rft.btitle=&rft.title=Journal+of+Shellfish+Research&rft.issn=07308000&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - Screening Tests for Fire Safety of Composites for Marine Applications AN - 18333443; 5388316 AB - Demands for reduced maintenance, reduced manning and reduced cost are resulting in the need for new and alternative materials for introduction in the fleet. The new materials in many cases tend to be non-metallic and organic (combustible) materials. In order to maintain a minimum level of fire safety, the US Navy has set performance requirements for new materials in many applications. These include the use of composite materials in ships and submarines. Performance requirements for composites, in most cases, are based on full-scale fire tests. The use of composites for structural applications in submarines is covered by MIL-STD-2031. The use of composites aboard US Navy ships for topside applications is now covered by Fire Safety testing criteria. The recommended fire performance criteria contain requirements for fire growth, smoke toxicity, visibility (ISO 9705), fire resistance and structural integrity under fire (UL 1709). When developing new composite systems, it is expensive to repeatedly conduct these typical full-scale fire tests to determine the performance of the most recent design. Instead, more cost-effective small-scale testing is preferable to evaluate performance. To facilitate the introduction of new and modified fire tolerant materials/systems/designs, and to reduce the financial burden on small business, the US Navy has developed a low cost composite system fire screening protocol which offers the potential of predicting the full-scale fire performance. Fire growth potential of new composite systems and designs can be screened by using small-scale test data from cone calorimeter (ASTM E-1354) and Lateral Ignition Flame spread Test (ASTM E-1321) in conjunction with the Composite Fire Hazard Analysis Tool (CFHAT). The small-scale burn-through test (2 x 2 ft) was shown capable of screening fire resistance performance determined in furnace testing with a UL-1709 fire curve. These screening techniques provide cost-effective approaches for evaluating fire performance of new technologies, which in turn aids in the product development process. Full-scale fire testing is still required before inclusion of products onboard US Navy submarines and surface ships. JF - Fire and Materials AU - Sorathia, U AU - Long, G AU - Gracik, T AU - Blum, M AU - Ness, J AD - NAVSEA, Carderock Division, 9500 MacArthur Blvd, W. Bethesda, MD 20817, USA, sorathiaua@nswccd.navy.mil Y1 - 2001/12// PY - 2001 DA - Dec 2001 SP - 215 EP - 222 VL - 25 IS - 6 SN - 0308-0501, 0308-0501 KW - composite materials KW - Health & Safety Science Abstracts KW - Ships KW - Fires KW - Materials testing KW - Smoke KW - Toxicity testing KW - Marine transportation KW - H 7000:Fire Safety UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18333443?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Fire+and+Materials&rft.atitle=Screening+Tests+for+Fire+Safety+of+Composites+for+Marine+Applications&rft.au=Sorathia%2C+U%3BLong%2C+G%3BGracik%2C+T%3BBlum%2C+M%3BNess%2C+J&rft.aulast=Sorathia&rft.aufirst=U&rft.date=2001-12-01&rft.volume=25&rft.issue=6&rft.spage=215&rft.isbn=&rft.btitle=&rft.title=Fire+and+Materials&rft.issn=03080501&rft_id=info:doi/10.1002%2Ffam.771 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Smoke; Toxicity testing; Materials testing; Fires; Marine transportation; Ships DO - http://dx.doi.org/10.1002/fam.771 ER - TY - JOUR T1 - Examination of Peak Power Dependence in the UV Inactivation of Bacterial Spores AN - 18218267; 5288684 AB - We examine whether the rate of delivery of photons from a UV radiation source has an effect on the inactivation of spores. We directly compare the output of a high-peak-power UV laser source at 248 nm to a low-power continuous lamp source (254 nm) in the inactivation of Bacillus subtilis spores. The two UV sources differ by a factor of 10 in peak power. Contrary to previous reports, no clear differences in spore survival were observed. JF - Applied and Environmental Microbiology AU - Rice, J K AU - Ewell, M AD - Chemistry Division, Code 6111, Naval Research Laboratory, Washington, DC 20375-5342., rice@ccf.nrl.navy.mil Y1 - 2001/12// PY - 2001 DA - Dec 2001 SP - 5830 EP - 5832 VL - 67 IS - 12 SN - 0099-2240, 0099-2240 KW - inactivation KW - Microbiology Abstracts A: Industrial & Applied Microbiology KW - U.V. radiation KW - Bacillus subtilis KW - Preservation KW - Spores KW - A 01019:Sterilization, preservation & packaging UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18218267?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+and+Environmental+Microbiology&rft.atitle=Examination+of+Peak+Power+Dependence+in+the+UV+Inactivation+of+Bacterial+Spores&rft.au=Rice%2C+J+K%3BEwell%2C+M&rft.aulast=Rice&rft.aufirst=J&rft.date=2001-12-01&rft.volume=67&rft.issue=12&rft.spage=5830&rft.isbn=&rft.btitle=&rft.title=Applied+and+Environmental+Microbiology&rft.issn=00992240&rft_id=info:doi/10.1128%2FAEM.67.12.5830-5832.2001 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Bacillus subtilis; U.V. radiation; Preservation; Spores DO - http://dx.doi.org/10.1128/AEM.67.12.5830-5832.2001 ER - TY - JOUR T1 - Synergistic neutralizing antibody response to a dengue virus type 2 DNA vaccine by incorporation of lysosome-associated membrane protein sequences and use of plasmid expressing GM-CSF. AN - 71275305; 11883007 AB - We have previously shown that a dengue virus type 1 DNA vaccine expressing premembrane (prM) and envelope (E) genes was immunogenic in mice and monkeys and that rhesus monkeys vaccinated with this construct were completely to partially protected from virus challenge. In order to improve the immunogenicity of dengue DNA vaccines, we have evaluated the effect of lysosome targeting of antigens and coimmunization with a plasmid expressing GM-CSF on antibody responses. A dengue virus type 2 candidate vaccine containing prM and E genes was constructed in which the transmembrane and cytoplasmic regions of E were replaced by those of the lysosome-associated membrane protein (LAMP). The modified vaccine construct expressed antigen that was colocalized with endogenous LAMP in lysosomal vesicles of transfected cells, whereas the antigen expressed from the unmodified construct was not. It was hypothesized that targeting of antigen to the lysosomal compartment will increase antigen presentation by MHC class II, leading to stronger CD4-mediated immune responses. Mice immunized with the modified construct responded with significantly higher levels of virus neutralizing antibodies compared to those immunized with the unmodified construct. Coimmunization of mice with a plasmid expressing murine GM-CSF enhanced the antibody response obtained with either the unmodified or the modified construct alone. The highest antibody responses were noted when the modified construct was coinjected with plasmid expressing the GM-CSF gene. These results could form the basis for an effective tetravalent dengue virus DNA vaccine. JF - Virology AU - Raviprakash, K AU - Marques, E AU - Ewing, D AU - Lu, Y AU - Phillips, I AU - Porter, K R AU - Kochel, T J AU - August, T J AU - Hayes, C G AU - Murphy, G S AD - Virology Program, Infectious Diseases Directorate, Naval Medical Research Center, Silver Spring, Maryland 20910, USA. raviprakashk@nmrc.navy.mil Y1 - 2001/11/10/ PY - 2001 DA - 2001 Nov 10 SP - 74 EP - 82 VL - 290 IS - 1 SN - 0042-6822, 0042-6822 KW - Antibodies, Viral KW - 0 KW - Antigens, CD KW - DNA, Viral KW - E-glycoprotein, Dengue virus type 2 KW - Lysosome-Associated Membrane Glycoproteins KW - Membrane Glycoproteins KW - Vaccines, DNA KW - Viral Envelope Proteins KW - Viral Vaccines KW - prM protein, Flavivirus KW - Granulocyte-Macrophage Colony-Stimulating Factor KW - 83869-56-1 KW - Index Medicus KW - Animals KW - 3T3 Cells KW - Humans KW - Cercopithecus aethiops KW - Neutralization Tests KW - Vero Cells KW - Mice KW - Antibody Affinity KW - Plasmids KW - Drug Synergism KW - Antibodies, Viral -- immunology KW - Granulocyte-Macrophage Colony-Stimulating Factor -- immunology KW - Vaccines, DNA -- immunology KW - Viral Vaccines -- genetics KW - Dengue Virus -- immunology KW - Antigens, CD -- genetics KW - Viral Vaccines -- immunology KW - Viral Envelope Proteins -- immunology KW - Granulocyte-Macrophage Colony-Stimulating Factor -- genetics KW - DNA, Viral -- immunology KW - Vaccines, DNA -- genetics KW - Membrane Glycoproteins -- immunology KW - Antigens, CD -- immunology KW - Membrane Glycoproteins -- genetics KW - Viral Envelope Proteins -- genetics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71275305?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Virology&rft.atitle=Synergistic+neutralizing+antibody+response+to+a+dengue+virus+type+2+DNA+vaccine+by+incorporation+of+lysosome-associated+membrane+protein+sequences+and+use+of+plasmid+expressing+GM-CSF.&rft.au=Raviprakash%2C+K%3BMarques%2C+E%3BEwing%2C+D%3BLu%2C+Y%3BPhillips%2C+I%3BPorter%2C+K+R%3BKochel%2C+T+J%3BAugust%2C+T+J%3BHayes%2C+C+G%3BMurphy%2C+G+S&rft.aulast=Raviprakash&rft.aufirst=K&rft.date=2001-11-10&rft.volume=290&rft.issue=1&rft.spage=74&rft.isbn=&rft.btitle=&rft.title=Virology&rft.issn=00426822&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-04-02 N1 - Date created - 2002-03-08 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Use of the round window microcatheter in the treatment of Meniere's disease. AN - 85368091; pmid-11801994 AB - Transtympanic gentamicin is an increasingly popular treatment for Meniere's disease. The present report examines the 2-year follow-up of our first 27 patients with Meniere's disease treated with the use of microdose gentamicin through the Round Window Microcatheter. We applied the 1995 American Academy of Otolaryngology-Head and Neck Surgery criteria to this patient group to analyze the results of treatment.This study is an evaluation of consecutive patients with predetermined data collection on each patient.Patients with confirmed Meniere's disease underwent placement of the Round Window Microcatheter, which was filled with 10 mg/mL gentamicin, after placement into the round window niche was confirmed. Ten milligrams per milliliter of gentamicin was injected into the catheter by hand on two occasions after device placement in the first several patients. The remaining patients had continuous infusion of 10 mg/mL gentamicin at 1microL/h for the next 10 days. The catheter was removed 10 days after placement. All patients underwent an extensive set of hearing and vestibular tests on several occasions before, during, and after treatment.In the patients in the study, vertigo was eliminated in 92.6%, with 3.7% of patients (1/27) demonstrating a mild permanent threshold shift in hearing. Tinnitus and pressure were significantly reduced in more than 65% of patients. Only one patient demonstrated a reduction of vestibular function after treatment.Results of this study on this group of patients indicate that vertigo can be controlled in the long term using microdose gentamicin without a significant reduction in cochlear or vestibular function in most of the patients in our series. Our results are compared with the published literature examining transtympanic injection. In addition, the underlying science supporting this type of treatment is examined. JF - The Laryngoscope AU - Hoffer, M E AU - Kopke, R D AU - Weisskopf, P AU - Gottshall, K AU - Allen, K AU - Wester, D AU - Balaban, C AD - Department of Defense Spatial Orientation Center, Naval Medical Center San Diego, San Diego, California 92134-2200, USA. mehoffer@nmcsd.med.navy.mil Y1 - 2001/11// PY - 2001 DA - Nov 2001 SP - 2046 EP - 2049 VL - 111 IS - 11 Pt 1 SN - 0023-852X, 0023-852X KW - Index Medicus KW - National Library of Medicine KW - Adult KW - *Anti-Bacterial Agents: administration & dosage KW - Anti-Bacterial Agents: therapeutic use KW - Catheters, Indwelling KW - *Drug Delivery Systems: instrumentation KW - Female KW - Follow-Up Studies KW - *Gentamicins: administration & dosage KW - Gentamicins: therapeutic use KW - Humans KW - Male KW - *Meniere Disease: drug therapy KW - *Round Window, Ear KW - Time Factors UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85368091?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Laryngoscope&rft.atitle=Use+of+the+round+window+microcatheter+in+the+treatment+of+Meniere%27s+disease.&rft.au=Hoffer%2C+M+E%3BKopke%2C+R+D%3BWeisskopf%2C+P%3BGottshall%2C+K%3BAllen%2C+K%3BWester%2C+D%3BBalaban%2C+C&rft.aulast=Hoffer&rft.aufirst=M&rft.date=2001-11-01&rft.volume=111&rft.issue=11+Pt+1&rft.spage=2046&rft.isbn=&rft.btitle=&rft.title=The+Laryngoscope&rft.issn=0023852X&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Evaluation of a fundamental integral in rough-surface scattering theory. AN - 85360661; pmid-11757916 AB - An algorithm is presented for the numerical evaluation of a fundamental but intractable integral that occurs in the physical theory of scattering from random rough surfaces. It is based on a rational-function approximation to an integrand factor, augmented with techniques for excluding poles and zeros from the path of integration. Examples, complete with error analysis, are provided for cases relevant to acoustic sea-floor and sea-surface scattering. JF - The Journal of the Acoustical Society of America AU - Drumheller, D M AU - Gragg, R F AD - Naval Research Laboratory, Acoustics Division, Washington, DC 20375-5350, USA. David.Drumheller@nrl.navy.mil Y1 - 2001/11// PY - 2001 DA - Nov 2001 SP - 2270 EP - 2275 VL - 110 IS - 5 Pt 1 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85360661?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Evaluation+of+a+fundamental+integral+in+rough-surface+scattering+theory.&rft.au=Drumheller%2C+D+M%3BGragg%2C+R+F&rft.aulast=Drumheller&rft.aufirst=D&rft.date=2001-11-01&rft.volume=110&rft.issue=5+Pt+1&rft.spage=2270&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Regionally selective alterations in local cerebral glucose utilization evoked by charybdotoxin, a blocker of central voltage-activated K+-channels. AN - 72303571; 11722607 AB - The quantitative [14C]-2-deoxyglucose autoradiographic technique was employed to investigate the effect of charybdotoxin, a blocker of certain voltage-activated K+ channels, on functional activity, as reflected by changes in local rates of cerebral glucose utilization in rat brain. Intracerebroventricular administration of charybdotoxin, at doses below those producing seizure activity, produced a heterogeneous effect on glucose utilization throughout the brain. Out of the 75 brain regions investigated, 24 displayed alterations in glucose utilization. The majority of these changes were observed with the intermediate dose of charybdotoxin administered (12.5 pmol), with the lower (6.25 pmol) and higher (25 pmol) doses of charybdotoxin producing a much more restricted pattern of change in glucose utilization. In brain regions which displayed alterations in glucose at all doses of charybdotoxin administered, no dose dependency in terms of the magnitude of change was observed. The 21 brain regions which displayed altered functional activity after administration of 12.5 pmol charybdotoxin were predominantly limited to the hippocampus, limbic and motor structures. In particular, glucose utilization was altered within three pathways implicated within learning and memory processes, the septohippocampal pathway, Schaffer collaterals within the hippocampus and the Papez circuit. The nigrostriatal pathway also displayed altered local cerebral glucose utilization. These data indicate that charybdotoxin produces alterations in functional activity within selected pathways in the brain. Furthermore the results raise the possibility that manipulation of particular subtypes of Kv1 channels in the hippocampus and related structures may be a means of altering cognitive processes without causing global changes in neural activity throughout the brain. JF - The European journal of neuroscience AU - Cochran, S M AU - Harvey, A L AU - Pratt, J A AD - Department of Physiology and Pharmacology, Strathclyde Institute for Biomedical Sciences, University of Strathclyde, Glasgow G4 ONR, UK. Y1 - 2001/11// PY - 2001 DA - November 2001 SP - 1455 EP - 1463 VL - 14 IS - 9 SN - 0953-816X, 0953-816X KW - Carbon Radioisotopes KW - 0 KW - Potassium Channels, Voltage-Gated KW - Charybdotoxin KW - 115422-61-2 KW - Deoxyglucose KW - 9G2MP84A8W KW - Glucose KW - IY9XDZ35W2 KW - Index Medicus KW - Animals KW - Cerebral Cortex -- drug effects KW - Septal Nuclei -- metabolism KW - Rats, Long-Evans KW - Limbic System -- metabolism KW - Cerebral Cortex -- metabolism KW - Neural Pathways -- metabolism KW - Dentate Gyrus -- metabolism KW - Hippocampus -- metabolism KW - Neural Pathways -- drug effects KW - Hippocampus -- drug effects KW - Rats KW - Limbic System -- drug effects KW - Dentate Gyrus -- drug effects KW - Septal Nuclei -- drug effects KW - Basal Ganglia -- drug effects KW - Male KW - Basal Ganglia -- metabolism KW - Potassium Channels, Voltage-Gated -- drug effects KW - Neurons -- metabolism KW - Memory -- drug effects KW - Neurons -- drug effects KW - Glucose -- metabolism KW - Energy Metabolism -- physiology KW - Energy Metabolism -- drug effects KW - Brain -- drug effects KW - Memory -- physiology KW - Brain -- metabolism KW - Potassium Channels, Voltage-Gated -- metabolism KW - Charybdotoxin -- pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72303571?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+European+journal+of+neuroscience&rft.atitle=Regionally+selective+alterations+in+local+cerebral+glucose+utilization+evoked+by+charybdotoxin%2C+a+blocker+of+central+voltage-activated+K%2B-channels.&rft.au=Cochran%2C+S+M%3BHarvey%2C+A+L%3BPratt%2C+J+A&rft.aulast=Cochran&rft.aufirst=S&rft.date=2001-11-01&rft.volume=14&rft.issue=9&rft.spage=1455&rft.isbn=&rft.btitle=&rft.title=The+European+journal+of+neuroscience&rft.issn=0953816X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-11 N1 - Date created - 2001-11-27 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Distribution and fate of energetics on DOD test and training ranges AN - 51891545; 2004-013333 AB - Current knowledge concerning the nature and extent of residual explosives contamination is inadequate to ensure management of ranges as sustainable resources. The objective of this project is to develop techniques for assessing the potential for environmental impacts from residual energetics. The approach includes characterization of post blast residues from various heavy artillery munitions and hand grenades by sampling surface soils in craters from both high- and low-order detonations. Residues from specific munitions will also be determined by sampling soot deposited on snow by the blast. Where possible, groundwater and surface water associated with the ranges will be sampled. The study will also fill data gaps in soil transport parameters, such as dissolution kinetics, soil/water partitioning coefficients and transformation/degradation rates. Results from various sites in the U.S. and Canada will be compared. Surface soils have been analyzed from a heavy artillery impact range and at gun positions at Fort Lewis, WA, and at hand grenade ranges at Fort Lewis, Camp Bonneville, WA, and Fort Richardson, AK. Groundwater from monitoring wells and surface seepages around the heavy artillery range were also sampled. Soil results indicate very low residual concentrations of explosives in high-order artillery detonations. However, low-order detonations left extremely high local concentrations of residues. 2,4-DNT from single-based propellant was detected in surface soil at the firing points of several 105-mm howitzers. Explosives residues at hand grenade ranges were relatively high. Results to date suggest that management of ranges to control residues from low-order detonations may be necessary to ensure environmental protection of local receptors including groundwater. This research will contribute techniques for range characterization and for development of a source term for explosives residuals resulting from various range activities. These data will provide a basis for insuring environmental compliance and the continued use of test and training ranges as sustainable resources. JF - Abstracts with Programs - Geological Society of America AU - Pennington, Judith C AU - Jenkins, Thomas F AU - Brannon, James M AU - Thiboutot, Sonia AU - DeLaney, John E AU - Lynch, Jason AU - Clausen, Jay L AU - Anonymous Y1 - 2001/11// PY - 2001 DA - November 2001 SP - 118 PB - Geological Society of America (GSA), Boulder, CO VL - 33 IS - 6 SN - 0016-7592, 0016-7592 KW - United States KW - soils KW - hazardous waste KW - Washington KW - residual explosives KW - Pierce County Washington KW - Adams County Washington KW - pollution KW - Fort Lewis KW - solution KW - Southern Alaska KW - ground water KW - spatial distribution KW - military geology KW - explosives KW - detection KW - land management KW - sustainable development KW - Camp Bonneville KW - testing KW - Fort Richardson Alaska KW - Alaska KW - land use KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51891545?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Abstracts+with+Programs+-+Geological+Society+of+America&rft.atitle=Distribution+and+fate+of+energetics+on+DOD+test+and+training+ranges&rft.au=Pennington%2C+Judith+C%3BJenkins%2C+Thomas+F%3BBrannon%2C+James+M%3BThiboutot%2C+Sonia%3BDeLaney%2C+John+E%3BLynch%2C+Jason%3BClausen%2C+Jay+L%3BAnonymous&rft.aulast=Pennington&rft.aufirst=Judith&rft.date=2001-11-01&rft.volume=33&rft.issue=6&rft.spage=118&rft.isbn=&rft.btitle=&rft.title=Abstracts+with+Programs+-+Geological+Society+of+America&rft.issn=00167592&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Geological Society of America, 2001 annual meeting N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by the Geological Society of America, Boulder, CO, United States N1 - Date revised - 2004-01-01 N1 - PubXState - CO N1 - Last updated - 2012-06-07 N1 - CODEN - GAAPBC N1 - SubjectsTermNotLitGenreText - Adams County Washington; Alaska; Camp Bonneville; detection; explosives; Fort Lewis; Fort Richardson Alaska; ground water; hazardous waste; land management; land use; military geology; Pierce County Washington; pollution; residual explosives; soils; solution; Southern Alaska; spatial distribution; sustainable development; testing; United States; Washington ER - TY - JOUR T1 - Convergence fronts in tidally forced rotating estuaries AN - 50156121; 2002-007596 AB - In situ observation and remote sensing imagery reveal the presence of longitudinal velocity convergences over bathymetric channels in tidal estuaries. We present the results of numerical experiments designed to investigate the cause of these convergences for channels possessing shallow shoal regions and a deeper central region. The equations of motion for a homogeneous fluid on a rotating Earth are solved using a fully spectral code in the across-estuary (i.e., the vertical or x-z) plane, while no along-estuary flow variations (in the y direction) are permitted. A Gaussian-shaped bottom bathymetry is chosen. In the along-channel (y) direction we impose a pressure gradient which is the sum of constant and fluctuating parts to simulate the steady and tidally oscillating parts of the estuarine flow. The details of the transient response can be complicated, but we observe that for most ( approximately 80%) of the tidal cycle there exists a cross-estuary recirculation cell colocated with a localized along-channel jet. Both of these are situated over the bottom bathymetric groove; the circulation is always clockwise when facing down current. This feature results from the generation of stream-wise vorticity through the tilting of planetary vorticity by the vertical shear of the along-estuary flow. A surface convergence-divergence pair is associated with the flow. The maximum value of each is seen to occur on the edge of the bathymetric feature but may migrate toward or away from the center as long as the current continues in the same direction. When the tide reverses, the feature reappears on the opposite shoal, and the migration of the convergence and divergence extrema begins again. We also find that the responses are qualitatively similar for all bathymetric grooves, even asymmetrically situated ones, provided that the estuary width-to-depth ratio is of order 100 or larger, the Rossby numbers are of order unity, and the Ekman layer thickness-to-channel-depth ratio is greater than approximately 0.65. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Handler, Robert A AU - Mied, Richard P AU - Evans, Thomas E AU - Donato, Timothy F Y1 - 2001/11// PY - 2001 DA - November 2001 SP - 27 EP - 27,162 PB - American Geophysical Union, Washington, DC VL - 106 IS - C11 SN - 0148-0227, 0148-0227 KW - United States KW - currents KW - upwelling KW - Northwest Atlantic KW - imagery KW - in situ KW - numerical analysis KW - geophysical methods KW - radar methods KW - bottom currents KW - convection KW - simulation KW - satellite methods KW - ocean currents KW - estuaries KW - SAR KW - velocity KW - Delaware Bay KW - bathymetry KW - North Atlantic KW - longitudinal velocity convergence KW - Atlantic Ocean KW - remote sensing KW - 20:Applied geophysics KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50156121?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Convergence+fronts+in+tidally+forced+rotating+estuaries&rft.au=Handler%2C+Robert+A%3BMied%2C+Richard+P%3BEvans%2C+Thomas+E%3BDonato%2C+Timothy+F&rft.aulast=Handler&rft.aufirst=Robert&rft.date=2001-11-01&rft.volume=106&rft.issue=C11&rft.spage=27&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC000637 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 25 N1 - PubXState - DC N1 - Document feature - illus. incl. block diag., 1 table, geol. sketch map N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Atlantic Ocean; bathymetry; bottom currents; convection; currents; Delaware Bay; estuaries; geophysical methods; imagery; in situ; longitudinal velocity convergence; North Atlantic; Northwest Atlantic; numerical analysis; ocean currents; radar methods; remote sensing; SAR; satellite methods; simulation; United States; upwelling; velocity DO - http://dx.doi.org/10.1029/2000JC000637 ER - TY - JOUR T1 - Inertial oscillations in the Korea Strait AN - 50153980; 2002-007583 AB - Inertial oscillations (IO) are examined in the Korea Strait based on measurements from 13 acoustic Doppler current profilers covering the time period May 1999 through March 2000. Strong IO responses to wind stress occur during summer. A simple linear model predicts that winter wind stress is expected to generate inertial responses of the same order of magnitude as those in summer. However, the observed winter IO response is much weaker than predicted. During summer, the currents within the mixed layer and below the mixed layer are of comparable amplitude but in opposite directions. The depth at which the currents reverse directions varies throughout the year as the mixed layer deepens from about 40 m during summer to the bottom of the water column in November. During winter, the velocity structure is more uniform in depth with currents in the same direction throughout the water column. One possible explanation for these phenomena is related to the combined effect of the strait boundaries and the strong summer stratification. The stratification prevents the wind stress momentum flux from mixing downward below the thermocline and thus allows the development of a bottom current separate from the surface current. Such a velocity structure is necessary to satisfy the no-flow condition through the land boundaries. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Jacobs, G A AU - Book, J W AU - Perkins, H T AU - Teague, W J Y1 - 2001/11// PY - 2001 DA - November 2001 SP - 26 EP - 26,957 PB - American Geophysical Union, Washington, DC VL - 106 IS - C11 SN - 0148-0227, 0148-0227 KW - Yellow Sea KW - currents KW - East China Sea KW - ocean circulation KW - Japan Sea KW - sea water KW - bottom currents KW - ocean currents KW - West Pacific KW - measurement KW - North Pacific KW - inertial oscillations KW - Pacific Ocean KW - Korea Strait KW - acoustic Doppler current meters KW - Northwest Pacific KW - winds KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50153980?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Inertial+oscillations+in+the+Korea+Strait&rft.au=Jacobs%2C+G+A%3BBook%2C+J+W%3BPerkins%2C+H+T%3BTeague%2C+W+J&rft.aulast=Jacobs&rft.aufirst=G&rft.date=2001-11-01&rft.volume=106&rft.issue=C11&rft.spage=26&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC000509 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 32 N1 - PubXState - DC N1 - Document feature - illus. incl. 4 plates, geol. sketch map N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - acoustic Doppler current meters; bottom currents; currents; East China Sea; inertial oscillations; Japan Sea; Korea Strait; measurement; North Pacific; Northwest Pacific; ocean circulation; ocean currents; Pacific Ocean; sea water; West Pacific; winds; Yellow Sea DO - http://dx.doi.org/10.1029/2000JC000509 ER - TY - JOUR T1 - Oxides of nitrogen emissions from burning wood AN - 18461977; 5435531 AB - Oxides of nitrogen, NO sub(x) emissions, are one of the most carefully monitored contributors to air pollution in metropolitan areas. NO sub(x) is known to contribute to smog and ground level ozone as well as having the potential to make rain more acidic. Fuels burned in air all produce NO sub(x), however, some sources are much worse than others. NO sub(x) emissions data from a wood-burning boiler are presented in this paper to show the level of emissions from burning wood and to publish the data as well as to show the effects of combustion parameters on NO sub(x) production. This paper presents variables such as excess air, air temperature and distribution and fuel moisture, size and combustion rate and the effect of each on the production of nitric oxide during the combustion of wood fuel. The results apply to many other biomass fuels including agricultural wastes, industrial solid wastes, shipboard solid wastes and municipal solid wastes fired under similar conditions. JF - Journal of Solid Waste Technology and Management AU - Tuttle, K L AD - United States Naval Academy, Annapolis, MD, USA Y1 - 2001/11// PY - 2001 DA - Nov 2001 SP - 112 EP - 120 VL - 27 IS - 3-4 SN - 1088-1697, 1088-1697 KW - Pollution Abstracts KW - P 0000:AIR POLLUTION UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18461977?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Apollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Solid+Waste+Technology+and+Management&rft.atitle=Oxides+of+nitrogen+emissions+from+burning+wood&rft.au=Tuttle%2C+K+L&rft.aulast=Tuttle&rft.aufirst=K&rft.date=2001-11-01&rft.volume=27&rft.issue=3-4&rft.spage=112&rft.isbn=&rft.btitle=&rft.title=Journal+of+Solid+Waste+Technology+and+Management&rft.issn=10881697&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - CPAPER T1 - Brief history of the three stages of science: The general theory of evolution AN - 39436048; 3627002 AU - Rudin, DO Y1 - 2001/10/29/ PY - 2001 DA - 2001 Oct 29 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39436048?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Brief+history+of+the+three+stages+of+science%3A+The+general+theory+of+evolution&rft.au=Rudin%2C+DO&rft.aulast=Rudin&rft.aufirst=DO&rft.date=2001-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: International Institute for Advanced Studies in Systems Research & Cybernetics, Windsor, Ontario N9B 3P4, Canada; phone: 519 944 4378; fax: 519 974 8191; URL: www.iias.edu N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Miniature low-cost autonomous underwater vehicle AN - 39429468; 3631063 AU - Wick, CE AU - Stilwell, D J Y1 - 2001/10/29/ PY - 2001 DA - 2001 Oct 29 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39429468?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Miniature+low-cost+autonomous+underwater+vehicle&rft.au=Wick%2C+CE%3BStilwell%2C+D+J&rft.aulast=Wick&rft.aufirst=CE&rft.date=2001-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Oceans 2001, Ms. Priscilla Billing Director, Communications, Univ. of Hawaii at Manoa, Sea Grant College Program, Hawaii; URL: www.oceans2001.com N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Development of thin, low frequency electroacoustic projectors for underwater applications AN - 39420274; 3637989 AU - Howarth, T R AU - Tressler, J F Y1 - 2001/10/29/ PY - 2001 DA - 2001 Oct 29 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39420274?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Development+of+thin%2C+low+frequency+electroacoustic+projectors+for+underwater+applications&rft.au=Howarth%2C+T+R%3BTressler%2C+J+F&rft.aulast=Howarth&rft.aufirst=T&rft.date=2001-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Acoustical Society of The Netherlands, P.O. Box 1067, NL-2600 BB Delft, The Netherlands; phone: 31-15-2692428; fax: 31-15-2625403; URL: www.internoise2001.tudelft.nl. Paper No. 3A.05.02 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Building a 43-year record of Arctic Ocean ice draft from submarine sonar data AN - 39379595; 3631274 AU - Bentley, D L AU - Wensnahan, M AU - Rothrock, DA AU - Tucker, WB III Y1 - 2001/10/29/ PY - 2001 DA - 2001 Oct 29 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39379595?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Building+a+43-year+record+of+Arctic+Ocean+ice+draft+from+submarine+sonar+data&rft.au=Bentley%2C+D+L%3BWensnahan%2C+M%3BRothrock%2C+DA%3BTucker%2C+WB+III&rft.aulast=Bentley&rft.aufirst=D&rft.date=2001-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Oceans 2001, Ms. Priscilla Billing Director, Communications, Univ. of Hawaii at Manoa, Sea Grant College Program, Hawaii; URL: www.oceans2001.com N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Method of pseudopotential in acoustical scattering AN - 39351202; 3638517 AU - Roy, DNG AU - Dacol, D Y1 - 2001/10/29/ PY - 2001 DA - 2001 Oct 29 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39351202?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Method+of+pseudopotential+in+acoustical+scattering&rft.au=Roy%2C+DNG%3BDacol%2C+D&rft.aulast=Roy&rft.aufirst=DNG&rft.date=2001-10-29&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Acoustical Society of The Netherlands, P.O. Box 1067, NL-2600 BB Delft, The Netherlands; phone: 31-15-2692428; fax: 31-15-2625403; URL: www.internoise2001.tudelft.nl. Paper No. 4D.02.01 N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - Regularization methods for near-field acoustical holography. AN - 85362192; pmid-11681378 AB - The reconstruction of the pressure and normal surface velocity provided by near-field acoustical holography (NAH) from pressure measurements made near a vibrating structure is a linear, ill-posed inverse problem due to the existence of strongly decaying, evanescentlike waves. Regularization provides a technique of overcoming the ill-posedness and generates a solution to the linear problem in an automated way. We present four robust methods for regularization; the standard Tikhonov procedure along with a novel improved version, Landweber iteration, and the conjugate gradient approach. Each of these approaches can be applied to all forms of interior or exterior NAH problems; planar, cylindrical, spherical, and conformal. We also study two parameter selection procedures, the Morozov discrepancy principle and the generalized cross validation, which are crucial to any regularization theory. In particular, we concentrate here on planar and cylindrical holography. These forms of NAH which rely on the discrete Fourier transform are important due to their popularity and to their tremendous computational speed. In order to use regularization theory for the separable geometry problems we reformulate the equations of planar, cylindrical, and spherical NAH into an eigenvalue problem. The resulting eigenvalues and eigenvectors couple easily to regularization theory, which can be incorporated into the NAH software with little sacrifice in computational speed. The resulting complete automation of the NAH algorithm for both separable and nonseparable geometries overcomes the last significant hurdle for NAH. JF - The Journal of the Acoustical Society of America AU - Williams, E G AD - Naval Research Laboratory, Washington, DC 20375-5350, USA. williams@genah.nrl.navy.mil Y1 - 2001/10// PY - 2001 DA - Oct 2001 SP - 1976 EP - 1988 VL - 110 IS - 4 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85362192?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Regularization+methods+for+near-field+acoustical+holography.&rft.au=Williams%2C+E+G&rft.aulast=Williams&rft.aufirst=E&rft.date=2001-10-01&rft.volume=110&rft.issue=4&rft.spage=1976&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - State monitoring activities related to Pfiesteria-like organisms. AN - 72227333; 11677180 AB - In response to potential threats to human health and fish populations, six states along the east coast of the United States initiated monitoring programs related to Pfiesteria-like organisms in 1998. These actions were taken in the wake of toxic outbreaks of Pfiesteria piscicida Steidinger & Burkholder in Maryland during 1997 and previous outbreaks in North Carolina. The monitoring programs have two major purposes. The first, rapid response, is to ensure public safety by responding immediately to conditions that may indicate the presence of Pfiesteria or related organisms in a toxic state. The second, comprehensive assessment, is to provide a more complete understanding of where Pfiesteria-like organisms may become a threat, to understand what factors may stimulate their growth and toxicity, and to evaluate the impacts of these organisms upon fish and other aquatic life. In states where human health studies are being conducted, the data from both types of monitoring are used to provide information on environmental exposure. The three elements included in each monitoring program are identification of Pfiesteria-like organisms, water quality measurements, and assessments of fish health. Identification of Pfiesteria-like organisms is a particularly difficult element of the monitoring programs, as these small species cannot be definitively identified using light microscopy; newly applied molecular techniques, however, are starting to provide alternatives to traditional methods. State monitoring programs also offer many opportunities for collaborations with research initiatives targeting both environmental and human health issues related to Pfiesteria-like organisms. JF - Environmental health perspectives AU - Magnien, R E AD - Tidewater Ecosystem Assessment Division, Maryland Department of Natural Resources, Annapolis 21401, USA. rmagnien@dnr.state.md.us Y1 - 2001/10// PY - 2001 DA - October 2001 SP - 711 EP - 714 VL - 109 Suppl 5 SN - 0091-6765, 0091-6765 KW - Index Medicus KW - Animals KW - State Government KW - Eutrophication KW - Safety KW - North Carolina KW - Data Collection KW - Maryland KW - Environmental Monitoring KW - Public Health KW - Fish Diseases -- microbiology KW - Population Dynamics KW - Pfiesteria piscicida UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72227333?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+health+perspectives&rft.atitle=State+monitoring+activities+related+to+Pfiesteria-like+organisms.&rft.au=Magnien%2C+R+E&rft.aulast=Magnien&rft.aufirst=R&rft.date=2001-10-01&rft.volume=109+Suppl+5&rft.issue=&rft.spage=711&rft.isbn=&rft.btitle=&rft.title=Environmental+health+perspectives&rft.issn=00916765&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2003-07-08 N1 - Date created - 2001-10-25 N1 - Date revised - 2017-01-13 N1 - SuppNotes - Cited By: Lancet. 1998 Aug 15;352(9127):532-9 [9716058] Md Med J. 1998 May;47(3):113-9 [9601195] Proc Natl Acad Sci U S A. 2000 Apr 11;97(8):4303-8 [10760297] Appl Environ Microbiol. 2000 Nov;66(11):4641-8 [11055905] Nature. 1992 Jul 30;358(6385):407-10 [1641022] J Toxicol Environ Health. 1995 Dec;46(4):501-22 [8523474] N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - The gamma subunit of the rod photoreceptor cGMP phosphodiesterase can modulate the proteolysis of two cGMP binding cGMP-specific phosphodiesterases (PDE6 and PDE5) by caspase-3. AN - 72197146; 11602184 AB - We have investigated whether the proteolysis of members of the cGMP binding phosphodiesterases (PDE6, PDE5A1, and PDE10A2) by caspase-3 is modulated by the gamma inhibitor subunit of PDE6. We show here that purified caspase-3 proteolyses PDE6, an enzyme composed of two nonidentical catalytic subunits (termed alpha and beta) with molecular mass of 88 and 84 kDa. The proteolysis of PDE6 produced a single fragment with a molecular mass of 78 kDa. This corresponds to the possible cleavage of the caspase-3 consensus DFVD site (amino acids: 164-168) in the alpha subunit and leads to a 50% decrease in the cGMP hydrolysing activity of the enzyme. The addition of rod PDEgamma to the incubation completely blocked the cleavage of PDE6 by caspase-3. In contrast, rod PDEgamma converted PDE5A1 (molecular mass of 98 kDa) to a better substrate for caspase-3. This resulted in the formation of four major fragments with molecular mass of 82-83, 67, 43, and 34 kDa. In addition, caspase-3 induced an approximately 80% reduction in the activity of a partially purified preparation of PDE5A1 in the presence of rod PDEgamma. Caspase-3 also cleaved PDE10A2 (molecular mass of 95 kDa) to a single 48-kDa fragment. This was consistent with cleavage of the DLFD site (amino acids: 312-315) in PDE10A2. In contrast with both PDE6 and PDE5A1, rod PDEgamma was without effect on this enzyme. These data show that rod PDEgamma interacts with at least two members of the cGMP binding PDE family (PDE5A1 and PDE6) and can exert differential effects on the cleavage of these enzymes by caspase-3. JF - Cellular signalling AU - Frame, M AU - Wan, K F AU - Tate, R AU - Vandenabeele, P AU - Pyne, N J AD - Department of Physiology and Pharmacology, Strathclyde Institute for Biomedical Sciences, University of Strathclyde, 27 Taylor Street, Glasgow G4 ONR, UK. Y1 - 2001/10// PY - 2001 DA - October 2001 SP - 735 EP - 741 VL - 13 IS - 10 SN - 0898-6568, 0898-6568 KW - RNA KW - 63231-63-0 KW - Pde10a protein, mouse KW - EC 3.1.4.- KW - Phosphoric Diester Hydrolases KW - 3',5'-Cyclic-GMP Phosphodiesterases KW - EC 3.1.4.35 KW - Cyclic Nucleotide Phosphodiesterases, Type 5 KW - Cyclic Nucleotide Phosphodiesterases, Type 6 KW - Pde5a protein, mouse KW - Pde6b protein, mouse KW - Casp3 protein, mouse KW - EC 3.4.22.- KW - Caspase 3 KW - Caspases KW - Cyclic GMP KW - H2D2X058MU KW - Index Medicus KW - Animals KW - Drug Interactions KW - Base Sequence KW - Sequence Homology, Nucleic Acid KW - Molecular Sequence Data KW - Testis -- enzymology KW - Mice KW - Lung -- enzymology KW - Male KW - RNA -- biosynthesis KW - 3',5'-Cyclic-GMP Phosphodiesterases -- pharmacology KW - Cyclic GMP -- metabolism KW - 3',5'-Cyclic-GMP Phosphodiesterases -- genetics KW - Rod Cell Outer Segment -- enzymology KW - Caspases -- pharmacology KW - 3',5'-Cyclic-GMP Phosphodiesterases -- metabolism KW - Phosphoric Diester Hydrolases -- metabolism UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72197146?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Cellular+signalling&rft.atitle=The+gamma+subunit+of+the+rod+photoreceptor+cGMP+phosphodiesterase+can+modulate+the+proteolysis+of+two+cGMP+binding+cGMP-specific+phosphodiesterases+%28PDE6+and+PDE5%29+by+caspase-3.&rft.au=Frame%2C+M%3BWan%2C+K+F%3BTate%2C+R%3BVandenabeele%2C+P%3BPyne%2C+N+J&rft.aulast=Frame&rft.aufirst=M&rft.date=2001-10-01&rft.volume=13&rft.issue=10&rft.spage=735&rft.isbn=&rft.btitle=&rft.title=Cellular+signalling&rft.issn=08986568&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-12-04 N1 - Date created - 2001-10-16 N1 - Date revised - 2017-01-13 N1 - Genetic sequence - AF190928; GENBANK N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Chinese Perceptions of U.S. Power and Strategy AN - 60137713; 200203694 AB - An analysis of Chinese writings on US foreign policy & US-Sino relations reveals an emphasis on strategy. It is argued that such a perspective inevitably shapes China's relationship to the US. Chinese perceptions of US power during & after the Cold War are compared, & it is shown that, though these have shifted somewhat, China continues to view the US as a threatening imperialist state bent on hegemonic expansion. Foreign policy implications are discussed. In A Response to Yong Deng: Power, Perception, and the Cultural Lens, Qin Yaqing argues that China's (mis)perception of a US "grand strategy" as a hegemonic power, & subsequent relations with the US on the basis of this perception, are shaped by cultural factors on both sides. Implications of the intensification of a Hobbesian culture for future US-Sino relations are considered. K. Hyatt Stewart JF - Asian Affairs: An American Review AU - Deng, Yong AD - US Naval Academy, Annapolis, MD Y1 - 2001/10// PY - 2001 DA - October 2001 SP - 150 EP - 158 VL - 28 IS - 3 SN - 0092-7678, 0092-7678 KW - Peoples Republic of China KW - Hegemony KW - Imperialism KW - United States of America KW - International Relations KW - Threat KW - Foreign Policy KW - Political Power KW - article KW - 9063: international relations; international relations UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60137713?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Asian+Affairs%3A+An+American+Review&rft.atitle=Chinese+Perceptions+of+U.S.+Power+and+Strategy&rft.au=Deng%2C+Yong&rft.aulast=Deng&rft.aufirst=Yong&rft.date=2001-10-01&rft.volume=28&rft.issue=3&rft.spage=150&rft.isbn=&rft.btitle=&rft.title=Asian+Affairs%3A+An+American+Review&rft.issn=00927678&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-10-30 N1 - SuppNotes - Reply, 155-158. N1 - Last updated - 2016-09-28 N1 - SubjectsTermNotLitGenreText - United States of America; Peoples Republic of China; International Relations; Foreign Policy; Political Power; Hegemony; Threat; Imperialism ER - TY - JOUR T1 - Integration of lunar polar remote-sensing data sets; evidence for ice at the lunar south pole AN - 50154578; 2003-052231 AB - In order to investigate the feasibility of ice deposits at the lunar south pole, we have integrated all relevant lunar polar data sets. These include illumination data, Arecibo ground-based monostatic radar data, newly processed Clementine bistatic radar data, and Lunar Prospector neutron spectrometer measurements. The possibility that the lunar poles harbor ice deposits has important implications not only as a natural resource for future human lunar activity but also as a record of inner solar system volatiles (e.g., comets and asteroids) over the past billion years or more. We find that the epithermal neutron flux anomalies, measured by Lunar Prospector, are coincident with permanently shadowed regions at the lunar south pole, particularly those associated with Shackleton crater. Furthermore, these areas also correlate with the beta = 0 circular polarization ratio (CPR) enhancements revealed by new processing of Clementine bistatic radar echoes, which in turn are colocated with areas of anomalous high CPR observed by Arecibo Observatory on the lower, Sun-shadowed wall of Shackleton crater. Estimates of the extent of high CPR from Arecibo Observatory and Clementine bistatic radar data independently suggest that approximately 10 km (super 2) of ice may be present on the inner Earth-facing wall of Shackleton crater. None of the experiments that obtained the data presented here were ideally suited for definitively identifying ice in lunar polar regions. By assessing the relative merits of all available data, we find that it is plausible that ice does occur in cold traps at the lunar south pole and that future missions with instruments specifically designed to investigate these anomalies are worthy. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Nozette, Stewart AU - Spudis, Paul D AU - Robinson, Mark S AU - Bussey, D B J AU - Lichtenberg, Chris AU - Bonner, Robert Y1 - 2001/10// PY - 2001 DA - October 2001 SP - 23 EP - 23,266 PB - American Geophysical Union, Washington, DC VL - 106 IS - E10 SN - 0148-0227, 0148-0227 KW - water KW - polar regions KW - Arecibo radar data KW - Moon KW - Shackleton Crater KW - circular polarization ratio KW - radar methods KW - temperature KW - models KW - volatiles KW - craters KW - ice KW - surface features KW - planetology KW - Clementine Program KW - remote sensing KW - 04:Extraterrestrial geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50154578?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Integration+of+lunar+polar+remote-sensing+data+sets%3B+evidence+for+ice+at+the+lunar+south+pole&rft.au=Nozette%2C+Stewart%3BSpudis%2C+Paul+D%3BRobinson%2C+Mark+S%3BBussey%2C+D+B+J%3BLichtenberg%2C+Chris%3BBonner%2C+Robert&rft.aulast=Nozette&rft.aufirst=Stewart&rft.date=2001-10-01&rft.volume=106&rft.issue=E10&rft.spage=23&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JE001417 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 34 N1 - PubXState - DC N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Arecibo radar data; circular polarization ratio; Clementine Program; craters; ice; models; Moon; planetology; polar regions; radar methods; remote sensing; Shackleton Crater; surface features; temperature; volatiles; water DO - http://dx.doi.org/10.1029/2000JE001417 ER - TY - JOUR T1 - Sediment Trapping and Transport in the ACE Basin, South Carolina AN - 18220641; 5285926 AB - A study took place during May 1998 and May 1999 to examine the processes controlling localized accumulation of fine-grained sediments in the lower Ashepoo River. This region, referred to as the Mud Reach, is an area of muddy bottom sediments bounded by fine sands. The Mud Reach is located downstream of the landward extent of the salt intrusion where an estuarine turbidity maximum commonly occurs. Tidal time-series measurements made in the Mud Reach during May 1998, when river discharge was at a 10-yr high, showed high concentrations of suspended sediment (0.05-1 g l super(-1)) during maximum tidal current velocity with concentrations in the bottom 30 cm exceeding 70 g l super(-1) (fluid mud). A correlation between salinity stratification and increased suspended sediment concentration suggests that inhibited vertical mixing enhances the settling of flocculated sediments to the bed. Measurements made during May 1999 show a two-order-of-magnitude decrease in the concentration of near-bed sediments. A decrease in river discharge during the 1999 observation period of more than 100 m super(3) s super(-1) suggests that changes in the hydrography and in the supply of sediments to the system both may be important factors in the trapping of fine-grained sediments in the region. The source of sediments is likely from muddy deposits in the Fenwick Cut, a man-made section of the Atlantic Intracoastal Waterway about 2 km north of the Mud Reach that connects the Ashepoo and Edisto Rivers. The Fenwick Cut appears to be an effective area for trapping sediments where shoaling has increased by 130% in the last decade. Current measurements show that flow velocities decrease through the Cut, likely allowing for the settling of suspended particles that form the thick deposits of unconsolidated mud observed during both years. JF - Estuaries AU - Blake, A C AU - Kineke, G C AU - Milligan, T G AU - Alexander, C R AD - Space and Naval Warfare Systems Center, Marine Environmental Quality Branch D362, 53475 Strothe Road, Building 111, Room 258, San Diego, California 92152-6310, USA, carlsona@pescado.spawar.navy.mil Y1 - 2001/10// PY - 2001 DA - Oct 2001 SP - 721 EP - 733 VL - 24 IS - 5 SN - 0160-8347, 0160-8347 KW - USA, South Carolina KW - Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts; Aqualine Abstracts KW - ANW, USA, South Carolina, Ashepoo Estuary KW - Estuarine Environment KW - Sediment KW - Stratification KW - Mixing KW - Resuspended sediments KW - Salinity KW - Sediment transport KW - Sedimentation KW - Rivers KW - Marine KW - Suspended solids KW - Estuaries KW - Trap KW - Mud KW - Flow Discharge KW - Suspended Load KW - Suspended particulate matter KW - Tidal currents KW - Shoals KW - Tidal Currents KW - Shoaling KW - Turbidity KW - Sediment dynamics KW - Q2 09264:Sediments and sedimentation KW - O 3050:Sediment Dynamics KW - SW 0870:Erosion and sedimentation KW - AQ 00003:Monitoring and Analysis of Water and Wastes UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18220641?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Estuaries&rft.atitle=Sediment+Trapping+and+Transport+in+the+ACE+Basin%2C+South+Carolina&rft.au=Blake%2C+A+C%3BKineke%2C+G+C%3BMilligan%2C+T+G%3BAlexander%2C+C+R&rft.aulast=Blake&rft.aufirst=A&rft.date=2001-10-01&rft.volume=24&rft.issue=5&rft.spage=721&rft.isbn=&rft.btitle=&rft.title=Estuaries&rft.issn=01608347&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Dedicated Issue: Processes and Products of the Estuarine Turbidity Maximum. N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Resuspended sediments; Sediment transport; Suspended particulate matter; Sedimentation; Sediment dynamics; Suspended solids; Estuaries; Shoaling; Trap; Sediment; Stratification; Tidal currents; Rivers; Salinity; Shoals; Estuarine Environment; Tidal Currents; Flow Discharge; Mud; Suspended Load; Mixing; Turbidity; ANW, USA, South Carolina, Ashepoo Estuary; Marine ER - TY - JOUR T1 - The Dynamics of Science, Perception, and Policy during the Outbreak of Pfiesteria in the Chesapeake Bay AN - 18189814; 5222218 AB - An outbreak of Pfiesteria in the Chesapeake Bay in 1997 affected both fish and humans, leading to a media frenzy, intensive scientific investigations, and ultimately policy changes that would influence the national debate on pollution controls and the link between environmental and human health. JF - Bioscience AU - Magnien, R E AD - Tidewater Ecosystem Assessment Division in the Maryland Department of Natural Resources, Annapolis, MD 21402, USA, rmagnien@dnr.state.md.us Y1 - 2001/10// PY - 2001 DA - October 2001 SP - 843 EP - 852 PB - American Institute of Biological Sciences VL - 51 IS - 10 SN - 0006-3568, 0006-3568 KW - USA, Chesapeake Bay KW - man KW - Risk Abstracts; Health & Safety Science Abstracts; Pollution Abstracts; Ecology Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources; Microbiology Abstracts C: Algology, Mycology & Protozoology; Water Resources Abstracts KW - Environmental Quality KW - Government policy KW - Pollution effects KW - Public health KW - Pisces KW - Water Pollution Control KW - Dangerous organisms KW - Fish kill KW - Public Health KW - Dinoflagellates KW - Environmental Policy KW - Pfiesteria KW - Policies KW - Government policies KW - Toxicity KW - ANW, USA, Chesapeake Bay KW - Toxins KW - Water pollution KW - Environmental protection KW - Microorganisms KW - Environmental quality KW - Neurotoxins KW - Public Opinion KW - Pollution control KW - K 03009:Algae KW - R2 23090:Policy and planning KW - H 3000:Environment and Ecology KW - P 9000:ENVIRONMENTAL ACTION KW - D 04803:Pollution effects KW - SW 3070:Water quality control KW - K 03039:Algae KW - Q1 08121:Law, policy, economics and social sciences KW - Q5 08524:Public health, medicines, dangerous organisms UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18189814?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Bioscience&rft.atitle=The+Dynamics+of+Science%2C+Perception%2C+and+Policy+during+the+Outbreak+of+Pfiesteria+in+the+Chesapeake+Bay&rft.au=Magnien%2C+R+E&rft.aulast=Magnien&rft.aufirst=R&rft.date=2001-10-01&rft.volume=51&rft.issue=10&rft.spage=843&rft.isbn=&rft.btitle=&rft.title=Bioscience&rft.issn=00063568&rft_id=info:doi/10.1043%2F0006-3568%282001%29051%280843%3ATDOSPA%292.0.CO%3B2 LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Fish kill; Dangerous organisms; Policies; Pollution effects; Neurotoxins; Environmental protection; Pollution control; Public health; Dinoflagellates; Environmental quality; Government policy; Water pollution; Toxins; Government policies; Water Pollution Control; Public Health; Environmental Quality; Microorganisms; Environmental Policy; Toxicity; Public Opinion; Pisces; Pfiesteria; ANW, USA, Chesapeake Bay DO - http://dx.doi.org/10.1043/0006-3568(2001)051(0843:TDOSPA)2.0.CO;2 ER - TY - JOUR T1 - Normalization for citation analysis. AN - 85362008; pmid-11721877 JF - Cortex; a journal devoted to the study of the nervous system and behavior AU - Kostoff, R N AD - Office of Naval Research, Arlington, VA 22217, USA. kostofr@onr.navy.mil Y1 - 2001/09// PY - 2001 DA - Sep 2001 SP - 604 EP - 606 VL - 37 IS - 4 SN - 0010-9452, 0010-9452 KW - Index Medicus KW - National Library of Medicine KW - *Bibliometrics KW - Humans UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85362008?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Cortex%3B+a+journal+devoted+to+the+study+of+the+nervous+system+and+behavior&rft.atitle=Normalization+for+citation+analysis.&rft.au=Kostoff%2C+R+N&rft.aulast=Kostoff&rft.aufirst=R&rft.date=2001-09-01&rft.volume=37&rft.issue=4&rft.spage=604&rft.isbn=&rft.btitle=&rft.title=Cortex%3B+a+journal+devoted+to+the+study+of+the+nervous+system+and+behavior&rft.issn=00109452&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Estimated ventilation requirements for personal air-cooling systems. AN - 71183776; 11565822 AB - Individuals wearing encapsulating garments require auxiliary cooling systems to sustain physical and cognitive performance when exposed to high temperatures or workloads. Heat transfer in such cooling systems is typically based on either air or liquid as the heat exchange medium. Designing air-cooled systems requires knowledge of the quantity of heat to be extracted and cooling system design criteria, inlet air temperature and humidity and ventilation rates. This paper addresses this issue by viewing the human as a simple time averaged heat source whose temperature must be maintained within a specified range. Integrating heat production over time permits heat extraction to be separated from physiological thermoregulation. Framing physical workload and ambient conditions in terms of military relevant scenarios for rear cabin helicopter aircrew (25 yr old male working at 45% VO2max), families of curves were identified that define air conditioning system design criteria for given conditions. JF - Aviation, space, and environmental medicine AU - Kaufman, J W AD - Crew Systems Engineering Department, Naval Air Warfare Center Aircraft Division, Patuxent River, MD 20670-1906, USA. kaufmanjw@navair.navy.mil Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 842 EP - 847 VL - 72 IS - 9 SN - 0095-6562, 0095-6562 KW - Index Medicus KW - Space life sciences KW - Human Engineering KW - Equipment Design KW - Ventilation KW - Body Temperature KW - Humans KW - Humidity KW - Air Conditioning -- standards KW - Air Conditioning -- instrumentation KW - Protective Clothing -- adverse effects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71183776?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aviation%2C+space%2C+and+environmental+medicine&rft.atitle=Estimated+ventilation+requirements+for+personal+air-cooling+systems.&rft.au=Kaufman%2C+J+W&rft.aulast=Kaufman&rft.aufirst=J&rft.date=2001-09-01&rft.volume=72&rft.issue=9&rft.spage=842&rft.isbn=&rft.btitle=&rft.title=Aviation%2C+space%2C+and+environmental+medicine&rft.issn=00956562&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-08 N1 - Date created - 2001-09-21 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Multiresidue method for the analysis of pesticide residues in fruits and vegetables by accelerated solvent extraction and capillary gas chromatography. AN - 71176080; 11559102 AB - An analytical procedure using accelerated solvent extraction and capillary gas chromatography with electron capture and flame photometric detections was developed to simultaneously determine residues of different pesticides in fruits and vegetables. Single laboratory validation of the method was carried out for 28 compounds selected from eight pesticide classes, in blank and fortified samples of fresh pear, cantaloupe, white potato, and cabbage. The method had to meet specific established validation criteria for regulatory purposes applicable to our laboratory. At each of the two fortification levels studied, 24 of the 28 pesticides gave recoveries of more than 70% with a coefficient of variation of less than 10%. With respect to existing procedures, the method showed acceptable limits of detection (from 0.0019 to 0.14 microg/g depending on the pesticide and matrix) while minimizing environmental concerns, time, and labor. JF - Journal of agricultural and food chemistry AU - Adou, K AU - Bontoyan, W R AU - Sweeney, P J AD - State Chemist Section, Maryland Department of Agriculture, 50 Harry S. Truman Parkway, Annapolis, Maryland 21401, USA. kouamea@mda.state.md.us Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 4153 EP - 4160 VL - 49 IS - 9 SN - 0021-8561, 0021-8561 KW - Pesticide Residues KW - 0 KW - Solvents KW - Index Medicus KW - Reproducibility of Results KW - Food Contamination -- analysis KW - Vegetables -- chemistry KW - Pesticide Residues -- analysis KW - Fruit -- chemistry KW - Chromatography, Gas -- methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71176080?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+agricultural+and+food+chemistry&rft.atitle=Multiresidue+method+for+the+analysis+of+pesticide+residues+in+fruits+and+vegetables+by+accelerated+solvent+extraction+and+capillary+gas+chromatography.&rft.au=Adou%2C+K%3BBontoyan%2C+W+R%3BSweeney%2C+P+J&rft.aulast=Adou&rft.aufirst=K&rft.date=2001-09-01&rft.volume=49&rft.issue=9&rft.spage=4153&rft.isbn=&rft.btitle=&rft.title=Journal+of+agricultural+and+food+chemistry&rft.issn=00218561&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-10-25 N1 - Date created - 2001-09-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Small recirculating filters for nitrogen reduction. AN - 71153013; 11544843 AB - Concerned about the negative impacts of nitrogen loading from septic systems on the Chesapeake Bay watershed, Maryland's Anne Arundel County Health Department has pioneered the use of small recirculating sand filters to reduce nitrogen in effluent from residential septic systems. Recirculating sand filters can reduce the total nitrogen in septic-tank effluent by up to 70 percent. Years of experience and the county's participation in the National Onsite Demonstration Project have led to modifications that make the filters more acceptable to homeowners. Use of alternative media, changes in flow patterns, and homeowner education have increased acceptance by homeowners. JF - Journal of environmental health AU - Piluk, R J AU - Byers, B R AD - Anne Arundel County Department of Health, J. Howard Beard Health Services Building, 3 Harry S. Truman Parkway, Annapolis, MD 21401, USA. Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 15 EP - 19 VL - 64 IS - 2 SN - 0022-0892, 0022-0892 KW - Silicon Dioxide KW - 7631-86-9 KW - Nitrogen KW - N762921K75 KW - Index Medicus KW - Filtration KW - Humans KW - Water Movements KW - Adsorption KW - Water Pollution -- prevention & control KW - Public Opinion KW - Nitrogen -- chemistry KW - Water Purification -- methods KW - Silicon Dioxide -- chemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71153013?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+environmental+health&rft.atitle=Small+recirculating+filters+for+nitrogen+reduction.&rft.au=Piluk%2C+R+J%3BByers%2C+B+R&rft.aulast=Piluk&rft.aufirst=R&rft.date=2001-09-01&rft.volume=64&rft.issue=2&rft.spage=15&rft.isbn=&rft.btitle=&rft.title=Journal+of+environmental+health&rft.issn=00220892&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-17 N1 - Date created - 2001-09-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Identification of differential gene expression profiles in rat cortical cells exposed to the neuroactive agents trimethylolpropane phosphate and bicuculline. AN - 71149903; 11544054 AB - Recent technological advancements in microfabrication combined with the rapid acquisition of full genome sequence data have led to the development of DNA arrays that have the capacity to monitor the expression levels of thousands of genes simultaneously. The development of this technology enables the use of functional genomics approaches to identify molecular markers associated with cellular responsiveness to cytotoxic exposures. Databases containing unique cell-response profiles associated with specific toxicants or classes of toxicants can then be used in conjunction with cell-based biosensor platforms for environmental surveillance and toxicological assessment. An important issue that must be addressed, however, is whether DNA arrays can be used to identify transient gene modulation events in a reproducible manner. To address this issue, we utilized a primary embryonic rat (day 18) cortical cell model system and examined the RNA of both chemically treated and untreated cells using radioisotope-labeled cDNA probes and commercially available nylon membrane arrays. Using this approach, we examined experimental variability, basal gene expression variability, the occurrence of false positives, and the reproducibility of gene expression profiles obtained after chemical exposure. Minimal differences in gene modulation were observed between RNA samples from independently cultured cortical cells when array experiments were conducted in parallel (Pearson correlation coefficient for gene intensities =0.98). In contrast, significant differences in gene expression were observed between array experiments conducted at different times with an identical RNA source (Pearson correlation coefficient for gene intensities=0.91). Our results suggest the effect of basal gene activity differences in independently isolated cell cultures is negligible and that experimental variability possibly associated with the handling of RNA samples, differences in reverse transcription efficiency, hybridization, and/or signal acquisition are the primary contributors to variability in measurements. Using cDNA array analysis of unexposed cells from three independent cell culture preparations, we calculated false positive gene modulation events as a function of the threshold absolute value of log(2) >1.0. The number of false positives using this criteria was 1-10 gene/ESTs/5109 actively transcribed gene/ESTs represented on the array. Using three independent replicate experiments of untreated cortical cell cultures, we determined that a threshold criterion of absolute value of log(2) >0.63 for triplicate experiments would reduce the expected number of false positives in our experiments to less than one. Using this criterion, reproducible gene expression profiles were identified in cortical cells exposed to the neuroactive agents trimethylolpropane phosphate and bicuculline. JF - Biosensors & bioelectronics AU - Andreadis, J D AU - Mann, T T AU - Russell, A C AU - Stenger, D A AU - Pancrazio, J J AD - Center for Bio/Molecular Science and Engineering, Code 6910, Naval Research Laboratory, Washington, DC 20375, USA. jxa@ccalpha4.nrl.navy.mil Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 593 EP - 601 VL - 16 IS - 7-8 SN - 0956-5663, 0956-5663 KW - Bridged Bicyclo Compounds, Heterocyclic KW - 0 KW - GABA Antagonists KW - 4-ethyl-1-phospha-2,6,7 trioxabicyclo(2.2.2)octane-1-oxide KW - 1005-93-2 KW - Bicuculline KW - Y37615DVKC KW - Index Medicus KW - Rats KW - Gene Expression -- drug effects KW - Animals KW - Reproducibility of Results KW - Oligonucleotide Array Sequence Analysis KW - Cells, Cultured KW - GABA Antagonists -- pharmacology KW - Bicuculline -- pharmacology KW - Cerebral Cortex -- drug effects KW - Bridged Bicyclo Compounds, Heterocyclic -- pharmacology KW - Cerebral Cortex -- metabolism KW - Gene Expression Profiling -- methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71149903?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biosensors+%26+bioelectronics&rft.atitle=Identification+of+differential+gene+expression+profiles+in+rat+cortical+cells+exposed+to+the+neuroactive+agents+trimethylolpropane+phosphate+and+bicuculline.&rft.au=Andreadis%2C+J+D%3BMann%2C+T+T%3BRussell%2C+A+C%3BStenger%2C+D+A%3BPancrazio%2C+J+J&rft.aulast=Andreadis&rft.aufirst=J&rft.date=2001-09-01&rft.volume=16&rft.issue=7-8&rft.spage=593&rft.isbn=&rft.btitle=&rft.title=Biosensors+%26+bioelectronics&rft.issn=09565663&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-22 N1 - Date created - 2001-09-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Design and demonstration of an automated cell-based biosensor. AN - 71149855; 11544047 AB - Cell-based biosensors have the capacity to respond to a wide range of analytes in a physiologically relevant manner and appear well-suited for toxicity monitoring of both known and unknown analytes. One means of acquiring cellular functional information for biosensor applications involves extracellular recording from excitable cells, which can generate noninvasive and long-term measurements. Previous work from our laboratory described a prototype portable system capable of high signal-to-noise extracellular recordings, in spite of deficiencies in thermal control, fluidics handling, and absence of data acquisition (DAQ) capability. The present work describes a cell-based biosensor system that incorporates low noise amplifier and filter boards, a two-stage thermal control system with integrated fluidics and a flexible graphical user interface for DAQ and control implemented on a personal computer. Wherever possible, commercial off-the-shelf components have been utilized for system design and fabrication. The system exhibits input-referred noise levels of 5-10 microV(RMS), such that extracellular potentials exceeding 50-60 microV can be readily resolved. In addition, the biosensor system is capable of automated temperature and fluidics control. Flow rates can range from 0-2.5 ml/min, while the cell recording chamber temperature is maintained within a range of 36-37 degrees C. To demonstrate the capability of this system to resolve small extracellular potentials, recordings from embryonic chick cardiac myocytes have been performed. JF - Biosensors & bioelectronics AU - Gray, S A AU - Kusel, J K AU - Shaffer, K M AU - Shubin, Y S AU - Stenger, D A AU - Pancrazio, J J AD - Center for Bio/Molecular Science and Engineering, Code 6900, Naval Research Laboratory, Washington, DC 20375, USA. Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 535 EP - 542 VL - 16 IS - 7-8 SN - 0956-5663, 0956-5663 KW - Index Medicus KW - Software KW - Myocardium -- cytology KW - Animals KW - Equipment Design KW - Cells, Cultured KW - Chick Embryo KW - Action Potentials KW - Myocardium -- metabolism KW - Biosensing Techniques -- statistics & numerical data KW - Biosensing Techniques -- instrumentation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71149855?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biosensors+%26+bioelectronics&rft.atitle=Design+and+demonstration+of+an+automated+cell-based+biosensor.&rft.au=Gray%2C+S+A%3BKusel%2C+J+K%3BShaffer%2C+K+M%3BShubin%2C+Y+S%3BStenger%2C+D+A%3BPancrazio%2C+J+J&rft.aulast=Gray&rft.aufirst=S&rft.date=2001-09-01&rft.volume=16&rft.issue=7-8&rft.spage=535&rft.isbn=&rft.btitle=&rft.title=Biosensors+%26+bioelectronics&rft.issn=09565663&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-22 N1 - Date created - 2001-09-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Methods for short time series analysis of cell-based biosensor data. AN - 71148073; 11544044 AB - This paper describes two approaches for sensing changes in spiking cells when only a limited amount of spike data is available, i.e., dynamically constructed local expansion rates and spike area distributions. The two methods were tested on time series from cultured neuron cells that exhibit spiking both autonomously and in the presence of periodic stimulation. Our tested hypothesis was that minute concentrations of toxins could affect the local statistics of the dynamics. Short data sets having relatively few spikes were generated from experiments on cells before and after being treated with a small concentration of channel blocker. In spontaneous spiking cells, local expansion rates show a sensitivity that correlates with channel concentration level, while stimulated cells show no such correlation. Spike area distributions on the other hand showed measurable differences between control and treated conditions for both types of spiking, and a much higher degree of sensitivity. Because these methods are based on analysis of short time series analysis, they might provide novel means for cell drug and toxin detection. JF - Biosensors & bioelectronics AU - Schwartz, I B AU - Billings, L AU - Pancrazio, J J AU - Schnur, J M AD - Naval Research Laboratory, Special Project in Nonlinear Science, Code 6700.3, Washington, DC 20375, USA. schwartz@nlschaos.nrl.navy.mil Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 503 EP - 512 VL - 16 IS - 7-8 SN - 0956-5663, 0956-5663 KW - Neurotoxins KW - 0 KW - Cadmium Chloride KW - J6K4F9V3BA KW - Index Medicus KW - Rats KW - Animals KW - Patch-Clamp Techniques KW - Neurons -- drug effects KW - Cadmium Chloride -- toxicity KW - Neurons -- physiology KW - Data Interpretation, Statistical KW - Mice KW - Action Potentials -- drug effects KW - Neurotoxins -- toxicity KW - Cell Line KW - Biosensing Techniques -- statistics & numerical data UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71148073?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biosensors+%26+bioelectronics&rft.atitle=Methods+for+short+time+series+analysis+of+cell-based+biosensor+data.&rft.au=Schwartz%2C+I+B%3BBillings%2C+L%3BPancrazio%2C+J+J%3BSchnur%2C+J+M&rft.aulast=Schwartz&rft.aufirst=I&rft.date=2001-09-01&rft.volume=16&rft.issue=7-8&rft.spage=503&rft.isbn=&rft.btitle=&rft.title=Biosensors+%26+bioelectronics&rft.issn=09565663&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-22 N1 - Date created - 2001-09-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - The use of GABA(A) receptors expressed in neural precursor cells for cell-based assays. AN - 71147475; 11544042 AB - GABA(A) receptors are known targets for certain classes of environmental neurotoxins and pharmaceutical compounds. Since few neural cell lines express functional GABA(A) receptors, the capacity to rapidly screen for compounds that affect GABA(A) receptor function is presently limited. Previous work has demonstrated that rat neural precursor cells express functional GABA(A) receptors that can be monitored via Ca(2+) imaging. This study examined GABA(A) receptor subunit expression to determine whether GABA(A) receptor function and its interactions with neurotoxins is preserved after passaging. Neural precursor cells isolated from embryonic day 13 rat brain were expanded in serum-free medium containing basic fibroblast growth factor and passaged three times. Reverse transcription-polymerase chain reaction analysis demonstrated early expression of abundant mRNAs encoding various GABA(A) receptor subunits. Ca(2+) imaging showed that the highly proliferating precursor cells in passaged cultures maintained expression of functional GABA(A) receptors. In addition, we showed that trimethylolpropane phosphate, a neurotoxin generated during partial pyrolysis of a synthetic ester turbine engine lubricant, potently inhibited muscimol (GABA(A) receptor agonist) but not depolarization-induced cytosolic Ca(2+) increase. The findings of this study suggest that neural precursor cells may be well suited for the evaluation of certain environmental neurotoxins with convulsant activity. The potential use of neural precursor cells in high-throughput screens for compounds acting on GABA(A) receptors is discussed. JF - Biosensors & bioelectronics AU - Shaffer, K M AU - Lin, H J AU - Maric, D AU - Pancrazio, J J AU - Stenger, D A AU - Barker, J L AU - Ma, W AD - Center for Bio/Molecular Science and Engineering, Code 6900, Naval Research Laboratory, Washington, DC 20375, USA. Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 481 EP - 489 VL - 16 IS - 7-8 SN - 0956-5663, 0956-5663 KW - Bridged Bicyclo Compounds, Heterocyclic KW - 0 KW - Neurotoxins KW - Protein Subunits KW - RNA, Messenger KW - Receptors, GABA-A KW - 4-ethyl-1-phospha-2,6,7 trioxabicyclo(2.2.2)octane-1-oxide KW - 1005-93-2 KW - Calcium KW - SY7Q814VUP KW - Index Medicus KW - Animals KW - Gene Expression KW - Stem Cells -- metabolism KW - RNA, Messenger -- genetics KW - Reverse Transcriptase Polymerase Chain Reaction KW - Neurotoxins -- toxicity KW - Calcium -- metabolism KW - Rats KW - Bridged Bicyclo Compounds, Heterocyclic -- toxicity KW - RNA, Messenger -- metabolism KW - Cells, Cultured KW - Neurons -- cytology KW - Receptors, GABA-A -- genetics KW - Receptors, GABA-A -- drug effects KW - Receptors, GABA-A -- chemistry KW - Biosensing Techniques -- methods UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71147475?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Biosensors+%26+bioelectronics&rft.atitle=The+use+of+GABA%28A%29+receptors+expressed+in+neural+precursor+cells+for+cell-based+assays.&rft.au=Shaffer%2C+K+M%3BLin%2C+H+J%3BMaric%2C+D%3BPancrazio%2C+J+J%3BStenger%2C+D+A%3BBarker%2C+J+L%3BMa%2C+W&rft.aulast=Shaffer&rft.aufirst=K&rft.date=2001-09-01&rft.volume=16&rft.issue=7-8&rft.spage=481&rft.isbn=&rft.btitle=&rft.title=Biosensors+%26+bioelectronics&rft.issn=09565663&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-01-22 N1 - Date created - 2001-09-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Microstructure of graphite with unusual carbon isotopes in lodranite Graves Nunataks 95209 AN - 52150346; 2002-010111 JF - Meteoritics & Planetary Science AU - Stroud, R M AU - Nittler, L R AU - McCoy, T J AU - Consolmagno, Guy J Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 200 PB - Meteoritical Society, Fayetteville, AR VL - 36 IS - 9, Suppl. SN - 1086-9379, 1086-9379 KW - stony irons KW - isotopes KW - isotope ratios KW - C-13/C-12 KW - microstructure KW - native elements KW - lodranite KW - stable isotopes KW - meteorites KW - graphite KW - mineral composition KW - Graves Nunataks Meteorites KW - carbon KW - GRA 95209 KW - chemical composition KW - 05B:Petrology of meteorites and tektites UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52150346?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Meteoritics+%26+Planetary+Science&rft.atitle=Microstructure+of+graphite+with+unusual+carbon+isotopes+in+lodranite+Graves+Nunataks+95209&rft.au=Stroud%2C+R+M%3BNittler%2C+L+R%3BMcCoy%2C+T+J%3BConsolmagno%2C+Guy+J&rft.aulast=Stroud&rft.aufirst=R&rft.date=2001-09-01&rft.volume=36&rft.issue=9%2C+Suppl.&rft.spage=200&rft.isbn=&rft.btitle=&rft.title=Meteoritics+%26+Planetary+Science&rft.issn=10869379&rft_id=info:doi/ L2 - http://cavern.uark.edu/~meteor/ LA - English DB - GeoRef N1 - Conference title - 64th annual meeting of the Meteoritical Society N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 7 N1 - PubXState - AR N1 - Last updated - 2014-03-14 N1 - SubjectsTermNotLitGenreText - C-13/C-12; carbon; chemical composition; GRA 95209; graphite; Graves Nunataks Meteorites; isotope ratios; isotopes; lodranite; meteorites; microstructure; mineral composition; native elements; stable isotopes; stony irons ER - TY - JOUR T1 - Mesoscale characteristics AN - 50227497; 2002-036381 AB - The spatial length, time, and propagation characteristics of the ocean mesoscale variability are examined throughout the globe. Sea surface height (SSH) variations from a combination of the Geosat Exact Repeat Mission, ERS-1, ERS-2, and TOPEX/Poseidon altimeter satellites are used to compute the observed covariance of the mesoscale. The mesoscale is defined as the residual SSH after removing a filtered large-scale SSH having length scales greater than 750 km zonally and 250 km meridionally. From the observed binned covariance function, an objective analysis computes characteristics of the climatological mesoscale variability. Westward propagation is dominant throughout the globe. The Antarctic Circumpolar Current appears to affect the zonal propagation, as the propagation direction is eastward throughout this current. (MOD. JOURN. ABST.) JF - Journal of Geophysical Research AU - Jacobs, G A AU - Barron, C N AU - Rhodes, R C Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 19 EP - 19,595 PB - American Geophysical Union, Washington, DC VL - 106 IS - C9 SN - 0148-0227, 0148-0227 KW - currents KW - Southern Ocean KW - sea surface height KW - ocean circulation KW - statistical analysis KW - Gulf Stream KW - Antarctic Circumpolar Current KW - altimetry KW - European remote sensing satellite KW - satellite methods KW - ocean currents KW - temperature KW - conductivity KW - ocean waves KW - ERS KW - bathymetry KW - Geosat Exact Repeat Mission KW - world ocean KW - mesoscale variability KW - TOPEX/POSEIDON KW - remote sensing KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50227497?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Mesoscale+characteristics&rft.au=Jacobs%2C+G+A%3BBarron%2C+C+N%3BRhodes%2C+R+C&rft.aulast=Jacobs&rft.aufirst=G&rft.date=2001-09-01&rft.volume=106&rft.issue=C9&rft.spage=19&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC000669 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 37 N1 - PubXState - DC N1 - Document feature - illus. incl. 9 plates, sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - altimetry; Antarctic Circumpolar Current; bathymetry; conductivity; currents; ERS; European remote sensing satellite; Geosat Exact Repeat Mission; Gulf Stream; mesoscale variability; ocean circulation; ocean currents; ocean waves; remote sensing; satellite methods; sea surface height; Southern Ocean; statistical analysis; temperature; TOPEX/POSEIDON; world ocean DO - http://dx.doi.org/10.1029/2000JC000669 ER - TY - JOUR T1 - Calculation of spectral weighting functions for the solar photobleaching of chromophoric dissolved organic matter in temperate lakes AN - 18195381; 5238372 AB - The effect of solar radiation on the dissolved absorption coefficient (a sub(CDOM)[ lambda ]), which reflects the concentration of chromophoric dissolved organic matter (CDOM), was investigated in several lakes near Bariloche, Argentina and in northeastern Pennsylvania, USA. Samples of 0.2 mu m filtered lake water were exposed in quartz tubes to different portions of the solar spectrum using optical cutoff filters to remove parts of the ultraviolet (UV) region of the solar spectrum. Changes in the spectral absorption in these samples and the absorbed incident energy were used to calculate spectral weighting functions (SWFs) for the photobleaching (PB) of CDOM. PB was measured as the loss of a sub(CDOM)( lambda ) (the a sub(CDOM)[ lambda ] was averaged from 280 to 500 nm) per unit absorbed energy. CDOM from humic and clear lakes, as well as from a Sphagnum bog and an algal culture, was used in the experiments covering a wide range of carbon sources. We used an iterative, nonlinear optimization method to fit the measured results to a simple exponential function in order to generate each SWF. Comparing individual SWFs calculated for various CDOM sources, we computed a summary SWF from the experiments using epilimnial CDOM from our study lakes. Our summary SWF was able to explain 80-90% of the observed variance in our exposure experiments, and we were able to predict PB results obtained for other Argentine lakes (mean error 14.5%). Finally, we calculated that the effect of UV-B radiation on PB was small (<20% of total decrease in the absorption coefficient) compared to UV-A and blue light radiation. This suggested that increased UV-B radiation due to stratospheric ozone depletion would not greatly increase the photobleaching of whole water column CDOM in Patagonian lakes (<10%). JF - Limnology and Oceanography AU - Osburn, CL AU - Zagarese, HE AU - Morris, D P AU - Hargreaves, B R AU - Cravero, W E AD - Naval Research Laboratory, Code 6115, 4555 Overlook Ave SW, Washington, D.C. 2035, USA Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 1455 EP - 1467 VL - 46 IS - 6 SN - 0024-3590, 0024-3590 KW - Argentina, Bariloche KW - USA, Pennsylvania KW - ASFA 2: Ocean Technology Policy & Non-Living Resources; Aqualine Abstracts; Water Resources Abstracts KW - Photochemistry KW - Spectral Analysis KW - Optical properties KW - Spectral analysis (see also Multispectral analysis) KW - Chemical limnology KW - Solar radiation KW - Water analysis KW - Colour KW - Lakes KW - Organic Matter KW - Ultraviolet radiation KW - Optical Properties KW - Solar Radiation KW - Experimental Data KW - Water colour KW - Organic matter KW - Spectral analysis KW - Color KW - Ultraviolet Radiation KW - Light penetration KW - AQ 00001:Water Resources and Supplies KW - SW 0850:Lakes KW - Q2 09184:Composition of water UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18195381?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Limnology+and+Oceanography&rft.atitle=Calculation+of+spectral+weighting+functions+for+the+solar+photobleaching+of+chromophoric+dissolved+organic+matter+in+temperate+lakes&rft.au=Osburn%2C+CL%3BZagarese%2C+HE%3BMorris%2C+D+P%3BHargreaves%2C+B+R%3BCravero%2C+W+E&rft.aulast=Osburn&rft.aufirst=CL&rft.date=2001-09-01&rft.volume=46&rft.issue=6&rft.spage=1455&rft.isbn=&rft.btitle=&rft.title=Limnology+and+Oceanography&rft.issn=00243590&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Photochemistry; Water colour; Lakes; Optical properties; Organic matter; Ultraviolet radiation; Spectral analysis; Chemical limnology; Light penetration; Solar radiation; Colour; Spectral analysis (see also Multispectral analysis); Water analysis; Experimental Data; Solar Radiation; Organic Matter; Spectral Analysis; Optical Properties; Ultraviolet Radiation; Color ER - TY - JOUR T1 - Institutional arrangements for managing the great lakes of the world: Results of a workshop on implementing the watershed approach AN - 18194478; 5225105 AB - The conceptual framework for lake management has evolved at an accelerating rate in recent years to include the basic principles of a watershed approach: (i) citizen and stakeholder involvement is important throughout the planning and management process; (ii) the geographic focus for management activities includes the lake and its entire watershed; and (iii) mechanisms need to be in place to promote cooperation among different government jurisdictions and organizations in the watershed. Creating effective institutional arrangements for implementing this watershed approach in lake regions is perhaps the most challenging and important issue facing the world's lakes. LakeNet organized a workshop at the 8th International Conference on the Conservation and Management of Lakes in May 1999. This article is a synthesis of the results of the workshop and the eight case reports prepared by the workshop participants published in this special issue. Seven major threats to lakes were identified: (i) accelerated eutrophication; (ii) invasive species; (iii) toxic contamination; (iv) overfishing; (v) water diversion, (vi) acidification; and (vii) climate change. Institutions and institutional arrangements for addressing these issues and for implementing a watershed approach are just beginning to emerge on lakes around the world. All of the institutions described in the case reports were established or formalized during the 1980s and 1990s. The legal mechanisms creating these institutions range from cooperative agreements among jurisdictions for purposes of policy and planning to national laws and international treaties with full regulatory powers. The knowledge base, political will and financial resources for these activities were very small in comparison with the complexity of the task at hand. JF - Lakes & Reservoirs: Research and Management AU - Borre, L AU - Barker AU - Duker, LE AD - LakeNet Secretariat, Monitor International, 300 State Street Annapolis, Maryland 21403, USA, lborre@monitorinternational.org Y1 - 2001/09// PY - 2001 DA - Sep 2001 SP - 199 EP - 209 PB - Blackwell Science Ltd VL - 6 IS - 3 SN - 1320-5331, 1320-5331 KW - ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Catchment area KW - Policy Making KW - Conferences KW - Case Studies KW - Catchment Areas KW - Economic Aspects KW - Freshwater KW - Water Resources Management KW - Institutions KW - Watersheds KW - Water quality control KW - Lakes KW - Water management KW - Political aspects KW - Ecosystem management KW - Political Aspects KW - Environment management KW - Q5 08523:Conservation, wildlife management and recreation KW - SW 0850:Lakes KW - Q2 09123:Conservation KW - Q1 08121:Law, policy, economics and social sciences UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18194478?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Lakes+%26+Reservoirs%3A+Research+and+Management&rft.atitle=Institutional+arrangements+for+managing+the+great+lakes+of+the+world%3A+Results+of+a+workshop+on+implementing+the+watershed+approach&rft.au=Borre%2C+L%3BBarker%3BDuker%2C+LE&rft.aulast=Borre&rft.aufirst=L&rft.date=2001-09-01&rft.volume=6&rft.issue=3&rft.spage=199&rft.isbn=&rft.btitle=&rft.title=Lakes+%26+Reservoirs%3A+Research+and+Management&rft.issn=13205331&rft_id=info:doi/10.1046%2Fj.1440-1770.2001.00148.x LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Water quality control; Catchment area; Lakes; Water management; Political aspects; Ecosystem management; Watersheds; Environment management; Policy Making; Conferences; Case Studies; Catchment Areas; Economic Aspects; Institutions; Water Resources Management; Political Aspects; Freshwater DO - http://dx.doi.org/10.1046/j.1440-1770.2001.00148.x ER - TY - JOUR T1 - Detection of Dengue Viral RNA in Aedes aegypti (Diptera: Culicidae) Exposed to Sticky Lures Using Reverse-Transcriptase Polymerase Chain Reaction AN - 18186542; 5208330 AB - Active surveillance for dengue (DEN) virus infected mosquitoes can be an effective way to predict the risk of dengue infection in a given area. However, doing so may pose logistical problems if mosquitoes must be kept alive or frozen fresh to detect DEN virus. In an attempt to simplify mosquito processing, we evaluated the usefulness of a sticky lure and a seminested reverse-transcriptase polymerase chain reaction assay (RT-PCR) for detecting DEN virus RNA under laboratory conditions using experimentally infected Aedes aegypti (L.) mosquitoes. In the first experiment, 40 male mosquitoes were inoculated with 0.13 mu l of a 10 super(4) pfu/ml DEN-2 stock solution. After a 7-d incubation period, the mosquitoes were applied to the sticky lure and kept at room temperatures of 23-30 degree C. Following 7, 10, 14, and 28 d application, 10 mosquitoes each were removed from the lure, pooled, and assayed for virus. DEN virus nucleic acid was clearly detectable in all pools up to 28 d after death. A second study evaluated sensitivity and specificity using one, two, and five DEN-infected mosquitoes removed after 7, 10, 14, 21, and 30 d application and tested by RT-PCR. All four DEN serotypes were individually inoculated in mosquitoes and evaluated using the same procedures as experiment 1. The four serotypes were detectable in as few as one mosquito 30 d after application to the lure with no evidence of cross-reactivity. The combination of sticky lures and RT-PCR show promise for mosquito and dengue virus surveillance and warrant further evaluation. JF - Journal of Medical Entomology AU - Bangs, MJ AU - Tan, R AU - Listiyaningsih, E AU - Kay, B H AU - Porter, K R AD - American Embassy Jakarta, Unit 8132, Department of Entomology, Parasitic Diseases Program, NAMRU-TWO, FPO AP 96520-8132, USA, bangsmj@namru2.med.navy.mil Y1 - 2001/09// PY - 2001 DA - September 2001 SP - 720 EP - 724 PB - Entomological Society of America VL - 38 IS - 5 SN - 0022-2585, 0022-2585 KW - Diptera KW - Mosquitoes KW - Yellow fever mosquito KW - sticky lures KW - surveillance KW - Virology & AIDS Abstracts; ASFA 1: Biological Sciences & Living Resources; ASFA 3: Aquatic Pollution & Environmental Quality; Entomology Abstracts KW - Dengue virus KW - Biological vectors KW - Aedes aegypti KW - Human diseases KW - Nucleotide sequence KW - Vectors KW - Culicidae KW - Freshwater KW - Infection KW - Public health KW - RNA KW - Viral diseases KW - Dengue KW - Analytical techniques KW - DNA KW - RNA-directed DNA polymerase KW - Polymerase chain reaction KW - Disease detection KW - V 22160:Viral infections of invertebrates KW - Q1 08205:Genetics and evolution KW - Q1 08484:Species interactions: parasites and diseases KW - Q5 08524:Public health, medicines, dangerous organisms KW - Q1 08301:General KW - Z 05156:Techniques UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18186542?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Medical+Entomology&rft.atitle=Detection+of+Dengue+Viral+RNA+in+Aedes+aegypti+%28Diptera%3A+Culicidae%29+Exposed+to+Sticky+Lures+Using+Reverse-Transcriptase+Polymerase+Chain+Reaction&rft.au=Bangs%2C+MJ%3BTan%2C+R%3BListiyaningsih%2C+E%3BKay%2C+B+H%3BPorter%2C+K+R&rft.aulast=Bangs&rft.aufirst=MJ&rft.date=2001-09-01&rft.volume=38&rft.issue=5&rft.spage=720&rft.isbn=&rft.btitle=&rft.title=Environmental+Monitoring+and+Assessment&rft.issn=01676369&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-05-27 N1 - SubjectsTermNotLitGenreText - Biological vectors; Human diseases; Viral diseases; Nucleotide sequence; Analytical techniques; DNA; Polymerase chain reaction; Disease detection; Public health; RNA; Dengue; Vectors; RNA-directed DNA polymerase; Infection; Dengue virus; Aedes aegypti; Culicidae; Freshwater DO - http://dx.doi.org/10.1043/0022-2585(2001)038(0720:DODVRI)2.0.CO;2 ER - TY - GEN T1 - Taxes or Fees? The Political Economy of Providing Excludable Public Goods AN - 60526945; 200820765 AB - This paper provides a positive analysis of public provision of excludable public goods financed by uniform taxes or fees. Individuals differing in preferences decide using majority-rule the provision level and financing instrument. The median preference individual is the decisive voter in a tax regime, while an individual with preferences above the median generally determines the fee in a fee regime. Numerical solutions indicate that populations with uniform or left-skewed distributions of preferences choose taxes, while a majority coalition of high and low preference individuals prefer fees when preferences are sufficiently right-skewed. Public good provision under fees exceeds that under taxes in the latter case. JF - SSRN Working Paper Series AU - Swope, Kurtis AU - Janeba, Eckhard AD - United States Naval Academy - General Y1 - 2001/08/22/ PY - 2001 DA - 2001 Aug 22 PB - Social Science Research Network (SSRN), Rochester NY KW - Excludable Public Goods KW - Public Provision KW - Voting KW - Taxation KW - Finance KW - Public Goods KW - Political Economy KW - Voting Behavior KW - 9141: political economy; political economy KW - Taxation KW - Finance KW - Public Goods KW - Political Economy KW - Voting Behavior KW - 9141: political economy; political economy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60526945?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=preprint&rft.jtitle=SSRN+Working+Paper+Series&rft.atitle=Taxes+or+Fees%3F+The+Political+Economy+of+Providing+Excludable+Public+Goods&rft.au=Swope%2C+Kurtis%3BJaneba%2C+Eckhard&rft.aulast=Swope&rft.aufirst=Kurtis&rft.date=2001-08-22&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=SSRN+Working+Paper+Series&rft.issn=&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2008-09-02 N1 - Last updated - 2016-09-28 ER - TY - JOUR T1 - Quaternary ammonium palmitoyl glycol chitosan--a new polysoap for drug delivery. AN - 71038890; 11472828 AB - A new polysoap, quaternary ammonium palmitoyl glycol chitosan (GCPQ, M(w)=178,000 g mole(-1)) with drug solubilising potential has been synthesised and characterised. In solution hydrophobic domains of GCPQ polymeric micelles were identified by the hypsochromic shift in the lambda(max) of methyl orange and by the increase in the ratio of the fluorescence emission intensity of the third and first pyrene vibronic peaks (I(3)/I(1)). At high aqueous concentrations (>10 mg ml(-1)) GCPQ presents as a gel which solubilises pyrene (2.5 mM, normal solubility in water approximately 2 microM) on probe sonication. Dilution of the gel to a liquid solution of polymeric micelles (< or =3.75 mg ml(-1) of GCPQ), results in the observation of fluorescent pyrene excimers (excited dimers) and a high excimer to monomer fluorescence ratio (I(E)/I(M)). However, attempts to solubilise pyrene at a concentration of 2.5 mM in a liquid solution of GCPQ (3.75 mg ml(-1)) results in a reduced I(E)/I(M) value and pyrene precipitation. Viscometry measurements show a more compact conformation for the polymer solubilising pyrene than the polymer alone. The polymer is non-haemolytic when present as the liquid solution and relatively non cytotoxic. In conclusion, a new biocompatible polysoap (potential drug solubiliser) is described which forms hydrophobic domains in solution and shows hysteresis in its solubilisation of pyrene. JF - International journal of pharmaceutics AU - Uchegbu, I F AU - Sadiq, L AU - Arastoo, M AU - Gray, A I AU - Wang, W AU - Waigh, R D AU - Schätzlein, A G AU - Schätzleinä, A G AD - Department of Pharmaceutical Sciences, Strathclyde Institute for Biological Sciences Building, University of Strathclyde, 27 Taylor Street, Glasgow G4 ONR, Scotland, UK. i.f.uchegbu@strath.ac.uk Y1 - 2001/08/14/ PY - 2001 DA - 2001 Aug 14 SP - 185 EP - 199 VL - 224 IS - 1-2 SN - 0378-5173, 0378-5173 KW - Azo Compounds KW - 0 KW - Fluorescent Dyes KW - Indicators and Reagents KW - Pyrenes KW - Quaternary Ammonium Compounds KW - palmitoyl glycol chitosan KW - Chitin KW - 1398-61-4 KW - methyl orange KW - 6B4TC34456 KW - Chitosan KW - 9012-76-4 KW - pyrene KW - 9E0T7WFW93 KW - Index Medicus KW - Molecular Structure KW - Indicators and Reagents -- metabolism KW - Fluorescent Dyes -- metabolism KW - Azo Compounds -- metabolism KW - Spectrometry, Fluorescence KW - Pyrenes -- metabolism KW - Models, Chemical KW - Molecular Weight KW - Cell Line KW - Magnetic Resonance Spectroscopy KW - Drug Delivery Systems KW - Chitin -- chemistry KW - Chitin -- toxicity KW - Chitin -- analogs & derivatives KW - Quaternary Ammonium Compounds -- chemistry KW - Chitin -- chemical synthesis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71038890?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+journal+of+pharmaceutics&rft.atitle=Quaternary+ammonium+palmitoyl+glycol+chitosan--a+new+polysoap+for+drug+delivery.&rft.au=Uchegbu%2C+I+F%3BSadiq%2C+L%3BArastoo%2C+M%3BGray%2C+A+I%3BWang%2C+W%3BWaigh%2C+R+D%3BSch%C3%A4tzlein%2C+A+G%3BSch%C3%A4tzlein%C3%A4%2C+A+G&rft.aulast=Uchegbu&rft.aufirst=I&rft.date=2001-08-14&rft.volume=224&rft.issue=1-2&rft.spage=185&rft.isbn=&rft.btitle=&rft.title=International+journal+of+pharmaceutics&rft.issn=03785173&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-11-01 N1 - Date created - 2001-07-26 N1 - Date revised - 2017-01-13 N1 - SuppNotes - Erratum In: Int J Pharm 2001 Nov 6;230(1-2):77 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Immunoneutralisation of GnRH-I, without cross-reactivity to GnRH-II, in the development of a highly specific anti-fertility vaccine for clinical and veterinary use. AN - 71149104; 11543851 AB - In recent years, several forms of gonadotrophin releasing hormone (GnRH) molecules have been isolated from primate brain. These molecules are very similar in sequence and this raises the question of whether previously developed neutralisation vaccines based on GnRH (now termed GnRH-I) would remove other forms of GnRH (namely GnRH-II) as well. As the function of these other molecules has not yet been clearly defined, potential health risks could exist by their ablation. In view of the high sequence homology between the molecules, this paper describes the production of highly specific polyclonal antibodies against GnRH-I and GnRH-II, with negligible cross-reactivity. The ultimate aim of this is to develop an anti-fertility vaccine which does not present any inappropriate side-effects, caused by neutralisation of a GnRH molecule which may or may not be directly involved in reproduction. Several formulations were investigated, based on analogues of the following molecules, conjugated to tetanus toxoid: 1. GnRH-I pGlu-His-Trp-Ser-Try-Gly-Leu-Arg-Pro-Gly-NH2 and 2. GnRH-II pGlu-His-Trp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH2. The specificity of the antibodies produced was examined, together with effects on fertility and any inappropriate side-effects. Immunostaining of hypothalamic sections was carried out, using the generated antisera, to determine the regional distribution of GnRH-I and GnRH-II neurones, as well as to further evaluate the specificity of the antibodies. JF - Journal of reproductive immunology AU - Ferro, V A AU - Khan, M A AU - Latimer, V S AU - Brown, D AU - Urbanski, H F AU - Stimson, W H AD - Department of Immunology, University of Strathclyde, SIBS Building, 27 Taylor Street, Glasgow G4 ONR, UK. v.a.ferro@strath.ac.uk Y1 - 2001/08// PY - 2001 DA - August 2001 SP - 109 EP - 129 VL - 51 IS - 2 SN - 0165-0378, 0165-0378 KW - Contraceptive Agents, Male KW - 0 KW - Immunoglobulin Isotypes KW - Tetanus Toxoid KW - Vaccines, Conjugate KW - Vaccines, Contraceptive KW - Gonadotropin-Releasing Hormone KW - 33515-09-2 KW - Index Medicus KW - Vaccines, Conjugate -- immunology KW - Animals KW - Vaccines, Conjugate -- adverse effects KW - Brain Chemistry KW - Humans KW - Testis -- pathology KW - Immunoglobulin Isotypes -- blood KW - Immunization Schedule KW - Cross Reactions -- immunology KW - Rats KW - Rats, Sprague-Dawley KW - Tetanus Toxoid -- adverse effects KW - Testis -- anatomy & histology KW - Macaca mulatta KW - Contraceptive Agents, Male -- adverse effects KW - Male KW - Tetanus Toxoid -- immunology KW - Gonadotropin-Releasing Hormone -- metabolism KW - Antibody Specificity KW - Gonadotropin-Releasing Hormone -- immunology KW - Vaccines, Contraceptive -- immunology KW - Vaccines, Contraceptive -- adverse effects KW - Gonadotropin-Releasing Hormone -- analogs & derivatives UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71149104?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+reproductive+immunology&rft.atitle=Immunoneutralisation+of+GnRH-I%2C+without+cross-reactivity+to+GnRH-II%2C+in+the+development+of+a+highly+specific+anti-fertility+vaccine+for+clinical+and+veterinary+use.&rft.au=Ferro%2C+V+A%3BKhan%2C+M+A%3BLatimer%2C+V+S%3BBrown%2C+D%3BUrbanski%2C+H+F%3BStimson%2C+W+H&rft.aulast=Ferro&rft.aufirst=V&rft.date=2001-08-01&rft.volume=51&rft.issue=2&rft.spage=109&rft.isbn=&rft.btitle=&rft.title=Journal+of+reproductive+immunology&rft.issn=01650378&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-10-25 N1 - Date created - 2001-09-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Detection of physiologically active compounds using cell-based biosensors. AN - 71008314; 11451472 AB - Cell-based biosensors are portable devices that contain living biological cells that monitor physiological changes induced by exposure to environmental perturbations such as toxicants, pathogens or other agents. Methods of detecting physiological changes include extracellular electrical recordings, optical measurements, and, in the future, functional genomics and proteomics. Several technical developments are occurring that will increase the feasibility of cell-based biosensors for field applications; these developments include stem cell and 3D culture technologies. Possible scenarios for the use of cell-based biosensors include broad-range detectors of unknown threat agents and functional assessment of identified agents. JF - Trends in biotechnology AU - Stenger, D A AU - Gross, G W AU - Keefer, E W AU - Shaffer, K M AU - Andreadis, J D AU - Ma, W AU - Pancrazio, J J AD - Center for BioMolecular Science and Engineering, Code 6910, Naval Research Laboratory, Washington, DC 20375, USA. das@cbmse.nrl.navy.mil Y1 - 2001/08// PY - 2001 DA - August 2001 SP - 304 EP - 309 VL - 19 IS - 8 SN - 0167-7799, 0167-7799 KW - Index Medicus KW - Neurons KW - Stem Cells KW - Biosensing Techniques UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71008314?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Trends+in+biotechnology&rft.atitle=Detection+of+physiologically+active+compounds+using+cell-based+biosensors.&rft.au=Stenger%2C+D+A%3BGross%2C+G+W%3BKeefer%2C+E+W%3BShaffer%2C+K+M%3BAndreadis%2C+J+D%3BMa%2C+W%3BPancrazio%2C+J+J&rft.aulast=Stenger&rft.aufirst=D&rft.date=2001-08-01&rft.volume=19&rft.issue=8&rft.spage=304&rft.isbn=&rft.btitle=&rft.title=Trends+in+biotechnology&rft.issn=01677799&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-09-20 N1 - Date created - 2001-07-13 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Terrain organization calculated from digital elevation models AN - 51953791; 2003-057571 JF - Chikei = Transactions - Japanese Geomorphological Union AU - Guth, P L AU - Anonymous Y1 - 2001/08// PY - 2001 DA - August 2001 SP - C EP - 80 PB - Nippon Chikeigaku Rengo, Kyoto VL - 22 IS - 4 SN - 0389-1755, 0389-1755 KW - terrains KW - digital cartography KW - cartography KW - digital simulation KW - data processing KW - geomorphology KW - digital terrain models KW - 23:Geomorphology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51953791?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Chikei+%3D+Transactions+-+Japanese+Geomorphological+Union&rft.atitle=Terrain+organization+calculated+from+digital+elevation+models&rft.au=Guth%2C+P+L%3BAnonymous&rft.aulast=Guth&rft.aufirst=P&rft.date=2001-08-01&rft.volume=22&rft.issue=4&rft.spage=C&rft.isbn=&rft.btitle=&rft.title=Chikei+%3D+Transactions+-+Japanese+Geomorphological+Union&rft.issn=03891755&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Fifth international conference on Geomorphology N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - cartography; data processing; digital cartography; digital simulation; digital terrain models; geomorphology; terrains ER - TY - JOUR T1 - Entrapment and controlled release of active agents from halloysite AN - 51825944; 2004-054619 JF - Rocks and Minerals AU - Gaber, B P AU - Price, R R AU - Santos, J P AU - Vittal, V AU - Anonymous Y1 - 2001/08// PY - 2001 DA - August 2001 SP - 254 PB - Heldref Publications, Washington, DC VL - 76 IS - 4 SN - 0035-7529, 0035-7529 KW - silicates KW - maintenance KW - crystal structure KW - catalysts KW - remediation KW - clay minerals KW - oil wells KW - zeolite group KW - sheet silicates KW - framework silicates KW - halloysite KW - geochemistry KW - 01B:Mineralogy of silicates UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51825944?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Rocks+and+Minerals&rft.atitle=Entrapment+and+controlled+release+of+active+agents+from+halloysite&rft.au=Gaber%2C+B+P%3BPrice%2C+R+R%3BSantos%2C+J+P%3BVittal%2C+V%3BAnonymous&rft.aulast=Gaber&rft.aufirst=B&rft.date=2001-08-01&rft.volume=76&rft.issue=4&rft.spage=254&rft.isbn=&rft.btitle=&rft.title=Rocks+and+Minerals&rft.issn=00357529&rft_id=info:doi/ L2 - http://www.rocksandminerals.org/ LA - English DB - GeoRef N1 - Conference title - 27th Rochester mineralogical symposium N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2004-01-01 N1 - PubXState - DC N1 - Last updated - 2012-06-07 N1 - CODEN - ROCMAR N1 - SubjectsTermNotLitGenreText - catalysts; clay minerals; crystal structure; framework silicates; geochemistry; halloysite; maintenance; oil wells; remediation; sheet silicates; silicates; zeolite group ER - TY - JOUR T1 - Evolution of free propagating, two-dimensional surface gravity current fronts AN - 50154800; 2003-038079 AB - This work addresses the two-dimensional propagation and shape evolution of surface gravity current fronts with a surface density outcrop frontal line. The problem is formulated using the reduced gravity shallow water equations, and the gravity currents are assumed to advance into a fluid at rest. We formulate a nonlinear analytical model for the gravity current plume front morphology by applying the shock tube theory of compressible fluids, which casts the problem in the form of an initial value calculation to be solved numerically. The simulations are initiated by assuming three different plan forms for the initial plume front and their subsequent evolutions followed in time. The paper is concerned exclusively with gravity current fronts having initially a uniform frontal propagation speed locally normal to the plume front, and a number of interesting results emerge. We find that an initially concave region of the front can lead to a nonlinear focusing that results in an energetic bulge in the frontal plan view. These bulges form sharp angles, or kinks, where they are joined to the front at their edges on either side. As they evolve, these angles increase toward 180 degrees (a straight line), and the front becomes smoother in time. The orientation of the bulge and kink features predicted by the model is in agreement with visual and radar imagery observations. The kinks are always oriented toward the lighter plume material. When a plume has two or more such concave regions, the resulting energetic bulges can interact at a later time. The issue of determining plume speeds by tracking these features on sequential images of gravity currents is also dealt with. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Cooper, Arnold L AU - Mied, Richard P AU - Lindemann, Gloria J Y1 - 2001/08// PY - 2001 DA - August 2001 SP - 16 EP - 16,901 PB - American Geophysical Union, Washington, DC VL - 106 IS - C8 SN - 0148-0227, 0148-0227 KW - real aperture radar KW - plumes KW - geophysical methods KW - radar methods KW - surface gravity current KW - surface density outcrop frontal line KW - velocity KW - coastal environment KW - bathymetry KW - estuarine environment KW - accuracy KW - remote sensing KW - 20:Applied geophysics KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50154800?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Evolution+of+free+propagating%2C+two-dimensional+surface+gravity+current+fronts&rft.au=Cooper%2C+Arnold+L%3BMied%2C+Richard+P%3BLindemann%2C+Gloria+J&rft.aulast=Cooper&rft.aufirst=Arnold&rft.date=2001-08-01&rft.volume=106&rft.issue=C8&rft.spage=16&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC000213 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 35 N1 - PubXState - DC N1 - Document feature - illus. incl. geol. sketch map N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - accuracy; bathymetry; coastal environment; estuarine environment; geophysical methods; plumes; radar methods; real aperture radar; remote sensing; surface density outcrop frontal line; surface gravity current; velocity DO - http://dx.doi.org/10.1029/2000JC000213 ER - TY - JOUR T1 - Asian dust events of April 1998 AN - 50152812; 2002-032381 AB - On April 15 and 19, 1998, two intense dust storms were generated over the Gobi desert by springtime low-pressure systems descending from the northwest. The windblown dust was detected and its evolution followed by its yellow color on SeaWiFS satellite images, routine surface-based monitoring, and through serendipitous observations. The April 15 dust cloud was recirculating, and it was removed by a precipitating weather system over east Asia. The April 19 dust cloud crossed the Pacific Ocean in 5 days, subsided to the surface along the mountain ranges between British Columbia and California, and impacted severely the optical and the concentration environments of the region. In east Asia the dust clouds increased the albedo over the cloudless ocean and land by up to 10-20%, but it reduced the near-UV cloud reflectance, causing a yellow coloration of all surfaces. The yellow colored backscattering by the dust eludes a plausible explanation using simple Mie theory with constant refractive index. Over the West Coast the dust layer has increased the spectrally uniform optical depth to about 0.4, reduced the direct solar radiation by 30-40%, doubled the diffuse radiation, and caused a whitish discoloration of the blue sky. On April 29 the average excess surface-level dust aerosol concentration over the valleys of the West Coast was about 20-50 mu g/m (super 3) with local peaks >100 mu g/m (super 3) . The dust mass mean diameter was 2-3 mu m, and the dust chemical fingerprints were evident throughout the West Coast and extended to Minnesota. The April 1998 dust event has impacted the surface aerosol concentration 2-4 times more than any other dust event since 1988. The dust events were observed and interpreted by an ad hoc international web-based virtual community. It would be useful to set up a community-supported web-based infrastructure to monitor the global aerosol pattern for such extreme aerosol events, to alert and to inform the interested communities, and to facilitate collaborative analysis for improved air quality and disaster management. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Husar, R B AU - Tratt, David M AU - Schichtel, B A AU - Falke, S R AU - Li, F AU - Jaffe, D AU - Gasso, S AU - Gill, T AU - Laulainen, N S AU - Lu, F AU - Reheis, M C AU - Chun, Y AU - Westphal, Douglas L AU - Holben, B N AU - Gueymard, C AU - McKendry, I AU - Kuring, N AU - Feldman, G C AU - McClain, C AU - Frouin, R J AU - Merrill, J AU - DuBois, D AU - Vignola, F AU - Murayama, T AU - Nickovic, Slobodan AU - Wilson, W E AU - Sassen, K AU - Sugimoto, N AU - Malm, W C AU - Sokolik, I N AU - Winker, D M AU - Bergametti, G AU - Gillette, Dale A AU - Carmichael, Gregory R AU - Kaufman, Yoram J AU - Gomes, Laurent AU - Schuetz, L AU - Penner, J E Y1 - 2001/08// PY - 2001 DA - August 2001 SP - 18 EP - 18,330 PB - American Geophysical Union, Washington, DC VL - 106 IS - D16 SN - 0148-0227, 0148-0227 KW - dust storms KW - clouds KW - concentration KW - TOMS KW - sediment transport KW - clastic sediments KW - global KW - SeaWiFS KW - British Columbia KW - atmosphere KW - Gobi Desert KW - satellite methods KW - environmental analysis KW - atmospheric circulation KW - Canada KW - dust KW - sediments KW - Western Canada KW - wind transport KW - Asia KW - climate KW - remote sensing KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50152812?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Asian+dust+events+of+April+1998&rft.au=Husar%2C+R+B%3BTratt%2C+David+M%3BSchichtel%2C+B+A%3BFalke%2C+S+R%3BLi%2C+F%3BJaffe%2C+D%3BGasso%2C+S%3BGill%2C+T%3BLaulainen%2C+N+S%3BLu%2C+F%3BReheis%2C+M+C%3BChun%2C+Y%3BWestphal%2C+Douglas+L%3BHolben%2C+B+N%3BGueymard%2C+C%3BMcKendry%2C+I%3BKuring%2C+N%3BFeldman%2C+G+C%3BMcClain%2C+C%3BFrouin%2C+R+J%3BMerrill%2C+J%3BDuBois%2C+D%3BVignola%2C+F%3BMurayama%2C+T%3BNickovic%2C+Slobodan%3BWilson%2C+W+E%3BSassen%2C+K%3BSugimoto%2C+N%3BMalm%2C+W+C%3BSokolik%2C+I+N%3BWinker%2C+D+M%3BBergametti%2C+G%3BGillette%2C+Dale+A%3BCarmichael%2C+Gregory+R%3BKaufman%2C+Yoram+J%3BGomes%2C+Laurent%3BSchuetz%2C+L%3BPenner%2C+J+E&rft.aulast=Husar&rft.aufirst=R&rft.date=2001-08-01&rft.volume=106&rft.issue=D16&rft.spage=18&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JD900788 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 56 N1 - PubXState - DC N1 - Document feature - illus. incl. 2 plates, geol. sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Asia; atmosphere; atmospheric circulation; British Columbia; Canada; clastic sediments; climate; clouds; concentration; dust; dust storms; environmental analysis; global; Gobi Desert; remote sensing; satellite methods; SeaWiFS; sediment transport; sediments; TOMS; Western Canada; wind transport DO - http://dx.doi.org/10.1029/2000JD900788 ER - TY - JOUR T1 - A study of the sensitivity of simulated mineral dust production to model resolution AN - 50150979; 2002-032368 AB - The dependence of dust production on model grid-space resolution is investigated using the Navy's operational mesoscale meteorological model with an imbedded dust emission model. The study covers a 2-week period of strong dust storms in April 1998 in the major dust source area of East Asia. The modeled surface winds at grid resolutions of 20, 40, 60, and 80 km are verified against observational data. At all resolutions the model has a positive bias in wind speed that decreases as resolution increases. Dust fluxes that are proportional to the fourth power of the friction velocity (u (sub *) ) and the third power of the wind speed are calculated at all four resolutions and compared. Compared with the 20-km resolution u (sub *) -driven flux, which is deduced to be the most accurate, the u (sub *) -driven flux on the coarser grids overestimate the flux, with the 80 km being 60% higher for individual events and nearly 20% higher in the total dust production for the entire study period. The wind-driven flux misses the smaller events due to the lack of a dependence on stability and wind shear, when compared with the timing of surface dust observations, and has differences of up to 70%, when compared with the 20-km u (sub *) -driven flux. Averaging over space and time tends to reduce the differences among grids and might support modeling at coarse resolution. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Liu, Ming AU - Westphal, Douglas L AU - Sokolik, I N AU - Winker, D M AU - Bergametti, G AU - Gillette, Dale A AU - Carmichael, Gregory R AU - Kaufman, Yoram J AU - Gomes, Laurent AU - Schuetz, L AU - Penner, J E Y1 - 2001/08// PY - 2001 DA - August 2001 SP - 18 EP - 18,112 PB - American Geophysical Union, Washington, DC VL - 106 IS - D16 SN - 0148-0227, 0148-0227 KW - soils KW - dust storms KW - terrestrial environment KW - erosion KW - clastic sediments KW - arid environment KW - wind erosion KW - simulation KW - environmental analysis KW - models KW - provenance KW - sensitivity analysis KW - dust KW - sediments KW - aerosols KW - soil erosion KW - Asia KW - winds KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50150979?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=A+study+of+the+sensitivity+of+simulated+mineral+dust+production+to+model+resolution&rft.au=Liu%2C+Ming%3BWestphal%2C+Douglas+L%3BSokolik%2C+I+N%3BWinker%2C+D+M%3BBergametti%2C+G%3BGillette%2C+Dale+A%3BCarmichael%2C+Gregory+R%3BKaufman%2C+Yoram+J%3BGomes%2C+Laurent%3BSchuetz%2C+L%3BPenner%2C+J+E&rft.aulast=Liu&rft.aufirst=Ming&rft.date=2001-08-01&rft.volume=106&rft.issue=D16&rft.spage=18&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JD900711 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 26 N1 - PubXState - DC N1 - Document feature - illus. incl. 1 table, geol. sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - aerosols; arid environment; Asia; clastic sediments; dust; dust storms; environmental analysis; erosion; models; provenance; sediments; sensitivity analysis; simulation; soil erosion; soils; terrestrial environment; wind erosion; winds DO - http://dx.doi.org/10.1029/2000JD900711 ER - TY - JOUR T1 - Human Tolerance to Gz Acceleration Loads Generated in High-Performance Helicopters AN - 18140686; 5290578 AB - Background: As the Gz capabilities of tactical helicopters increase, the risk to unprotected helicopter aircrew resulting from the physiologic response to transitions from -1 Gz (push) to +4.5 Gz (pull) loads needs to be addressed. Methods: There were 9 volunteers who participated in a study conducted at the Veridian Operations Centrifuge Facility in Warminster, PA. A 1-h mission scenario consisting of nine helicopter maneuvers, based on inflight G measurements (push-pull mission, PPM), simulated both current (CM: -0.2 to +3.5 Gz) and projected future platform capabilities (FM: -1 Gz to +4.5 Gz). Additional scenarios were run in which push transitions were limited to +1 Gz (GM). Measurements included blood pressure (BP), heart rate (HR), loss of vision, and subjective fatigue. Results: Visual decrements were minimal during CM while muscular tensing was required to avoid blackout during FM. Light loss typically occurred during the transition from -Gz to +Gz. Within the scope of these tests, subjects tolerated the range of Gz stresses associated with current U.S. Navy rotary wing platforms. When subjected to FM G-loads (typical of current U.S. Army high-performance platforms), cardiovascular stress significantly increased, Gz tolerance dropped as much as 1.2 G, and HR increased as much as 67 bpm. Cardiovascular changes were significantly greater during FM PPM relative to GM. Four subjects reported Almost-Loss of Consciousness (A-LOC) symptoms during FM. Conclusions: While G-stress experienced by aircrew generated by current helicopters does not appear to present a high risk, G-awareness training is recommended to reduce risks to aircrew exposed to G-loads generated by more aggressive helicopters. Future studies are required to determine the impact of longer mission times and dehydration. JF - Aviation, Space and Environmental Medicine AU - Shender, B S AD - South Engineering Center/Crew Systems Dept., NAWCAD, BLDG 2187 Suite 2280, 48110 Shaw Road Unit 5, Patuxent River, MD 20670-1906, USA, ShenderBS@navair.navy.mil Y1 - 2001/08// PY - 2001 DA - Aug 2001 SP - 693 EP - 703 VL - 72 IS - 8 SN - 0095-6562, 0095-6562 KW - crew safety KW - gravity KW - helicopters KW - Health & Safety Science Abstracts; Risk Abstracts KW - Physiology KW - Military KW - Occupational exposure KW - R2 23080:Industrial and labor KW - H 1000:Occupational Safety and Health UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18140686?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ariskabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aviation%2C+Space+and+Environmental+Medicine&rft.atitle=Human+Tolerance+to+Gz+Acceleration+Loads+Generated+in+High-Performance+Helicopters&rft.au=Shender%2C+B+S&rft.aulast=Shender&rft.aufirst=B&rft.date=2001-08-01&rft.volume=72&rft.issue=8&rft.spage=693&rft.isbn=&rft.btitle=&rft.title=Aviation%2C+Space+and+Environmental+Medicine&rft.issn=00956562&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Occupational exposure; Military; Physiology ER - TY - JOUR T1 - Detection of Dengue Viral RNA Using a Nucleic Acid Sequence-Based Amplification Assay AN - 17911592; 5152496 AB - Faster techniques are needed for the early diagnosis of dengue fever and dengue hemorrhagic fever during the acute viremic phase of infection. An isothermal nucleic acid sequence-based amplification (NASBA) assay was optimized to amplify viral RNA of all four dengue virus serotypes by a set of universal primers and to type the amplified products by serotype-specific capture probes. The NASBA assay involved the use of silica to extract viral nucleic acid, which was amplified without thermocycling. The amplified product was detected by a probe-hybridization method that utilized electrochemiluminescence. Using normal human plasma spiked with dengue viruses, the NASBA assay had a detection threshold of 1 to 10 PFU/ml. The sensitivity and specificity of the assay were determined by testing 67 dengue virus-positive and 21 dengue virus-negative human serum or plasma samples. The "gold standard" used for comparison and evaluation was the mosquito C6/36 cell culture assay followed by an immunofluorescent assay. Viral infectivity titers in test samples were also determined by a direct plaque assay in Vero cells. The NASBA assay was able to detect dengue viral RNA in the clinical samples at plaque titers below 25 PFU/ml (the detection limit of the plaque assay). Of the 67 samples found positive by the C6/36 assay, 66 were found positive by the NASBA assay, for a sensitivity of 98.5%. The NASBA assay had a specificity of 100% based on the negative test results for the 21 normal human serum or plasma samples. These results indicate that the NASBA assay is a promising assay for the early diagnosis of dengue infections. JF - Journal of Clinical Microbiology AU - Wu, S L AU - Lee, E M AU - Putvatana, R AU - Shurtliff, R N AU - Porter, K R AU - Suharyono, W AU - Watts, D M AU - King, C AU - Murphy, G S AU - Hayes, C G AU - Romano, J W AD - Viral Diseases Department, Code 41, Naval Medical Research Center, 503 Robert Grant Ave., Silver Spring, MD 20910-7500., wus@nmrc.navy.mil Y1 - 2001/08// PY - 2001 DA - Aug 2001 SP - 2794 EP - 2798 VL - 39 IS - 8 SN - 0095-1137, 0095-1137 KW - nucleotide sequence KW - NASBA KW - nucleic acid sequence-based amplification KW - Virology & AIDS Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Dengue virus KW - Vero cells KW - Assays KW - Immunofluorescence KW - Hybridization analysis KW - Silica KW - Dengue KW - Primers KW - Chemiluminescence KW - A 01114:Viruses KW - V 22022:Virus assay UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17911592?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Clinical+Microbiology&rft.atitle=Detection+of+Dengue+Viral+RNA+Using+a+Nucleic+Acid+Sequence-Based+Amplification+Assay&rft.au=Wu%2C+S+L%3BLee%2C+E+M%3BPutvatana%2C+R%3BShurtliff%2C+R+N%3BPorter%2C+K+R%3BSuharyono%2C+W%3BWatts%2C+D+M%3BKing%2C+C%3BMurphy%2C+G+S%3BHayes%2C+C+G%3BRomano%2C+J+W&rft.aulast=Wu&rft.aufirst=S&rft.date=2001-08-01&rft.volume=39&rft.issue=8&rft.spage=2794&rft.isbn=&rft.btitle=&rft.title=Journal+of+Clinical+Microbiology&rft.issn=00951137&rft_id=info:doi/10.1128%2FJCM.39.8.2794-2798.2001 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Dengue virus; Dengue; Silica; Vero cells; Assays; Primers; Hybridization analysis; Chemiluminescence; Immunofluorescence DO - http://dx.doi.org/10.1128/JCM.39.8.2794-2798.2001 ER - TY - JOUR T1 - Simplified Microneutralization Test for Serotyping Adenovirus Isolates AN - 17903016; 5152504 AB - A simplified microneutralization procedure is described that uses an empirically determined virus challenge dose, a single dilution of antiserum, and observation of cytopathic effect to determine the adenovirus serotype. The simplified test has faster turnaround time and was 96% concordant with a confirmatory test using serial dilutions of type-specific sera. This method will find utility in high-volume serotyping work. JF - Journal of Clinical Microbiology AU - Malasig, MD AU - Goswami, PR AU - Crawford-Miksza, L K AU - Schnurr, D P AU - Gray, G C AD - DoD Center for Deployment Health Research, Naval Health Research Center, P.O. Box 85122, San Diego, CA 92186., malasig@nhrc.navy.mil Y1 - 2001/08// PY - 2001 DA - Aug 2001 SP - 2984 EP - 2986 VL - 39 IS - 8 SN - 0095-1137, 0095-1137 KW - Virology & AIDS Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Antisera KW - Adenovirus KW - Serotyping KW - Cytopathology KW - Neutralization KW - A 01114:Viruses KW - V 22010:Virus taxonomy & classification UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17903016?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologya&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Clinical+Microbiology&rft.atitle=Simplified+Microneutralization+Test+for+Serotyping+Adenovirus+Isolates&rft.au=Malasig%2C+MD%3BGoswami%2C+PR%3BCrawford-Miksza%2C+L+K%3BSchnurr%2C+D+P%3BGray%2C+G+C&rft.aulast=Malasig&rft.aufirst=MD&rft.date=2001-08-01&rft.volume=39&rft.issue=8&rft.spage=2984&rft.isbn=&rft.btitle=&rft.title=Journal+of+Clinical+Microbiology&rft.issn=00951137&rft_id=info:doi/10.1128%2FJCM.39.8.2984-2986.2001 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Adenovirus; Serotyping; Antisera; Neutralization; Cytopathology DO - http://dx.doi.org/10.1128/JCM.39.8.2984-2986.2001 ER - TY - JOUR T1 - Opportunities for using Navy marine mammals to explore associations between organochlorine contaminants and unfavorable effects on reproduction AN - 18175736; 5171334 AB - The Department of Defense (DoD) has a unique marine mammal program maintained by the US Navy that includes the largest force of bottlenose dolphins, Tursiops truncatus, worldwide. In recent years, this population of cetaceans that lives in netted open water enclosures in San Diego Bay has been monitored for levels of organochlorine (OC) contaminants in blubber, blood and milk. Data generated from these studies have afforded insight into the fate and possible effects of OC contaminants in marine mammals. We now report preliminary findings on the effects of maternal OC exposure on pregnancy outcome. Blubber OC levels were compared between females whose calves survived beyond 6 months and females whose calves were stillborn or died within 12 days of birth. The mean concentration of capital sigma DDT was more than 3 times as high among dolphins whose calves died as that among dolphins whose calves survived beyond 6 months (P = 0.002). Mean capital sigma PCB was more than 2.5 times higher in females whose calves did not survive (P = 0.076). This population is a logical sentinel for the assessment of environmentally mediated disease. Biological tissues and fluids can be sampled on a regular basis from the dolphins for accumulation of tissue residues, facilitated by conditioned husbandry behaviors. These trained behaviors help preclude possible alterations in health measures resulting from capture stress. Animals' diets can be monitored for contaminant levels. With these data, the expertise and facilities available at the Navy laboratory and in collaboration with other experts in the field, controlled studies can be designed to monitor and assess dietary exposure, measurable immune and neurologic responses and assess reproductive and transgenerational effects of contaminants. Biomarkers can be developed to relate the health of individual animals relative to contaminant exposures. Such investigations of natural exposure and response scenarios are a logical adjunct to traditional laboratory toxicity studies. JF - Science of the Total Environment AU - Reddy, M L AU - Reif, J S AU - Bachand, A AU - Ridgway, SH AD - SAIC Maritime Division, 3990 Old Town Ave. Suite No. 105A San Diego, CA 92110, USA, reddy@spawar.navy.mil Y1 - 2001/07/02/ PY - 2001 DA - 2001 Jul 02 SP - 171 EP - 182 VL - 274 IS - 1-3 SN - 0048-9697, 0048-9697 KW - Bottle-nosed dolphin KW - Mammals KW - blubber KW - marine mammals KW - ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources; Toxicology Abstracts; Pollution Abstracts; Aqualine Abstracts; Water Resources Abstracts KW - Pollution monitoring KW - INE, USA, California, San Diego Bay KW - Organochlorine compounds KW - Tursiops truncatus KW - Chlorides KW - Sexual reproduction KW - Pollutants KW - Animal Physiology KW - Drifters KW - Pollution indicators KW - Chlorinated organic compounds KW - Bioindicators KW - Milk KW - Mammalia KW - Toxicity KW - Sexual Reproduction KW - Chlorinated hydrocarbons KW - Blood KW - Animals (Mammals) (see also Individual names) KW - Bioaccumulation KW - Marine pollution KW - Marine Mammals KW - Water Pollution Effects KW - Body fat KW - Reproduction KW - Organic Compounds KW - Toxicity (see also Lethal limits) KW - Monitoring KW - P 1000:MARINE POLLUTION KW - Q5 08504:Effects on organisms KW - X 24153:Metabolism KW - SW 3030:Effects of pollution KW - AQ 00008:Effects of Pollution KW - Q1 08376:Physiology, biochemistry, biophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18175736?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Science+of+the+Total+Environment&rft.atitle=Opportunities+for+using+Navy+marine+mammals+to+explore+associations+between+organochlorine+contaminants+and+unfavorable+effects+on+reproduction&rft.au=Reddy%2C+M+L%3BReif%2C+J+S%3BBachand%2C+A%3BRidgway%2C+SH&rft.aulast=Reddy&rft.aufirst=M&rft.date=2001-07-02&rft.volume=274&rft.issue=1-3&rft.spage=171&rft.isbn=&rft.btitle=&rft.title=Science+of+the+Total+Environment&rft.issn=00489697&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Thematic Issue: Toxicology and Risk Assessment Approaches. N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Blood; Pollution monitoring; Bioaccumulation; Milk; Sexual reproduction; Chlorinated hydrocarbons; Organochlorine compounds; Marine pollution; Body fat; Reproduction; Bioindicators; Chlorinated organic compounds; Animals (Mammals) (see also Individual names); Pollutants; Monitoring; Toxicity (see also Lethal limits); Pollution indicators; Drifters; Marine Mammals; Water Pollution Effects; Animal Physiology; Chlorides; Toxicity; Organic Compounds; Sexual Reproduction; Tursiops truncatus; Mammalia; INE, USA, California, San Diego Bay ER - TY - JOUR T1 - The Family in John Locke's Political Thought AN - 60626506; 200204167 AB - What might attention to Locke's political thought contribute to contemporary debates about family? I consider the original Lockean understanding of the role of family in civil society as presented in Locke's Two Treatises of Government & Some Thoughts concerning Education. The education recommended to parents in the latter aims at teaching children, within the bounds of their understanding, principles of acquisition & management of property that echo those outlined in the famous fifth chapter of the Second Treatise & that are crucial to the operation of Lockean political society. Attention to these echoes reveals connections between Locke's philosophies of politics & education. Drawing on these connections & on Locke's Letter concerning Toleration, I outline the disposition that a contemporary Lockean might take toward the family & its role in the liberal polity & also the judgment that might be adopted by a Lockean liberal toward traditionalist, egalitarian, & libertarian arguments about the family. Adapted from the source document. JF - Polity AU - Pfeffer, Jacqueline L AD - Saint John's Coll, Annapolis, MD j-pfeffer@sjca.edu Y1 - 2001/07// PY - 2001 DA - July 2001 SP - 593 EP - 618 VL - 33 IS - 4 SN - 0032-3497, 0032-3497 KW - Locke, John KW - Political Socialization KW - Political Philosophy KW - Family KW - Civil Society KW - article KW - 9221: politics and society; politics and society KW - 9003: history and theory; political theories and philosophy UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60626506?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Polity&rft.atitle=The+Family+in+John+Locke%27s+Political+Thought&rft.au=Pfeffer%2C+Jacqueline+L&rft.aulast=Pfeffer&rft.aufirst=Jacqueline&rft.date=2001-07-01&rft.volume=33&rft.issue=4&rft.spage=593&rft.isbn=&rft.btitle=&rft.title=Polity&rft.issn=00323497&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - SubjectsTermNotLitGenreText - Family; Political Philosophy; Locke, John; Civil Society; Political Socialization ER - TY - JOUR T1 - Crustal structure of Ascension Island from wide-angle seismic data; implications for the formation of near-ridge volcanic islands AN - 52202670; 2001-060395 AB - The study of the internal structure of volcanic islands is important for understanding how such islands form and how the lithosphere deforms beneath them. Studies to date have focused on very large volcanic edifices (e.g., Hawaiian Islands, Marquesas), but less attention has been paid to smaller islands, which are more common. Ascension Island, a 4-km high volcanic edifice with a basal diameter of 60 km, is located in the equatorial Atlantic (8 degrees S), 90 km west of the Mid-Atlantic Ridge on 7 Ma oceanic lithosphere. We present results of a wide-angle seismic profile crossing the island revealing a crustal thickness of 12-13 km, an overthickened layer 3 (7 km thick) and little evidence of lithospheric flexure. Together these results suggest Ascension Island may be older than previously assumed and may have begun forming at an on-axis position around 6-7 Ma. This hypothesis is further supported by the presence of a young 1.4-km high edifice directly adjacent to the Mid-Atlantic Ridge with a volume about 1/7 that of Ascension Island, possibly representing the earliest stages of seamount formation. Excess magmatism appears to be related to the tectonic setting at the ridge-fracture zone intersection. JF - Earth and Planetary Science Letters AU - Klingelhoefer, F AU - Minshull, T A AU - Blackman, D K AU - Harben, P AU - Childers, V Y1 - 2001/07// PY - 2001 DA - July 2001 SP - 41 EP - 56 PB - Elsevier, Amsterdam VL - 190 IS - 1-2 SN - 0012-821X, 0012-821X KW - oceanic crust KW - geophysical surveys KW - flexure KW - oceanic lithosphere KW - refraction methods KW - Mid-Atlantic Ridge KW - Ascension Island KW - volcanism KW - thickness KW - ocean floors KW - seismic profiles KW - lithosphere KW - magmatism KW - geophysical methods KW - seismic methods KW - Atlantic Ocean Islands KW - fracture zones KW - velocity structure KW - submarine volcanoes KW - volcanoes KW - surveys KW - islands KW - geophysical profiles KW - hydrophones KW - crust KW - Atlantic Ocean KW - mid-ocean ridges KW - 18:Solid-earth geophysics KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52202670?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Earth+and+Planetary+Science+Letters&rft.atitle=Crustal+structure+of+Ascension+Island+from+wide-angle+seismic+data%3B+implications+for+the+formation+of+near-ridge+volcanic+islands&rft.au=Klingelhoefer%2C+F%3BMinshull%2C+T+A%3BBlackman%2C+D+K%3BHarben%2C+P%3BChilders%2C+V&rft.aulast=Klingelhoefer&rft.aufirst=F&rft.date=2001-07-01&rft.volume=190&rft.issue=1-2&rft.spage=41&rft.isbn=&rft.btitle=&rft.title=Earth+and+Planetary+Science+Letters&rft.issn=0012821X&rft_id=info:doi/10.1016%2FS0012-821X%2801%2900362-4 L2 - http://www.sciencedirect.com/science/journal/0012821X LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2001-01-01 N1 - Number of references - 55 N1 - Document feature - illus. incl. 1 table, sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - EPSLA2 N1 - SubjectsTermNotLitGenreText - Ascension Island; Atlantic Ocean; Atlantic Ocean Islands; crust; flexure; fracture zones; geophysical methods; geophysical profiles; geophysical surveys; hydrophones; islands; lithosphere; magmatism; Mid-Atlantic Ridge; mid-ocean ridges; ocean floors; oceanic crust; oceanic lithosphere; refraction methods; seismic methods; seismic profiles; submarine volcanoes; surveys; thickness; velocity structure; volcanism; volcanoes DO - http://dx.doi.org/10.1016/S0012-821X(01)00362-4 ER - TY - CONF T1 - A Virtual Reality Patient Simulation System for Teaching Emergency Response Skills to U.S. Navy Medical Providers AN - 18367339; 5343662 AB - Rapid and effective medical intervention in response to civil and military-related disasters is crucial for saving lives and limiting long-term disability. Inexperienced providers may suffer in performance when faced with limited supplies and the demands of stabilizing casualities not generally encountered in the comparatively resource-rich hospital setting. Head trauma and multiple injury cases are particularly complex to diagnose and treat, requiring the integration and processing of complex multimodal data. In this project, collaborators adapted and merged existing technologies to produce a flexible, modular patient simulation system with both three-dimensional virtual reality and two-dimensional flat screen user interfaces for teaching cognitive assessment and treatment skills. This experiential, problem-based training approach engages the user in a stress-filled, high fidelity world, providing multiple learning opportunities within a compressed period of time and without risk. The system simulates both the dynamic state of the patient and the results of user intervention, enabling trainees to watch the virtual patient deteriorate or stabilize as a result of their decision-making speed and accuracy. Systems can be deployed to the field enabling trainees to practice repeatedly until their skills are mastered and to maintain those skills once acquired. This paper describes the technologies and the process used to develop the trainers, the clinical algorithms, and the incorporation of teaching points. We also characterize aspects of the actual simulation exercise through the lens of the trainee. JF - Journal of Prehospital and Disaster Medicine AU - Freeman, K M AU - Thompson, S F AU - Allely, E B AU - Sobel, AL AU - Stansfield, SA AU - Pugh, WM Y1 - 2001/07// PY - 2001 DA - Jul 2001 SP - 3 EP - 8 VL - 16 IS - 3 KW - emergency medical services KW - virtual reality KW - Health & Safety Science Abstracts KW - H 6000:Natural Disasters/Civil Defense/Emergency Management UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18367339?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Prehospital+and+Disaster+Medicine&rft.atitle=A+Virtual+Reality+Patient+Simulation+System+for+Teaching+Emergency+Response+Skills+to+U.S.+Navy+Medical+Providers&rft.au=Freeman%2C+K+M%3BThompson%2C+S+F%3BAllely%2C+E+B%3BSobel%2C+AL%3BStansfield%2C+SA%3BPugh%2C+WM&rft.aulast=Freeman&rft.aufirst=K&rft.date=2001-07-01&rft.volume=16&rft.issue=3&rft.spage=3&rft.isbn=&rft.btitle=&rft.title=Journal+of+Prehospital+and+Disaster+Medicine&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 ER - TY - JOUR T1 - Characteristics of laser-induced inelastic-scattering signals from coastal waters AN - 18170976; 5175603 AB - This paper describes laser-induced fluorescence and Raman signal measurements from coastal waters. These measurements collect laser- induced signals as a function of laser wavelengths and water temperatures. For each laser wavelength, the laser energies simultaneously induce dissolved organic material (DOM) fluorescence, alga fluorescence, and Raman signals. For the water samples used, these measurements show that DOM and Raman signal amplitudes are insensitive to water temperatures. However, alga fluorescence signals increases slowly with increases in water temperatures. The wavelength-dependent measurements show that Raman signal amplitudes decrease with increases in excitation laser wavelengths between 490 and 535 nm, the wavelength range used in these measurements. The alga fluorescence signal amplitudes also decrease with increase in excitation laser wavelengths. However, these decreases are insignificant compared to that of Raman signals. Within the excitation laser wavelength range studied, the DOM fluorescence does not show significant spectral structures that depend on laser wavelengths. The measurement results suggest optimum laser wavelengths for studying laser-induced inelastic scattering in coastal waters. These data also suggest that for both active and passive coastal water remote sensing, Raman signals may bias alga fluorescence measurement results depending on relative alga fluorescence and Raman signal intensity. JF - Remote Sensing of Environment AU - Lin, C S AD - Remote Sensing Division, Naval Research Laboratory, Code 7228, 4555 Overlook Avenue SouthWest, Washington, DC 20375, USA Y1 - 2001/07// PY - 2001 DA - July 2001 SP - 104 EP - 111 VL - 77 IS - 1 SN - 0034-4257, 0034-4257 KW - Raman signal intensity KW - Meteorological & Geoastrophysical Abstracts; Aqualine Abstracts; Water Resources Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Remote Sensing KW - Dissolved Solids KW - Water Temperature KW - Instrumentation KW - Determination KW - Seawater fluorescence KW - Coastal Waters KW - Algae (see also Individual groups) KW - Scattering KW - Organic Matter KW - Optical properties of seawater KW - Optical Properties KW - Algae KW - Fluorescence KW - Light transmission by seawater KW - Temperature KW - Water temperature KW - Coastal waters KW - Wavelengths KW - Laser uses in oceanography KW - Dissolved organic matter KW - Lasers KW - Measuring equipment KW - Q2 09185:Organic compounds KW - SW 5040:Data acquisition KW - M2 551.468:Coastal Oceanography (551.468) KW - M2 551.463.5:Radiation and optical properties of sea water (551.463.5) KW - O 1080:Multi-disciplinary Studies KW - AQ 00003:Monitoring and Analysis of Water and Wastes KW - M2 551.460.083:Instruments for measuring physical quantities in sea water (551.460.083) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18170976?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Remote+Sensing+of+Environment&rft.atitle=Characteristics+of+laser-induced+inelastic-scattering+signals+from+coastal+waters&rft.au=Lin%2C+C+S&rft.aulast=Lin&rft.aufirst=C&rft.date=2001-07-01&rft.volume=77&rft.issue=1&rft.spage=104&rft.isbn=&rft.btitle=&rft.title=Remote+Sensing+of+Environment&rft.issn=00344257&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Fluorescence; Dissolved organic matter; Lasers; Water temperature; Coastal waters; Laser uses in oceanography; Seawater fluorescence; Optical properties of seawater; Light transmission by seawater; Algae (see also Individual groups); Scattering; Instrumentation; Determination; Temperature; Measuring equipment; Remote Sensing; Dissolved Solids; Water Temperature; Organic Matter; Coastal Waters; Optical Properties; Algae; Wavelengths ER - TY - JOUR T1 - Nutritional consequences of gastrolith ingestion in blue-winged teal: A test of the hard-seed-for-grit hypothesis AN - 17892569; 5162697 AB - One benefit attributed to retention of mineral grit in avian gizzards is enhanced digestive efficiency, which may be realized through higher metabolizable energy of hard seed diets. The hard-seed-for-grit hypothesis also suggests that hard seeds can substitute for grit in the gizzard as an aid to mechanical digestion. However, neither of these presumed nutritional benefits of gastrolith ingestion have been quantified. We maintained captive blue-winged teal (Anas discors) on 4 experimental dietary supplements (none, grit, milo, and both grit and milo), and conducted true metabolizable energy (TME) feeding trials to demonstrate the nutritional consequences of gastrolith consumption. We measured TME of 3 test diets: millet (Echinochloa crus-galli), milo, and smartweed (Polygonum pensylvanicum). Mean TME did not differ among treatments for any of the test diets, suggesting that pretrial gastrolith ingestion did not appreciably increase metabolizability of these foods. There was little evidence that birds retained either pretrial seed supplements or the experimental diets in the gizzard, suggesting that seed substitution did not occur. Birds frequently regurgitated the test diet. Although we corrected food intake for regurgitated food mass, a significant positive relationship between net intake and TME occurred for smartweed. However, variation in net intake and occurrence of regurgitation did not appear to alter the effects of gastroliths on TME. This study does not provide support for either presumed nutritional benefit of gastrolith ingestion. These results may reflect the lack of energetic constraints on food acquisition in captive birds. A similar study of Canada geese (Branta canadensis) showed a significant effect of grit on TME of some foods, suggesting that digestive responses may vary across a gradient in body size. JF - Journal of Wildlife Management AU - Sherfy, M H AU - Kirkpatrick, R L AU - Webb, KE Jr AD - U.S. Fish and Wildlife Service, Chesapeake Bay Field Office, 177 Admiral Cochrane Drive, Annapolis, MD 21401, USA, mark_sherfy@fws.gov Y1 - 2001/07// PY - 2001 DA - Jul 2001 SP - 406 EP - 414 VL - 65 IS - 3 SN - 0022-541X, 0022-541X KW - grit ingestion KW - Blue-winged teal KW - Ecology Abstracts KW - Diets KW - Wildlife management KW - Anas discors KW - Nutrition KW - D 04700:Management UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17892569?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Wildlife+Management&rft.atitle=Nutritional+consequences+of+gastrolith+ingestion+in+blue-winged+teal%3A+A+test+of+the+hard-seed-for-grit+hypothesis&rft.au=Sherfy%2C+M+H%3BKirkpatrick%2C+R+L%3BWebb%2C+KE+Jr&rft.aulast=Sherfy&rft.aufirst=M&rft.date=2001-07-01&rft.volume=65&rft.issue=3&rft.spage=406&rft.isbn=&rft.btitle=&rft.title=Journal+of+Wildlife+Management&rft.issn=0022541X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Anas discors; Diets; Nutrition; Wildlife management ER - TY - CPAPER T1 - Exposure assessment and the health of deployed forces AN - 39449690; 3608693 AU - Still, K Y1 - 2001/06/22/ PY - 2001 DA - 2001 Jun 22 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 2000:Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39449690?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Exposure+assessment+and+the+health+of+deployed+forces&rft.au=Still%2C+K&rft.aulast=Still&rft.aufirst=K&rft.date=2001-06-22&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Airforce Research Laboratory, 2698 G. Street, Wright-Patterson AFB OH 45433-7604, USA; URL: www.hes.afrl.af.mil N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - GOMaP (Global ocean mapping program): A proposed international long-term project to systematically map the world's ocean floors from beach to trench AN - 39383554; 3609509 AU - Vogt, PR AU - Carron, MJ AU - Jung, W-Y Y1 - 2001/06/22/ PY - 2001 DA - 2001 Jun 22 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39383554?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=GOMaP+%28Global+ocean+mapping+program%29%3A+A+proposed+international+long-term+project+to+systematically+map+the+world%27s+ocean+floors+from+beach+to+trench&rft.au=Vogt%2C+PR%3BCarron%2C+MJ%3BJung%2C+W-Y&rft.aulast=Vogt&rft.aufirst=PR&rft.date=2001-06-22&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Coastal Oceanographics Inc., 11 G-Old Indian Trail, Middlefield, CT 06455, USA; phone: 860-349-3800; fax: 860-349-1982; email: coastalo@coastalo.com; URL: www.coastalo.com N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Utilization of risk assessment in tactical command decisions AN - 39293234; 3608692 AU - Jederberg, W Y1 - 2001/06/22/ PY - 2001 DA - 2001 Jun 22 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 2000:Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39293234?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Utilization+of+risk+assessment+in+tactical+command+decisions&rft.au=Jederberg%2C+W&rft.aulast=Jederberg&rft.aufirst=W&rft.date=2001-06-22&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Airforce Research Laboratory, 2698 G. Street, Wright-Patterson AFB OH 45433-7604, USA; URL: www.hes.afrl.af.mil N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - Acoustically coupled gas bubbles in fluids: time-domain phenomena. AN - 85350478; pmid-11425101 AB - In previous work [C. Feuillade, J. Acoust. Soc. Am. 98, 1178-1190 (1995)] a coupled oscillator formalism was introduced for describing collective resonances, scattering, and superresonances, of multiple gas bubbles in a fluid. Subsequently, time-domain investigations of the impulse response of coupled systems have disclosed the exact conditions which determine whether the ensemble scattering behavior should be described using: either (a), a multiple scattering; or (b), a self-consistent methodology. The determining factor is the Q of the individual scatterers, and their typical spatial separations in the medium. For highly damped or sparse systems, e.g., scattering from loose schools of swimbladder fish, or from a gassy seabed containing entrained bubbles, the multiple scatter counting approach should be applicable. For more strongly coupled systems, e.g., a dense cloud of resonating bubbles in the water column, energy exchange may be due primarily to radiative cycling rather than scattering, in which case a self-consistent approach is indicated. The result has implications for both volume and bottom scattering applications. JF - The Journal of the Acoustical Society of America AU - Feuillade, C AD - Naval Research Laboratory, Stennis Space Center, Mississippi 39529-5004, USA. cf@nrlssc.navy.mil Y1 - 2001/06// PY - 2001 DA - Jun 2001 SP - 2606 EP - 2615 VL - 109 IS - 6 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85350478?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Acoustically+coupled+gas+bubbles+in+fluids%3A+time-domain+phenomena.&rft.au=Feuillade%2C+C&rft.aulast=Feuillade&rft.aufirst=C&rft.date=2001-06-01&rft.volume=109&rft.issue=6&rft.spage=2606&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Pulse propagation in randomly fluctuating media. AN - 85350321; pmid-11425098 AB - Pulse propagation in a weakly and randomly inhomogeneous medium is studied using a time-domain progressive wave equation. An eikonal-like approximated solution to the wave equation derived from the path integral representation is used to obtain the time-dependent statistics of pulses propagating through this random medium. This approach yields both a simple way of producing simulations of time series as well as their statistical properties. JF - The Journal of the Acoustical Society of America AU - Dacol, D K AD - Naval Research Laboratory, Washington, DC 20375-5350, USA. dacol@nrl.navy.mil Y1 - 2001/06// PY - 2001 DA - Jun 2001 SP - 2581 EP - 2586 VL - 109 IS - 6 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85350321?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Pulse+propagation+in+randomly+fluctuating+media.&rft.au=Dacol%2C+D+K&rft.aulast=Dacol&rft.aufirst=D&rft.date=2001-06-01&rft.volume=109&rft.issue=6&rft.spage=2581&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Neurophysiologic effects of chemical agent hydrolysis products on cortical neurons in vitro. AN - 71002656; 11456340 AB - The neurophysiologic effects of chemical agent hydrolysis products were examined on cultured cortical neurons using multielectrode array (MEA) recording and the whole-cell patch clamp technique. Measurement of neuronal network extracellular potentials showed that the primary hydrolysis product of soman, pinacolyl methylphosphonic acid (PMPA), inhibited network mean burst and spike rates with an EC50 of approximately 2 mM. In contrast, the degradation product of sarin, isopropyl methylphosphonic acid (IMPA), and the final common hydrolysis product of both soman and sarin, methylphosphonic acid (MPA), failed to affect neuronal network behavior at concentrations reaching 5 mM. Closer examination of the effects of PMPA (2 mM) on discriminated extracellular units revealed that mean spike amplitude was slightly diminished to 95 +/- 1% (mean +/- S.E.M., n = 6, P < 0.01) of control. Whole-cell patch clamp records under current clamp mode also showed a PMPA-induced depression of the firing rate of spontaneous action potentials (APs) to 36 +/- 6% (n = 5, P < 0.001) of control. In addition, a minor depression with exposure to PMPA was observed in spontaneous and evoked AP amplitude to 93 +/- 3% (n = 5, P < 0.05) of control with no change in either the baseline membrane potential or input resistance. Preliminary voltage clamp recordings indicated a reduction in the occurrence of spontaneous inward currents with application of PMPA. These findings suggest that PMPA, unlike MPA or IMPA, may more readily interfere with one or more aspects of excitatory synaptic transmission. Furthermore, the data demonstrate that the combination of extracellular microelectrode array and patch clamp recording techniques facilitates analysis of compounds with neuropharmacologic effects. JF - Neurotoxicology AU - Pancrazio, J J AU - Keefer, E W AU - Ma, W AU - Stenger, D A AU - Gross, G W AD - Center for Bio/Molecular Science and Engineering, Naval Research Laboratory, Washington, DC 20375, USA. jxp@cbmse.nrl.navy.mil Y1 - 2001/06// PY - 2001 DA - June 2001 SP - 393 EP - 400 VL - 22 IS - 3 SN - 0161-813X, 0161-813X KW - Chemical Warfare Agents KW - 0 KW - Index Medicus KW - Rats KW - Animals KW - Action Potentials -- physiology KW - Patch-Clamp Techniques KW - Nerve Net -- physiology KW - Nerve Net -- drug effects KW - Action Potentials -- drug effects KW - Organ Culture Techniques KW - Hydrolysis KW - Embryo, Mammalian KW - Female KW - Pregnancy KW - Microelectrodes KW - Cerebral Cortex -- cytology KW - Cerebral Cortex -- drug effects KW - Chemical Warfare Agents -- metabolism KW - Neurons -- drug effects KW - Chemical Warfare Agents -- pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71002656?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Neurotoxicology&rft.atitle=Neurophysiologic+effects+of+chemical+agent+hydrolysis+products+on+cortical+neurons+in+vitro.&rft.au=Pancrazio%2C+J+J%3BKeefer%2C+E+W%3BMa%2C+W%3BStenger%2C+D+A%3BGross%2C+G+W&rft.aulast=Pancrazio&rft.aufirst=J&rft.date=2001-06-01&rft.volume=22&rft.issue=3&rft.spage=393&rft.isbn=&rft.btitle=&rft.title=Neurotoxicology&rft.issn=0161813X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-12-04 N1 - Date created - 2001-07-17 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Acupuncture for pilocarpine-resistant xerostomia following radiotherapy for head and neck malignancies. AN - 70872348; 11380221 AB - Xerostomia is a frequent and potentially debilitating toxicity of radiotherapy (XRT) for cancers of the head and neck. This report describes the use of acupuncture as palliation for such patients. Eighteen patients with xerostomia refractory to pilocarpine therapy after XRT for head and neck malignancy were offered acupuncture as palliation. All patients are without evidence of cancer recurrence at the primary site. Acupuncture was provided to three auricular points and one digital point bilaterally, with electrostimulation used variably. The Xerostomia Inventory (XI) was administered retrospectively to provide an objective measure of efficacy. Acupuncture contributed to relief from xerostomia to varying degrees. Palliative effect as measured by the XI varied from nil to robust (pre- minus post- therapy values of over 20 points). Nine patients had benefit of over 10 points on the XI. Acupuncture reduces xerostomia in some patients who are otherwise refractory to best current management. JF - International journal of radiation oncology, biology, physics AU - Johnstone, P A AU - Peng, Y P AU - May, B C AU - Inouye, W S AU - Niemtzow, R C AD - Radiation Oncology Division, Naval Medical Center, San Diego, CA 92134-1014, USA. pajohnstone@nmcsd.med.navy.mil Y1 - 2001/06/01/ PY - 2001 DA - 2001 Jun 01 SP - 353 EP - 357 VL - 50 IS - 2 SN - 0360-3016, 0360-3016 KW - Miotics KW - 0 KW - Pilocarpine KW - 01MI4Q9DI3 KW - Index Medicus KW - Humans KW - Drug Resistance KW - Radiotherapy -- adverse effects KW - Xerostomia -- etiology KW - Radiation Injuries -- drug therapy KW - Acupuncture Therapy KW - Pilocarpine -- therapeutic use KW - Xerostomia -- drug therapy KW - Miotics -- therapeutic use KW - Radiation Injuries -- therapy KW - Head and Neck Neoplasms -- radiotherapy KW - Xerostomia -- therapy KW - Radiation Injuries -- etiology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/70872348?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+journal+of+radiation+oncology%2C+biology%2C+physics&rft.atitle=Acupuncture+for+pilocarpine-resistant+xerostomia+following+radiotherapy+for+head+and+neck+malignancies.&rft.au=Johnstone%2C+P+A%3BPeng%2C+Y+P%3BMay%2C+B+C%3BInouye%2C+W+S%3BNiemtzow%2C+R+C&rft.aulast=Johnstone&rft.aufirst=P&rft.date=2001-06-01&rft.volume=50&rft.issue=2&rft.spage=353&rft.isbn=&rft.btitle=&rft.title=International+journal+of+radiation+oncology%2C+biology%2C+physics&rft.issn=03603016&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-06-07 N1 - Date created - 2001-05-29 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Northern ocean inventories of organochlorine and heavy metal contamination AN - 52137526; 2002-016155 JF - Marine Pollution Bulletin AU - Crane, Kathleen AU - Galasso, Jennifer AU - Brown, Clare AU - Cherkashov, Georgy AU - Ivanov, Gennady AU - Petrova, Vera AU - Vanstain, Boris A2 - Champ, Michael A. A2 - Gomez, Leo S. A2 - Makeyev, Vyachesliav M. A2 - Brooks, James M. A2 - Palmer, Harold D. A2 - Betz, Frederick Y1 - 2001/06// PY - 2001 DA - June 2001 SP - 28 EP - 60 PB - Pergamon, Oxford VL - 43 IS - 1-6 SN - 0025-326X, 0025-326X KW - silicates KW - clay KW - chlorinated hydrocarbons KW - PCBs KW - lead KW - organochlorine pesticides KW - environmental analysis KW - radioactive waste KW - laboratory studies KW - marine sediments KW - geographic information systems KW - transport KW - carbon KW - sediments KW - cadmium KW - halogenated hydrocarbons KW - Arctic Ocean KW - ecology KW - organic carbon KW - heavy metals KW - mercury KW - concentration KW - experimental studies KW - monitoring KW - sulfates KW - clastic sediments KW - pollutants KW - Arctic region KW - arsenic KW - smectite KW - pollution KW - thawing KW - biota KW - clay minerals KW - organic compounds KW - expeditions KW - metals KW - marine environment KW - sheet silicates KW - information systems KW - seasonal variations KW - waste disposal KW - pesticides KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52137526?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Pollution+Bulletin&rft.atitle=Northern+ocean+inventories+of+organochlorine+and+heavy+metal+contamination&rft.au=Crane%2C+Kathleen%3BGalasso%2C+Jennifer%3BBrown%2C+Clare%3BCherkashov%2C+Georgy%3BIvanov%2C+Gennady%3BPetrova%2C+Vera%3BVanstain%2C+Boris&rft.aulast=Crane&rft.aufirst=Kathleen&rft.date=2001-06-01&rft.volume=43&rft.issue=1-6&rft.spage=28&rft.isbn=&rft.btitle=&rft.title=Marine+Pollution+Bulletin&rft.issn=0025326X&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/0025326X LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 206 N1 - Document feature - sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - MPNBAZ N1 - SubjectsTermNotLitGenreText - Arctic Ocean; Arctic region; arsenic; biota; cadmium; carbon; chlorinated hydrocarbons; clastic sediments; clay; clay minerals; concentration; ecology; environmental analysis; expeditions; experimental studies; geographic information systems; halogenated hydrocarbons; heavy metals; information systems; laboratory studies; lead; marine environment; marine sediments; mercury; metals; monitoring; organic carbon; organic compounds; organochlorine pesticides; PCBs; pesticides; pollutants; pollution; radioactive waste; seasonal variations; sediments; sheet silicates; silicates; smectite; sulfates; thawing; transport; waste disposal ER - TY - JOUR T1 - TUMOR PREVALENCE AND BIOMARKERS OF EXPOSURE IN BROWN BULLHEADS (AMEIURUS NEBULOSUS) FROM THE TIDAL POTOMAC RIVER, USA, WATERSHED AN - 20164063; 7290762 AB - Associations between contaminant exposure and liver and skin tumor prevalence were evaluated in brown bullheads (Ameiurus nebulosus) from the tidal Potomac River, USA, watershed. Thirty bullheads [less than or equal to] age 3) were collected from Quantico embayment, near a Superfund site that released organochlorine contaminants; Neabsco Creek, a tributary with petroleum inputs from runoff and marinas; and Anacostia River (spring and fall), an urban tributary designated as a Chesapeake Bay region of concern, that was contaminated with polychlorinated biphenyls (PCBs), polycyclic aromatic hydrocarbons (PAHs), and organochlorine pesticides. Fish were collected from the Tuckahoe River, as a reference. Cytochrome P450 activity, bile PAH metabolites, and muscle organochlorine pesticide and PCB concentrations were measured in randomly selected individuals and sediment contaminants were analyzed. We found statistically significant differences in liver tumor prevalences: Anacostia (spring), 50%; Anacostia (fall), 60%; Neabsco, 17%; Quantico, 7%; and Tuckahoe, 10%. Skin tumor prevalences were significantly different: Anacostia (spring), 37%; Anacostia (fall), 10%; Neabsco, 3%; Quantico, 3%; and Tuckahoe, 0%. Tumor prevalence in Anacostia bullheads warrants concern and was similar to those at highly contaminated sites in the Great Lakes. Evidence was found of higher PAH exposure in Anacostia fish but a cause-effect linkage could not be established. Fish tumor surveys, with histopathologic examination of internal and external organs, are recommended for monitoring the status of regions of concern. JF - Environmental Toxicology and Chemistry AU - Pinkney, Alfred E AU - Harshbarger, John C AU - May, Eric B AU - Melancon, Mark J AD - U.S. Fish and Wildlife Service, Chesapeake Bay Field Office, 177 Admiral Cochrane Drive, Annapolis, Maryland 21401 Y1 - 2001/06// PY - 2001 DA - June 2001 SP - 1196 EP - 1205 PB - Allen Press, Inc., 810 East Tenth St. PO Box 1897 Lawrence KS 66044 USA, [mailto:webmaster@allenpress.com] VL - 20 IS - 6 SN - 0730-7268, 0730-7268 KW - Brown bullhead KW - Aqualine Abstracts; Pollution Abstracts; Toxicology Abstracts; Water Resources Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; ASFA 1: Biological Sciences & Living Resources KW - Tumors KW - Biomarkers KW - Brown bullheads KW - Polynuclear aromatic hydrocarbons KW - Springs KW - Watersheds KW - petroleum hydrocarbons KW - Toxicity tests KW - Lakes KW - Exposure KW - Petroleum KW - Bullhead KW - Aromatic hydrocarbons KW - Pollution indicators KW - PCB KW - USA, Washington D.C., Anacostia R. KW - Rivers KW - Muscles KW - ANW, USA, Chesapeake Bay KW - Cytochrome KW - polychlorinated biphenyls KW - Organic Compounds KW - Cytochrome P450 KW - Contaminants KW - Tumours KW - Runoff KW - Pollution monitoring KW - USA, Potomac R. KW - Organochlorine compounds KW - Polychlorinated Biphenyls KW - Statistical analysis KW - Metabolites KW - Pollutants KW - USA, Maryland, Potomac R. KW - Water springs KW - PCB compounds KW - Sediment pollution KW - Polycyclic aromatic hydrocarbons KW - Skin KW - Chlorine compounds KW - Pesticides (organochlorine) KW - biomarkers KW - Sediments KW - Ameiurus nebulosus KW - USA KW - Bile KW - North America, Great Lakes KW - Pesticides KW - Liver KW - P 9000:ENVIRONMENTAL ACTION KW - SW 3030:Effects of pollution KW - Q5 08502:Methods and instruments KW - Q1 08485:Species interactions: pests and control KW - AQ 00003:Monitoring and Analysis of Water and Wastes KW - X 24330:Agrochemicals UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/20164063?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Toxicology+and+Chemistry&rft.atitle=TUMOR+PREVALENCE+AND+BIOMARKERS+OF+EXPOSURE+IN+BROWN+BULLHEADS+%28AMEIURUS+NEBULOSUS%29+FROM+THE+TIDAL+POTOMAC+RIVER%2C+USA%2C+WATERSHED&rft.au=Pinkney%2C+Alfred+E%3BHarshbarger%2C+John+C%3BMay%2C+Eric+B%3BMelancon%2C+Mark+J&rft.aulast=Pinkney&rft.aufirst=Alfred&rft.date=2001-06-01&rft.volume=20&rft.issue=6&rft.spage=1196&rft.isbn=&rft.btitle=&rft.title=Environmental+Toxicology+and+Chemistry&rft.issn=07307268&rft_id=info:doi/10.1897%2F1551-5028%282001%290202.0.CO%3B2 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-05-27 N1 - SubjectsTermNotLitGenreText - Sediment pollution; Chlorine compounds; Pesticides; Aromatic hydrocarbons; Watersheds; Pollution indicators; Toxicity tests; Tumours; PCB; Rivers; Polycyclic aromatic hydrocarbons; Organochlorine compounds; Skin; Muscles; Statistical analysis; Pesticides (organochlorine); Metabolites; Tumors; biomarkers; Sediments; polychlorinated biphenyls; Bile; Petroleum; Liver; Cytochrome P450; Contaminants; Runoff; Pollution monitoring; Lakes; Cytochrome; Water springs; petroleum hydrocarbons; PCB compounds; Springs; Pollutants; Exposure; Polychlorinated Biphenyls; Bullhead; Organic Compounds; Ameiurus nebulosus; USA; USA, Potomac R.; USA, Maryland, Potomac R.; North America, Great Lakes; ANW, USA, Chesapeake Bay; USA, Washington D.C., Anacostia R. DO - http://dx.doi.org/10.1897/1551-5028(2001)020<1196:TPABOE>2.0.CO;2 ER - TY - JOUR T1 - Identification of target genes responsive to JP-8 exposure in the rat central nervous system AN - 18660933; 5562022 AB - Concern for the health risk associated with occupational exposure to jet fuel has emerged in the Department of Defense. Jet propulsion fuel-8 (JP-8) is the fuel used in most US and North Atlantic Treaty Organization (NATO) jet aircraft, and will be the predominant fuel both for military land vehicles and aircraft into the twenty-first century. JP-8 exhibits reduced volatility and lower benzene content as compared to JP-4, the predominant military aircraft fuel before 1992, possibly suggesting greater occupational exposure safety. However, the higher rates of occupational exposure through fueling and maintenance of increasingly larger numbers of aircraft/vehicles raise concerns with respect to toxicity. Clinical studies of workers experiencing long-term exposure to certain jet fuels demonstrated deficits in CNS function, including fatigue, neurobehavioral changes, psychiatric disorders, and abnormal electroencephalogram (EEG). In the present study, cDNA nylon arrays (Atlas Rat 1.2 Array, Clontech Laboratories, Palo Alto, CA) were utilized to measure changes in gene expression in whole brain tissue of rats exposed repeatedly to JP-8, under conditions that simulated possible real-world occupational exposure (6 h/day for 91 days) to JP-8 vapor at 1000 mg/m super(3). Gene expression analysis of the exposure group compared to the control group revealed a modulation of several genes, including glutathione S-transferase Yb2 subunit (GST Yb2); cytochrome P450 IIIA1 (CYP3A1); glucose-dependent insulinotropic peptide (GIP); alpha 1-proteinase inhibitor ( alpha 1-AT); polyubiquitin; GABA transporter 3 (GAT-3); and plasma membrane Ca super(2+)-transporting ATPase (brain isoform 2) (PMCA2). The implications of these vapor-induced changes in gene expression are discussed. JF - Toxicology and Industrial Health AU - Lin, B AU - Ritchie, G D AU - Rossi, J III AU - Pancrazio, J J AD - Center for Bio/Molecular Science & Engineering, Code 6900, Naval Research Laboratory, Washington, DC 20375, USA, jxp@cbmse.nrl.navy.mil Y1 - 2001/06// PY - 2001 DA - Jun 2001 SP - 262 EP - 269 VL - 17 IS - 5-10 SN - 0748-2337, 0748-2337 KW - JP-8 jet fuel KW - rats KW - Toxicology Abstracts KW - X 24155:Biochemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18660933?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Toxicology+and+Industrial+Health&rft.atitle=Identification+of+target+genes+responsive+to+JP-8+exposure+in+the+rat+central+nervous+system&rft.au=Lin%2C+B%3BRitchie%2C+G+D%3BRossi%2C+J+III%3BPancrazio%2C+J+J&rft.aulast=Lin&rft.aufirst=B&rft.date=2001-06-01&rft.volume=17&rft.issue=5-10&rft.spage=262&rft.isbn=&rft.btitle=&rft.title=Toxicology+and+Industrial+Health&rft.issn=07482337&rft_id=info:doi/10.1191%2F0748233701th117oa LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 DO - http://dx.doi.org/10.1191/0748233701th117oa ER - TY - JOUR T1 - The Reduced Oxygen Breathing Paradigm for Hypoxia Training: Physiological, Cognitive, and Subjective Effects AN - 18144798; 5147895 AB - The current training program for hypoxia familiarization requires a low pressure chamber that places aviator trainees at risk for decompression sickness. A cost-effective reduced oxygen-breathing (ROB) paradigm that decreases oxygen (O sub(2)) concentration leading to normobaric hypoxia was assessed as an alternative to the hypobaric chamber. To help establish the validity of the ROB paradigm, this report documents cognitive performance, cardiopulmonary and subjective changes during ROB exposure. Performance on a two-dimensional tracking task, as well as BP, heart rate, end-tidal carbon dioxide (ETCO sub(2)), O sub(2) saturation, and subjective reports of hypoxia symptoms were observed in 12 U.S. Navy divers during exposure to normoxic air followed by one of four experimental gas mixtures per session. All participants received all gas conditions that differed in their relative concentrations of O sub(2) and nitrogen (6.20/93.80, 7.00/93.00, 7.85/92.15, and 20.85/79.15% O sub(2)/N sub(2)). ROB caused increases in tracking task error (p < 0.0001). ROB also increased heart rate (p < 0.001) and systotic BP (p = 0.004), and decreased ETCO sub(2) and O sub(2) saturation (p < 0.0001). Finally, subjects responded to ROB-induced hypoxia with higher subjective symptom ratings (p < 0.0001). These data are consistent with those expected from hypoxic states and support the validity of the ROB paradigm for hypoxia training. Future validation studies comparing a ROB device with hypobaric chambers are needed. JF - Aviation, Space and Environmental Medicine AU - Sausen, K P AU - Wallick, M T AU - Slobodnik, B AU - Chimiak, J M AU - Bower, E A AU - Stiney, ME AU - Clark, J B AD - Naval Aerospace Medical Research Laboratory, 51 Hovey Road, Pensacola, FL 32508-1046, USA, kmayer@namrl.navy.mil Y1 - 2001/06// PY - 2001 DA - Jun 2001 SP - 539 EP - 545 VL - 72 IS - 6 SN - 0095-6562, 0095-6562 KW - Physical Education Index KW - Oxygen consumption (exercise effects) KW - Pulmonary ventilation KW - Respiration KW - Hypoxia KW - Heart rate KW - Training (programs) KW - Military KW - Cognition KW - Cardiac function KW - PE 090:Sports Medicine & Exercise Sport Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18144798?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aphysicaleducation&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aviation%2C+Space+and+Environmental+Medicine&rft.atitle=The+Reduced+Oxygen+Breathing+Paradigm+for+Hypoxia+Training%3A+Physiological%2C+Cognitive%2C+and+Subjective+Effects&rft.au=Sausen%2C+K+P%3BWallick%2C+M+T%3BSlobodnik%2C+B%3BChimiak%2C+J+M%3BBower%2C+E+A%3BStiney%2C+ME%3BClark%2C+J+B&rft.aulast=Sausen&rft.aufirst=K&rft.date=2001-06-01&rft.volume=72&rft.issue=6&rft.spage=539&rft.isbn=&rft.btitle=&rft.title=Aviation%2C+Space+and+Environmental+Medicine&rft.issn=00956562&rft_id=info:doi/ LA - English DB - Physical Education Index N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Hypoxia; Training (programs); Oxygen consumption (exercise effects); Respiration; Heart rate; Pulmonary ventilation; Cardiac function; Military; Cognition ER - TY - JOUR T1 - Chesapeake Bay outflow plume and coastal upwelling events: Physical and optical properties AN - 18080254; 5161496 AB - One of a series of Chesapeake Outflow Plume Experiments, COPE-2, was conducted in May 1997 along the coast of Virginia/North Carolina. The objective of this experiment was to describe the coastal buoyancy jet formed by the outflow of water from Chesapeake Bay, its dispersion into midshelf, and the optical property changes that accompany these events. Wind forcing scales of 3-5 days were responsible for formation of the jet (downwelling favorable winds) and its dispersion (upwelling favorable winds). During downwelling favorable events the jet established itself along the coast with speeds exceeding 0.5 m s super(-1), slowing and becoming more stable as it progressed. Downwelling circulation helped maintain the jet against the coast, and variations in wind strength produced wavelike variations in jet width. During upwelling favorable events, water from the jet was dispersed into midshelf in a thin near-surface layer. Optical surrogates for dissolved organic matter (DOM), chlorophyll, and suspended particles were formed using data from a pumped optical absorption/attenuation meter (ac-9). High loads of these materials were associated with the buoyancy jet and were subsequently dispersed into midshelf during upwelling events. During mature upwelling states, nearshore increases in chlorophyll and suspended particles mimicked the plume load, although relatively low levels of DOM made it separable from plume water by analysis of the optical signature. Upwelling relaxation fronts in these optical conditions could be seen. JF - Journal of Geophysical Research. C. Oceans AU - Johnson AU - Weidemann, A AU - Arnone, R AU - Davis, C O AD - Naval Research Laboratory, Stennis Space Center, Mississippi, USA Y1 - 2001/06// PY - 2001 DA - Jun 2001 SP - 11613 EP - 11622 VL - 106 IS - C6 SN - 0148-0227, 0148-0227 KW - USA, Chesapeake Bay KW - Water Resources Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Coastal jets KW - Marine KW - Coastal upwelling KW - Upwelling KW - Coastal Waters KW - Optical properties KW - ANW, USA, Chesapeake Bay KW - Hydrography KW - River Mouth KW - Optical Properties KW - Plumes KW - Bays KW - O 2010:Physical Oceanography KW - SW 0835:Streamflow and runoff KW - Q2 09146:TSD distribution, water masses and circulation UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18080254?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research.+C.+Oceans&rft.atitle=Chesapeake+Bay+outflow+plume+and+coastal+upwelling+events%3A+Physical+and+optical+properties&rft.au=Johnson%3BWeidemann%2C+A%3BArnone%2C+R%3BDavis%2C+C+O&rft.aulast=Johnson&rft.aufirst=&rft.date=2001-06-01&rft.volume=106&rft.issue=C6&rft.spage=11613&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research.+C.+Oceans&rft.issn=01480227&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-06 N1 - SubjectsTermNotLitGenreText - Coastal jets; Coastal upwelling; Hydrography; Optical properties; Plumes; Upwelling; Coastal Waters; River Mouth; Optical Properties; Bays; ANW, USA, Chesapeake Bay; Marine ER - TY - JOUR T1 - Increased sensitivity to seizures in repeated exposures to hyperbaric oxygen: role of NOS activation. AN - 70813797; 11334802 AB - Nitric oxide is involved in the mechanism of hyperbaric oxygen (HBO(2)) brain toxicity as nitric oxide synthase (NOS) inhibitors delay latent time before the onset of seizures. The purpose of this study was to investigate if seizures affect sensitivity to convulsions during subsequent exposure to HBO(2) and to determine if NOS activity and expression is changed after HBO(2) seizures. Rats were exposed to 5 atm (gauge pressure) 100% O(2) until seizures recorded by electroencephalograph (EEG) and reexposed 1, 2, or 6 days later. Latency to seizures was significantly shorter (P<0.05) in animals reexposed 1 or 2 days after the first exposure. Activity of calcium-dependent NOS activity in cortex was significantly higher 1 and 2 days after seizures compared with controls (P<0.05), while calcium-independent NOS activity was not changed during the 6-day post-seizure interval. The expression of neuronal NOS (nNOS) protein determined by Western blot was higher 1 and 2 days after seizures (P<0.05), while the expression of endothelial (eNOS) and inducible (iNOS) remained unchanged. nNOS upregulation 1 and 2 days after seizures and protection against HBO(2) seizures by nNOS-specific inhibitor 7-nitroindazole (7-NI) suggest possible involvement of NO in the mechanism of increased sensitivity to HBO(2) in reexposures. JF - Brain research AU - Chavko, M AU - Xing, G AU - Keyser, D O AD - Environmental Physiology Department, Naval Medical Research Center, 503 Robert Grant Avenue, Silver Spring, MD 20910, USA. chavkom@nmrc.navy.mil Y1 - 2001/05/11/ PY - 2001 DA - 2001 May 11 SP - 227 EP - 233 VL - 900 IS - 2 SN - 0006-8993, 0006-8993 KW - Enzyme Inhibitors KW - 0 KW - Indazoles KW - Nitric Oxide Synthase KW - EC 1.14.13.39 KW - Nitric Oxide Synthase Type I KW - Nos1 protein, rat KW - Calcium KW - SY7Q814VUP KW - 7-nitroindazole KW - UX0N37CMVH KW - Index Medicus KW - Animals KW - Reference Values KW - Cerebral Cortex -- enzymology KW - Electroencephalography KW - Indazoles -- pharmacology KW - Enzyme Activation -- physiology KW - Reaction Time -- physiology KW - Rats KW - Rats, Sprague-Dawley KW - Calcium -- physiology KW - Enzyme Inhibitors -- pharmacology KW - Time Factors KW - Male KW - Seizures -- enzymology KW - Hyperbaric Oxygenation KW - Seizures -- diagnosis KW - Nitric Oxide Synthase -- antagonists & inhibitors KW - Seizures -- etiology KW - Seizures -- prevention & control KW - Nitric Oxide Synthase -- metabolism UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/70813797?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Brain+research&rft.atitle=Increased+sensitivity+to+seizures+in+repeated+exposures+to+hyperbaric+oxygen%3A+role+of+NOS+activation.&rft.au=Chavko%2C+M%3BXing%2C+G%3BKeyser%2C+D+O&rft.aulast=Chavko&rft.aufirst=M&rft.date=2001-05-11&rft.volume=900&rft.issue=2&rft.spage=227&rft.isbn=&rft.btitle=&rft.title=Brain+research&rft.issn=00068993&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-09-06 N1 - Date created - 2001-05-03 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Explosives detection in soil using a field-portable continuous flow immunosensor AN - 18077504; 5119958 AB - A field method for quantitative analysis of explosives in contaminated soil samples is described. The method is based on a displacement immunoassay performed in a commercial instrument, the FAST 2000, engineered by Research International Inc. The method can be used on-site to measure 2,4,6-trinitrotoluene (TNT) and hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) within 5 min. For this study, replicate analyses were performed on soil extracts prepared from each field sample as well as appropriate controls, blanks, and laboratory standards. Statistical analyses were done to assess accuracy, bias, and predictability of the method. The results demonstrated that the immunosensor could be used effectively to screen environmental samples for the presence or absence of explosives. In most samples, the method also provided quantitative values that were in good agreement with standard laboratory analyses using HPLC. A limited number of sample matrices interfered with the immunoassay and produced results that varied significantly from the laboratory data. In each case, the compounds causing the problem have been identified and efforts are being made to minimize these matrix interferences in future field evaluations. JF - Journal of Hazardous Materials AU - Gauger, PR AU - Holt, D B AU - Patterson, CH Jr AU - Charles, P T AU - Shriver-Lake, L AU - Kusterbeck, A W AD - The Center for Bio/Molecular Science and Engineering, Naval Research Laboratory, Code 6900, Washington, DC 20375-5348, USA, awk@cbmse.navy.nrl.mil Y1 - 2001/05/07/ PY - 2001 DA - 2001 May 07 SP - 51 EP - 63 VL - 83 IS - 1-2 SN - 0304-3894, 0304-3894 KW - 2,4,6-trinitrotoluene KW - hexahydro-1,3,5-trinitro-1,3,5-triazine KW - Pollution Abstracts KW - Pollution detection KW - Sensors KW - Instruments KW - Soil contamination KW - Hazardous materials KW - Explosives KW - Immunoassays KW - P 5000:LAND POLLUTION UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18077504?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Apollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Hazardous+Materials&rft.atitle=Explosives+detection+in+soil+using+a+field-portable+continuous+flow+immunosensor&rft.au=Gauger%2C+PR%3BHolt%2C+D+B%3BPatterson%2C+CH+Jr%3BCharles%2C+P+T%3BShriver-Lake%2C+L%3BKusterbeck%2C+A+W&rft.aulast=Gauger&rft.aufirst=PR&rft.date=2001-05-07&rft.volume=83&rft.issue=1-2&rft.spage=51&rft.isbn=&rft.btitle=&rft.title=Journal+of+Hazardous+Materials&rft.issn=03043894&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Explosives; Soil contamination; Pollution detection; Immunoassays; Instruments; Sensors; Hazardous materials ER - TY - CPAPER T1 - Submerged aquatic vegetation restoration targeting system AN - 39364820; 3597792 AU - Parham, T AU - Karrh, L Y1 - 2001/05/03/ PY - 2001 DA - 2001 May 03 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39364820?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Submerged+aquatic+vegetation+restoration+targeting+system&rft.au=Parham%2C+T%3BKarrh%2C+L&rft.aulast=Parham&rft.aufirst=T&rft.date=2001-05-03&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: NOAA Coastal Services Center, 2234 South Hobson Avenue, Charleston, SC 29405-2413, USA; phone: 843-740-1200; fax: 843-740-1224; email: GeoTools@noaa.gov; URL: www.csc.noaa.gov N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - The design, fabrication, and measured acoustic performance of a 1-3 piezoelectric composite Navy calibration standard transducer. AN - 85354772; pmid-11386551 AB - The design, fabrication, and acoustic calibration of a new 1-3 piezoelectric composite-based U.S. Navy standard (USRD-F82) are presented. The F82 dual array/parametric mode projector may be used as a reciprocal linear transducer, or may be used to exploit the nonlinear properties of the water to produce highly directional acoustic beams (4 to 3 deg) at relatively low frequencies (5 to 50 kHz, respectively). As a result of its wide bandwidth, a broad range of primary as well as secondary frequencies of operation is possible. In the linear mode of operation the transducer provides two separate arrays to be addressed topside for either transmit or receive applications. The two circular apertures are centered on the acoustic axis and have active diameters of 22.8 cm (9 in.) and 5.1 cm (2 in.). The smaller array aperture could be used to obtain broader acoustic beams at relatively high frequencies. Due to the absence of air-filled pressure release components, the transducer will operate over most ocean pressures and temperatures. A general description of the 1-3 piezoelectric composite-based transducer configuration and measured performance is presented. JF - The Journal of the Acoustical Society of America AU - Benjamin, K C AU - Petrie, S AD - Naval Undersea Warfare Center Division Newport, Rhode Island 02841, USA. benjaminkc@npt.nuwc.navy.mil Y1 - 2001/05// PY - 2001 DA - May 2001 SP - 1973 EP - 1978 VL - 109 IS - 5 Pt 1 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85354772?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=The+design%2C+fabrication%2C+and+measured+acoustic+performance+of+a+1-3+piezoelectric+composite+Navy+calibration+standard+transducer.&rft.au=Benjamin%2C+K+C%3BPetrie%2C+S&rft.aulast=Benjamin&rft.aufirst=K&rft.date=2001-05-01&rft.volume=109&rft.issue=5+Pt+1&rft.spage=1973&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Wakefield generation and GeV acceleration in tapered plasma channels. AN - 85269013; pmid-11415017 AB - To achieve multi-GeV electron energies in the laser wakefield accelerator (LWFA), it is necessary to propagate an intense laser pulse long distances in a plasma without disruption. One of the purposes of this paper is to evaluate the stability properties of intense laser pulses propagating extended distances (many tens of Rayleigh ranges) in plasma channels. A three-dimensional envelope equation for the laser field is derived that includes nonparaxial effects such as group velocity dispersion, as well as wakefield and relativistic nonlinearities. It is shown that in the broad beam, short pulse limit the nonlinear terms in the wave equation that lead to Raman and modulation instabilities cancel. This cancellation can result in pulse propagation over extended distances, limited only by dispersion. Since relativistic focusing is not effective for short pulses, the plasma channel provides the guiding necessary for long distance propagation. Long pulses (greater than several plasma wavelengths), on the other hand, experience substantial modification due to Raman and modulation instabilities. For both short and long pulses the seed for instability growth is inherently determined by the pulse shape and not by background noise. These results would indicate that the self-modulated LWFA is not the optimal configuration for achieving high energies. The standard LWFA, although having smaller accelerating fields, can provide acceleration for longer distances. It is shown that by increasing the plasma density as a function of distance, the phase velocity of the accelerating field behind the laser pulse can be made equal to the speed of light. Thus electron dephasing in the accelerating wakefield can be avoided and energy gain increased by spatially tapering the plasma channel. Depending on the tapering gradient, this luminous wakefield phase velocity is obtained several plasma wavelengths behind the laser pulse. Simulations of laser pulses propagating in a tapered plasma channel are presented. Experimental techniques for generating a tapered density in a capillary discharge are described and an example of a GeV channel guided standard LWFA is presented. JF - Physical Review E: Statistical, Nonlinear, and Soft Matter Physics AU - Sprangle, P AU - Hafizi, B AU - Peñano J R AU - Hubbard, R F AU - Ting, A AU - Moore, C I AU - Gordon, D F AU - Zigler, A AU - Kaganovich, D AU - Antonsen, T M AD - Plasma Physics Division, Naval Research Laboratory, Washington, DC 20375. Y1 - 2001/05// PY - 2001 DA - May 2001 VL - 63 IS - 5 Pt 2 SN - 1539-3755, 1539-3755 UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85269013?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Physical+Review+E%3A+Statistical%2C+Nonlinear%2C+and+Soft+Matter+Physics&rft.atitle=Wakefield+generation+and+GeV+acceleration+in+tapered+plasma+channels.&rft.au=Sprangle%2C+P%3BHafizi%2C+B%3BPe%C3%B1ano+J+R%3BHubbard%2C+R+F%3BTing%2C+A%3BMoore%2C+C+I%3BGordon%2C+D+F%3BZigler%2C+A%3BKaganovich%2C+D%3BAntonsen%2C+T+M&rft.aulast=Sprangle&rft.aufirst=P&rft.date=2001-05-01&rft.volume=63&rft.issue=5+Pt+2&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Physical+Review+E%3A+Statistical%2C+Nonlinear%2C+and+Soft+Matter+Physics&rft.issn=15393755&rft_id=info:doi/ LA - eng DB - ComDisDome N1 - Last updated - 2010-05-07 ER - TY - JOUR T1 - New gravity data in the Arctic Ocean; comparison of airborne and ERS gravity AN - 50158859; 2001-068411 AB - New gravity fields from airborne gravimetry and from ERS-I and -2 satellite altimetry cover extensive portions of the Arctic Ocean. These two data sets may constitute as much as 60% of the data contributions to the Arctic Gravity Project compilation. Here we evaluate the accuracy and resolution of these data and quantify their impact on the compilation. Both gravity determinations compare favorably with Geological Survey of Canada surface measurements in the Beaufort Sea (airborne, 1.86-2.09 mGal rms; ERS, 2.64-3.11 mGal rms). Comparisons between the airborne and ERS data over the Chukchi Borderlands reveal a 4.38 mGal rms difference over the smoother region of the field and 7.36 mGal rms over the rugose field generated by the shallow ridges and deep troughs. Coherency between the two data sets in the Chukchi region implies a resolution of 19 km. Comparison with Science Ice Expedition submarine measurements over Chukchi Plateau suggests that the ERS field resolves even shorter-wavelength signal than the airborne data, whereas in the Beaufort Sea the airborne data showed better coherence to ground truth data. Long-wavelength differences exist between the two data sets, expressed as a 2-3 mGal offset over the Chukchi region. This study highlights the respective strengths of the two data sets. The ERS gravity field has the advantage of ubiquitous coverage of the ocean south of 81.5 degrees N, a denser sampling of the gravity field, and a recovery of signal down to approximately 15 km. The airborne data cover a significant portion of the polar hole in the satellite coverage, have lower measurement noise, and recover somewhat higher anomaly amplitudes in the 25-100 km wavelength range. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Childers, Vicki A AU - McAdoo, David C AU - Brozena, John M AU - Laxon, Seymour W Y1 - 2001/05// PY - 2001 DA - May 2001 SP - 8871 EP - 8886 PB - American Geophysical Union, Washington, DC VL - 106 IS - B5 SN - 0148-0227, 0148-0227 KW - geophysical surveys KW - geophysical methods KW - ice cover KW - satellite methods KW - noise KW - measurement KW - gravity methods KW - Chukchi Sea KW - plate tectonics KW - glacial environment KW - surveys KW - ERS KW - Arctic Ocean KW - Arctic Gravity Project KW - Beaufort Sea KW - accuracy KW - remote sensing KW - airborne methods KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50158859?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=New+gravity+data+in+the+Arctic+Ocean%3B+comparison+of+airborne+and+ERS+gravity&rft.au=Childers%2C+Vicki+A%3BMcAdoo%2C+David+C%3BBrozena%2C+John+M%3BLaxon%2C+Seymour+W&rft.aulast=Childers&rft.aufirst=Vicki&rft.date=2001-05-01&rft.volume=106&rft.issue=B5&rft.spage=8871&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JB900405 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2001-01-01 N1 - Number of references - 38 N1 - PubXState - DC N1 - Document feature - illus. incl. 2 plates, 3 tables, geol. sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - accuracy; airborne methods; Arctic Gravity Project; Arctic Ocean; Beaufort Sea; Chukchi Sea; ERS; geophysical methods; geophysical surveys; glacial environment; gravity methods; ice cover; measurement; noise; plate tectonics; remote sensing; satellite methods; surveys DO - http://dx.doi.org/10.1029/2000JB900405 ER - TY - JOUR T1 - A phase-variable capsule is involved in virulence of Campylobacter jejuni 81-176 AN - 18247779; 5308423 AB - Campylobacter jejuni strain 81-176 (HS36, 23) synthesizes two distinct glycan structures, as visualized by immunoblotting of proteinase K-digested whole-cell preparations. A site-specific insertional mutant in the kpsM gene results in loss of expression of a high-molecular-weight (HMW) glycan (apparent M sub(r) 26 kDa to > 85 kDa) and increased resolution of a second ladder-like glycan (apparent M sub(r) 26-50 kDa). The kpsM mutant of 81-176 is no longer typeable in either HS23 or HS36 antisera, indicating that the HMW glycan structure is the serodeterminant of HS23 and HS36. Both the kpsM-dependent HMW glycan and the kpsM-independent ladder-like structure appear to be capsular in nature, as both are attached to phospholipid rather than lipid A. Additionally, the 81-176 kpsM gene can complement a deletion in Escherichia coli kpsM, allowing the expression of an alpha 2,8 polysialic acid capsule in E. coli. Loss of the HMW glycan in 81-176 kpsM also increases the surface hydrophobicity and serum sensitivity of the bacterium. The kpsM mutant is also significantly reduced in invasion of INT407 cells and reduced in virulence in a ferret diarrhoeal disease model. The expression of the kpsM-dependent capsule undergoes phase variation at a high frequency. JF - Molecular Microbiology AU - Bacon, D J AU - Szymanski, C M AU - Burr, D H AU - Silver, R P AU - Alm, R A AU - Guerry, P AD - Enteric Diseases Department, Naval Medical Research Center, 503 Robert Grant Avenue, Silver Spring, MD 20910, USA., guerryp@nmrc.navy.mil Y1 - 2001/05// PY - 2001 DA - May 2001 SP - 769 EP - 777 PB - Blackwell Science Ltd VL - 40 IS - 3 SN - 0950-382X, 0950-382X KW - kpsM gene KW - Genetics Abstracts; Microbiology Abstracts B: Bacteriology KW - Virulence KW - Campylobacter jejuni KW - Escherichia coli KW - G 07320:Bacterial genetics KW - J 02740:Genetics and evolution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18247779?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Molecular+Microbiology&rft.atitle=A+phase-variable+capsule+is+involved+in+virulence+of+Campylobacter+jejuni+81-176&rft.au=Bacon%2C+D+J%3BSzymanski%2C+C+M%3BBurr%2C+D+H%3BSilver%2C+R+P%3BAlm%2C+R+A%3BGuerry%2C+P&rft.aulast=Bacon&rft.aufirst=D&rft.date=2001-05-01&rft.volume=40&rft.issue=3&rft.spage=769&rft.isbn=&rft.btitle=&rft.title=Molecular+Microbiology&rft.issn=0950382X&rft_id=info:doi/10.1046%2Fj.1365-2958.2001.02431.x LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Campylobacter jejuni; Escherichia coli; Virulence DO - http://dx.doi.org/10.1046/j.1365-2958.2001.02431.x ER - TY - JOUR T1 - Bioirrigation modeling in experimental benthic mesocosms AN - 18205302; 5275197 AB - Burrow irrigation by benthic infauna affects chemical mass transfer regimes in marine and estuarine sediments. The bioirrigation facilitates rapid exchange of solutes between oxygenated overlying water and anoxic pore water, and thus promotes biogeochemical reactions that include degradation of sedimentary organic matter and reoxidation of reduced species. A comprehensive understanding of chemical mass transfer processes in aquatic sediments thus requires a proper treatment of bioirrigation. We investigated bioirrigation processes during early diagenesis using laboratory benthic mesocosms. Bioirrigation was carried out in the mesocosms by Schizocardium sp., a funnel-feeding enteropneust hemichordate that builds and ventilates a U-shaped burrow. Interpretation of the laboratory results was aided by a two-dimensional multicomponent model for transport and reactions that explicitly accounts for the depth-dependent distribution of burrows as well as the chemical mass transfers in the immediate vicinity of burrow walls. Our study shows that bioirrigation significantly affects the spatial distributions of pore water solutes. Moreover, bioirrigation promotes burrow walls to be the site of steep geochemical gradients and rapid chemical mass transfer. Our results also indicate that the exchange function, alpha , widely used in one-dimensional bioirrigation modeling, can accurately describe the bioirrigation regimes if its depth attenuation is coupled to the depth-dependent distribution of burrows. In addition, this study shows that the multicomponent 2D reaction-transport model is a useful research tool that can be used to critically evaluate common biogeochemical assumptions such as the prescribed depth dependencies of organic matter degradation rate and C/N ratio, as well as the lack of macrofaunal contribution of metabolites to the pore water. JF - Journal of Marine Research AU - Furukawa, Yoko AU - Bentley, S J AU - Lavoie, D L AD - Naval Research Laboratory, Seafloor Sciences Branch, Stennis Space Center, MS 39529, USA, yoko.furukawa@nrlssc.navy.mil Y1 - 2001/05// PY - 2001 DA - May 2001 SP - 417 EP - 452 VL - 59 IS - 3 SN - 0022-2402, 0022-2402 KW - burrows KW - ASFA 1: Biological Sciences & Living Resources; Water Resources Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Experimental Data KW - Sediment chemistry KW - Marine Environment KW - Estuarine Environment KW - Biogeochemistry KW - Biogeochemical cycle KW - Mass Transfer KW - Benthic Fauna KW - Dissolved oxygen KW - Model Studies KW - Burrowing organisms KW - Marine Sediments KW - Schizocardium KW - Animal Behavior KW - Zoobenthos KW - Sediment-water exchanges KW - Q1 08462:Benthos KW - SW 0880:Chemical processes KW - Q2 09187:Geochemistry of sediments KW - O 1030:Invertebrates UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18205302?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Marine+Research&rft.atitle=Bioirrigation+modeling+in+experimental+benthic+mesocosms&rft.au=Furukawa%2C+Yoko%3BBentley%2C+S+J%3BLavoie%2C+D+L&rft.aulast=Furukawa&rft.aufirst=Yoko&rft.date=2001-05-01&rft.volume=59&rft.issue=3&rft.spage=417&rft.isbn=&rft.btitle=&rft.title=Journal+of+Marine+Research&rft.issn=00222402&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Burrowing organisms; Sediment chemistry; Biogeochemical cycle; Zoobenthos; Sediment-water exchanges; Dissolved oxygen; Experimental Data; Marine Environment; Marine Sediments; Estuarine Environment; Biogeochemistry; Mass Transfer; Animal Behavior; Benthic Fauna; Model Studies; Schizocardium ER - TY - JOUR T1 - Developing jellyfish strategy hypotheses using circulation models AN - 18178775; 5181817 AB - Little information exists relating life histories of jellyfish species to ocean currents. Successful cycling from sessile polyp to mature jellyfish and back must doubtlessly rely on circulation patterns that serve to retain the species in an optimum environment or disperse the species for other adaptive advantages. In this study, current vectors from a high resolution numerical model of the Gulf of Mexico are applied to a simple advection scheme to develop estimates of time and distance scales from probable polyp habitats to areas in which mature scyphomedusae are observed in the northern Gulf of Mexico. Although seasonal patterns of wind stress form the basis for circulation processes that favour shoreward distribution of medusae of oceanic origin, this dynamic may be altered by deep basin events that occur during critical life history stages. Inter-annual differences in distributional patterns of the sea nettle, Chrysaora quinquecirrha (Desor 1848), in Mississippi coastal waters could be explained by Loop Current processes that alter shelf circulation in the Mississippi Bight. JF - Hydrobiologia AU - Johnson AU - Perry, H M AU - Burke, W D AD - Naval Research Laboratory, Oceanography Division, Stennis Space Center, MS 39529, U.S.A., djohnson@drj.nrlssc.navy.mil Y1 - 2001/05// PY - 2001 DA - May 2001 SP - 213 EP - 221 PB - Kluwer Academic Publishers VL - 451 IS - 1-3 SN - 0018-8158, 0018-8158 KW - Cnidarians KW - Coelenterates KW - Cup animals KW - Jellyfishes KW - Mexico Gulf KW - Sea nettle KW - Oceanic Abstracts; Water Resources Abstracts; ASFA 1: Biological Sciences & Living Resources; Ecology Abstracts KW - Scyphozoa KW - Geographical distribution KW - Spatial distribution KW - Life cycle KW - Spatial Distribution KW - Biological drift KW - Models KW - Water circulation KW - Marine KW - Annual variations KW - Zooplankton KW - Ocean circulation KW - Chrysaora quinquecirrha KW - Model Studies KW - ASW, Mexico Gulf KW - Life History Studies KW - Life history KW - ASW, USA, Mississippi KW - Jelly Fish KW - Water Circulation KW - Cnidaria KW - Life Cycles KW - Shelf dynamics KW - O 1070:Ecology/Community Studies KW - SW 0810:General KW - D 04655:Invertebrates - general KW - D 04003:Modeling, mathematics, computer applications KW - Q1 08242:Geographical distribution KW - O 1030:Invertebrates UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18178775?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aecology&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Hydrobiologia&rft.atitle=Developing+jellyfish+strategy+hypotheses+using+circulation+models&rft.au=Johnson%3BPerry%2C+H+M%3BBurke%2C+W+D&rft.aulast=Johnson&rft.aufirst=&rft.date=2001-05-01&rft.volume=451&rft.issue=1-3&rft.spage=213&rft.isbn=&rft.btitle=&rft.title=Hydrobiologia&rft.issn=00188158&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Geographical distribution; Life history; Annual variations; Zooplankton; Ocean circulation; Life cycle; Biological drift; Shelf dynamics; Spatial distribution; Water circulation; Models; Life History Studies; Jelly Fish; Water Circulation; Spatial Distribution; Life Cycles; Model Studies; Scyphozoa; Cnidaria; Chrysaora quinquecirrha; ASW, Mexico Gulf; ASW, USA, Mississippi; Marine ER - TY - JOUR T1 - Induction of Systemic Antifimbria and Antitoxin Antibody Responses in Egyptian Children and Adults by an Oral, Killed Enterotoxigenic Escherichia coli plus Cholera Toxin B Subunit Vaccine AN - 17840490; 4875095 AB - We assessed serologic responses to an oral, killed whole-cell enterotoxigenic Escherichia coli plus cholera toxin B-subunit (ETEC-rCTB) vaccine in 73 Egyptian adults, 105 schoolchildren, and 93 preschool children. Each subject received two doses of vaccine or placebo 2 weeks apart, giving blood before immunization and 7 days after each dose. Plasma antibodies to rCTB and four vaccine-shared colonization factors (CFs) were measured by enzyme-linked immunosorbent assay. Immunoglobulin A (IgA) antibodies to rCTB and CFA/I were measured in all subjects, and those against CS1, CS2, and CS4 were measured in all children plus a subset of 33 adults. IgG antibodies to these five antigens were measured in a subset of 30 to 33 subjects in each cohort. Seroconversion was defined as a >2-fold increase in titer after vaccination. IgA and IgG seroconversion to rCTB was observed in 94 to 95% of adult vaccinees, with titer increases as robust as those previously reported for these two pediatric cohorts. The proportion showing IgA seroconversion to each CF antigen among vaccinated children (range, 70 to 96%) and adults (31 to 69%), as well as IgG seroconversion in children (44 to 75%) and adults (25 to 81%), was significantly higher than the corresponding proportion in placebo recipients, except for IgA responses to CS2 in adults. IgA anti-CF titers peaked after one dose in children, whereas in all age groups IgG antibodies rose incrementally after each dose. Independently, both preimmunization IgA titer and age were inversely related to the magnitude of IgA responses. In conclusion, serologic responses to the ETEC-rCTB vaccine may serve as practical immune outcome measures in future pediatric trials in areas where ETEC is endemic. JF - Infection and Immunity AU - Hall, E R AU - Wierzba, T F AU - Aahren, C AU - Rao, M R AU - Bassily, S AU - Francis, W AU - Girgis, F Y AU - Safwat, M AU - Lee, Y J AU - Svennerholm, A AU - Clemens, J D AU - Savarino, S J AD - Enteric Diseases Department, Naval Medical Research Center, 503 Robert Grant Ave., Silver Spring, MD 20910, savarinos@nmrc.navy.mil Y1 - 2001/05// PY - 2001 DA - May 2001 SP - 2853 EP - 2857 VL - 69 IS - 5 SN - 0019-9567, 0019-9567 KW - man KW - Egypt KW - Escherichia coli KW - colonization factor KW - colonization factors KW - Biotechnology and Bioengineering Abstracts; Medical and Pharmaceutical Biotechnology Abstracts; Immunology Abstracts; Microbiology Abstracts B: Bacteriology KW - Antibody response KW - Children KW - Toxins KW - Immunization KW - Immunoglobulin A KW - Pili KW - Cholera toxin KW - Immunoglobulin G KW - Cholera KW - Vaccines KW - J 02834:Vaccination and immunization KW - W3 33365:Vaccines (other) KW - F 06807:Active immunization KW - W 30965:Miscellaneous, Reviews UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17840490?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Infection+and+Immunity&rft.atitle=Induction+of+Systemic+Antifimbria+and+Antitoxin+Antibody+Responses+in+Egyptian+Children+and+Adults+by+an+Oral%2C+Killed+Enterotoxigenic+Escherichia+coli+plus+Cholera+Toxin+B+Subunit+Vaccine&rft.au=Hall%2C+E+R%3BWierzba%2C+T+F%3BAahren%2C+C%3BRao%2C+M+R%3BBassily%2C+S%3BFrancis%2C+W%3BGirgis%2C+F+Y%3BSafwat%2C+M%3BLee%2C+Y+J%3BSvennerholm%2C+A%3BClemens%2C+J+D%3BSavarino%2C+S+J&rft.aulast=Hall&rft.aufirst=E&rft.date=2001-05-01&rft.volume=69&rft.issue=5&rft.spage=2853&rft.isbn=&rft.btitle=&rft.title=Infection+and+Immunity&rft.issn=00199567&rft_id=info:doi/10.1128%2FIAI.69.5.2853-2857.2001 LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Vaccines; Cholera toxin; Immunoglobulin A; Immunoglobulin G; Immunization; Pili; Toxins; Cholera; Children; Antibody response DO - http://dx.doi.org/10.1128/IAI.69.5.2853-2857.2001 ER - TY - JOUR T1 - Assessment of dolphin (Tursiops truncatus) auditory sensitivity and hearing loss using jawphones. AN - 85345739; pmid-11325139 AB - Devices known as jawphones have previously been used to measure interaural time and intensity discrimination in dolphins. This study introduces their use for measuring hearing sensitivity in dolphins. Auditory thresholds were measured behaviorally against natural background noise for two bottlenose dolphins (Tursiops truncatus); a 14-year-old female and a 33-year-old male. Stimuli were delivered to each ear independently by placing jawphones directly over the pan bone of the dolphin's lower jaw, the assumed site of best reception. The shape of the female dolphin's auditory functions, including comparison measurements made in the free field, favorably matches that of the accepted standard audiogram for the species. Thresholds previously measured for the male dolphin at 26 years of age indicated a sensitivity difference between the ears of 2-3 dB between 4-10 kHz, which was considered unremarkable at the time. Thresholds for the male dolphin reported in this study suggest a high-frequency loss compared to the standard audiogram. Both of the male's ears have lost sensitivity to frequencies above 55 kHz and the right ear is 16-33 dB less sensitive than the left ear over the 10-40 kHz range, suggesting that males of the species may lose sensitivity as a function of age. The results of this study support the use of jawphones for the measurement of dolphin auditory sensitivity. JF - The Journal of the Acoustical Society of America AU - Brill, R L AU - Moore, P W AU - Dankiewicz, L A AD - Biosciences Division, SPAWAR Systems Center San Diego, California 92152-6506, USA. brill@spawar.navy.mil Y1 - 2001/04// PY - 2001 DA - Apr 2001 SP - 1717 EP - 1722 VL - 109 IS - 4 SN - 0001-4966, 0001-4966 KW - Index Medicus KW - National Library of Medicine KW - Animals KW - Audiometry: methods KW - *Auditory Perception: physiology KW - *Dolphins: physiology KW - Female KW - *Hearing Aids KW - *Hearing Disorders: diagnosis KW - *Jaw KW - Male KW - Noise KW - Sensitivity and Specificity UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85345739?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Assessment+of+dolphin+%28Tursiops+truncatus%29+auditory+sensitivity+and+hearing+loss+using+jawphones.&rft.au=Brill%2C+R+L%3BMoore%2C+P+W%3BDankiewicz%2C+L+A&rft.aulast=Brill&rft.aufirst=R&rft.date=2001-04-01&rft.volume=109&rft.issue=4&rft.spage=1717&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Cold War Science in Black and White: US Intelligence Gathering and Its Scientific Cover at the Naval Research Laboratory, 1948-62 AN - 60580230; 200117337 AB - In the immediate post-WWII era, researchers with the US Naval Research Laboratory's Radio Counter Measures (RCM) Branch was active in developing electronic intelligence ("elint") technologies & techniques for collecting information on the Soviet Union & its allies. The work of the Branch was often hidden behind unclassified research & engineering programs at the Laboratory. The first result of this effort was "Project PAMOR" (PAssive MOon Relay), which built radio antennae for capturing Soviet radar signals reflected from the moon's surface. Starting in 1954, RCM engineers established a working relationship with the Laboratory's Radio Astronomy Branch. The cooperation was directed toward the development of a 600-ft radio telescope for dual-purpose use in intelligence gathering & astronomical research. Although the 600-ft telescope was never built, a satellite-based alternative, called "GRAB" (Galactic RAdiation Background), was launched in June 1960. Again, this was a dual-use system. The world's first elint satellite & astronomical observatory were integrated into the same satellite bus, with astronomy serving as an operational front for the whole. A second GRAB was launched in 1962. This interface of classified & basic research tells us about the pursuit of science & science-based technologies during the Cold War. 4 Figures. Adapted from the source document. JF - Social Studies of Science AU - van Keuren, David K AD - Naval Research Laboratory, Washington, DC dvk@ccs.nrl.navy.mil Y1 - 2001/04// PY - 2001 DA - April 2001 SP - 207 EP - 229 VL - 31 IS - 2 SN - 0306-3127, 0306-3127 KW - Espionage KW - Intelligence KW - Secrecy KW - Scientific Research KW - Laboratories KW - Cold War KW - National Security KW - Armed Forces KW - article KW - 9091: government/political systems; armed forces UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60580230?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Social+Studies+of+Science&rft.atitle=Cold+War+Science+in+Black+and+White%3A+US+Intelligence+Gathering+and+Its+Scientific+Cover+at+the+Naval+Research+Laboratory%2C+1948-62&rft.au=van+Keuren%2C+David+K&rft.aulast=van+Keuren&rft.aufirst=David&rft.date=2001-04-01&rft.volume=31&rft.issue=2&rft.spage=207&rft.isbn=&rft.btitle=&rft.title=Social+Studies+of+Science&rft.issn=03063127&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - SSTSD2 N1 - SubjectsTermNotLitGenreText - Scientific Research; Armed Forces; Espionage; National Security; Cold War; Secrecy; Laboratories; Intelligence ER - TY - JOUR T1 - Influences of diurnal and intraseasonal forcing on mixed-layer and biological variability in the central Arabian Sea AN - 50159305; 2002-001310 AB - A three-dimensional, physical-biological model of the Indian Ocean is used to study the influences of diurnal and intraseasonal forcing on mixed-layer and biological variability in the central Arabian Sea, where a mooring was deployed and maintained from October 1994 to October 1995 by the Woods Hole Oceanographic Institution Upper Ocean Processes group. The physical model consists of four active layers overlying an inert deep ocean, namely, a surface mixed layer of thickness h (sub 1) , diurnal thermocline layer, seasonal thermocline, and main thermocline. The biological model consists of a set of advective-diffiisive equations in each layer that determine nitrogen concentrations in four compartments: nutrients, phytoplankton, zooplankton, and detritus. Both monthly climatological and "daily" fields are used to force solutions, the latter being a blend of daily-averaged fields measured at the mooring site and other products that include intraseasonal forcing. Diurnal forcing is included by allowing the incoming solar radiation to have a daily cycle. In solutions forced by climatological fields, h (sub 1) thickens steadily throughout both monsoons. When h (sub 1) detrains at their ends, short-lived, intense blooms develop (the model's spring and fall blooms) owing to the increase in depth-averaged light intensity sensed by the phytoplankton in layer 1. In solutions forced by daily fields, h (sub 1) thins in a series of events associated with monsoon break periods. As a result, the spring and fall blooms are split into a series of detrainment blooms, broadening them considerably. Diurnal forcing alters the mixed-layer and biological responses, among other things, by lengthening the time that h (sub 1) is thick during the northeast monsoon, by strengthening the spring and fall blooms and delaying them by 3 weeks, and by intensifying phytoplankton levels during intermonsoon periods. Solutions are compared with the mixed-layer thickness, phytoplankton biomass, and phytoplankton production fields estimated from mooring observations. The solution driven by daily fields with diurnal forcing reproduces the observed fields most faithfully. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - McCreary, Julian P, Jr AU - Kohler, Kevin E AU - Hood, Raleigh R AU - Smith, Sharon AU - Kindle, John AU - Fischer, Albert S AU - Weller, Robert A Y1 - 2001/04// PY - 2001 DA - April 2001 SP - 7139 EP - 7155 PB - American Geophysical Union, Washington, DC VL - 106 IS - C4 SN - 0148-0227, 0148-0227 KW - currents KW - sea water KW - phytoplankton KW - three-dimensional models KW - biological models KW - salinity KW - plankton KW - environmental analysis KW - ocean currents KW - Arabian Sea KW - temperature KW - nutrients KW - physical properties KW - monsoons KW - Indian Ocean KW - mixing KW - climate effects KW - seasonal variations KW - diurnal variations KW - productivity KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50159305?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Influences+of+diurnal+and+intraseasonal+forcing+on+mixed-layer+and+biological+variability+in+the+central+Arabian+Sea&rft.au=McCreary%2C+Julian+P%2C+Jr%3BKohler%2C+Kevin+E%3BHood%2C+Raleigh+R%3BSmith%2C+Sharon%3BKindle%2C+John%3BFischer%2C+Albert+S%3BWeller%2C+Robert+A&rft.aulast=McCreary&rft.aufirst=Julian&rft.date=2001-04-01&rft.volume=106&rft.issue=C4&rft.spage=7139&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC900156 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 29 N1 - PubXState - DC N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Arabian Sea; biological models; climate effects; currents; diurnal variations; environmental analysis; Indian Ocean; mixing; monsoons; nutrients; ocean currents; physical properties; phytoplankton; plankton; productivity; salinity; sea water; seasonal variations; temperature; three-dimensional models DO - http://dx.doi.org/10.1029/2000JC900156 ER - TY - JOUR T1 - Surface-to-subsurface velocity projection for shallow water currents AN - 50155119; 2002-001298 AB - Sea surface currents in coastal oceans are accessible to continuous direct observations by shore-based high-frequency Doppler radar systems. Inferring current structure in shallow water from such surface current observations is attempted. The approach assumes frictionally dominated flow and vertically varying current velocity on the scale of the Ekman boundary layer. The approximation of the velocity variation with depth is consequently derivable in terms of orthogonal basis functions from the sea surface kinematic and dynamic boundary conditions; specifically, the viscous momentum and shear equations evaluated at the sea surface. The inference procedure developed is demonstrated with sea surface data obtained in the coastal High-Resolution Remote Sensing Experiment on the continental shelf off Cape Hatteras. Despite uncertainties in the surface measurements, qualitative agreement is obtained between the inferred subsurface current and the current measured in situ. The sensitivity of the inference to the measurement uncertainties as well as to the model assumptions is investigated, and the inferred result is found to be generally robust. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Shen, Colin Y AU - Evans, Thomas E Y1 - 2001/04// PY - 2001 DA - April 2001 SP - 6973 EP - 6984 PB - American Geophysical Union, Washington, DC VL - 106 IS - C4 SN - 0148-0227, 0148-0227 KW - United States KW - currents KW - high-resolution methods KW - ocean circulation KW - Cape Hatteras KW - geophysical methods KW - radar methods KW - Dare County North Carolina KW - ocean currents KW - Doppler radar KW - North Carolina KW - velocity KW - coastal environment KW - three-dimensional current field KW - instruments KW - remote sensing KW - 20:Applied geophysics KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50155119?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Surface-to-subsurface+velocity+projection+for+shallow+water+currents&rft.au=Shen%2C+Colin+Y%3BEvans%2C+Thomas+E&rft.aulast=Shen&rft.aufirst=Colin&rft.date=2001-04-01&rft.volume=106&rft.issue=C4&rft.spage=6973&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F2000JC000267 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 17 N1 - PubXState - DC N1 - Document feature - illus. incl. 3 tables, geol. sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Cape Hatteras; coastal environment; currents; Dare County North Carolina; Doppler radar; geophysical methods; high-resolution methods; instruments; North Carolina; ocean circulation; ocean currents; radar methods; remote sensing; three-dimensional current field; United States; velocity DO - http://dx.doi.org/10.1029/2000JC000267 ER - TY - JOUR T1 - Supercritical Flow Interaction within the Cape Blanco-Cape Mendocino Orographic Complex AN - 18340676; 5241610 AB - Supercritical flow interaction occurring in the marine boundary layer between closely spaced coastal capes is investigated with a mesoscale numerical prediction model. As an extension of previous work, the U.S. Navy's Coupled Ocean/Atmosphere Mesoscale Prediction System (COAMPS) is used to perform idealized model simulations with marine layers of varying upstream Froude number to elucidate the different flow responses for a single convex bend. The impact upon the supercritical flow of introducing a series of closely spaced coastal bends is then investigated. The expansion fan is significantly reduced in magnitude and size by the formation of a compression wave at a blocking, concave bend approximately 150 km downstream. Building upon the idealized marine layer response, real-data forecasts are then examined for several time periods of supercritical flow interaction between Cape Blanco, Oregon, and Cape Mendocino, California. Observations from the Coastal Waves 1996 (CW96) field program were collected in the vicinity of these capes on several days during June-July of 1996. Aircraft measurements on three CW96 flights provide model validation and show ample evidence of supercritical phenomena, while buoy data along the Oregon and California coastline indicate substantial diurnal variability in the marine environment. GOES-9 satellite imagery reveals preferred regions of clearing in the coastal stratus deck downwind of convex coastal bends, which is consistent with supercritical expansion fan dynamics. Real-data COAMPS forecasts of summertime marine layer flow between these major capes indicate that the supercritical flow features, and their degree of interaction, vary diurnally. Diurnal oscillations in the upstream Froude number and flow direction driven by the sea-land-breeze circulation enhance or diminish the expansion fan in the lee of Cape Blanco, thereby altering the flow conditions encountering the concave turn at Cape Mendocino. In a manner similar to that produced in the idealized simulations, a compression jump forms due to the impact of highly supercritical flow within the Cape Blanco expansion fan upon the Cape Mendocino terrain. The compression wave becomes detached and propagates northward during the afternoon in response to a reduction in upstream Froude number. This propagating compression wave occurred in all three days of the study. The findings presented here demonstrate that supercritical flow responses about several closely spaced coastal bends cannot be analyzed independently. JF - Monthly Weather Review AU - Haack, T AU - Burk, S D AU - Dorman, C AU - Rogers, D AD - Marine Meteorology Division, Naval Research Laboratory, Monterey, CA, USA Y1 - 2001/04// PY - 2001 DA - Apr 2001 SP - 688 EP - 708 VL - 129 IS - 4 SN - 0027-0644, 0027-0644 KW - USA, California, Mendocino Cape KW - USA, Oregon, Blanco Cape KW - compression wave KW - ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts; Meteorological & Geoastrophysical Abstracts KW - Marine KW - Winds KW - Boundary Layers KW - Atmospheric circulation KW - Air flow over land KW - Topographic effects KW - Diurnal Distribution KW - Coastal waters KW - Model Studies KW - INE, USA, Oregon, Cape Blanco KW - Sea breezes KW - Flow Characteristics KW - INE, USA, California, Cape Mendocino KW - Marine atmospheric boundary layer flow KW - Coastal morphology KW - Froude number KW - Atmospheric boundary layer KW - Froude Number KW - Air Circulation KW - Sea Breezes KW - Coasts KW - Data Collections KW - Q2 09243:Structure, mechanics and thermodynamics KW - M2 551.55:Wind (551.55) KW - SW 0810:General KW - M2 551.510.522:Surface and planetary boundary layer (PBL) (551.510.522) UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18340676?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Monthly+Weather+Review&rft.atitle=Supercritical+Flow+Interaction+within+the+Cape+Blanco-Cape+Mendocino+Orographic+Complex&rft.au=Haack%2C+T%3BBurk%2C+S+D%3BDorman%2C+C%3BRogers%2C+D&rft.aulast=Haack&rft.aufirst=T&rft.date=2001-04-01&rft.volume=129&rft.issue=4&rft.spage=688&rft.isbn=&rft.btitle=&rft.title=Monthly+Weather+Review&rft.issn=00270644&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Sea breezes; Winds; Coastal morphology; Air flow over land; Atmospheric circulation; Atmospheric boundary layer; Topographic effects; Froude number; Coastal waters; Marine atmospheric boundary layer flow; Flow Characteristics; Boundary Layers; Diurnal Distribution; Froude Number; Air Circulation; Sea Breezes; Data Collections; Model Studies; Coasts; INE, USA, Oregon, Cape Blanco; INE, USA, California, Cape Mendocino; Marine ER - TY - JOUR T1 - Characterization of Monoclonal Antibodies with Specificity for the Core Oligosaccharide of Shigella Lipopolysaccharide AN - 18073904; 5133862 AB - Monoclonal antibodies (MAbs) were prepared against different strains of Shigella, following immunization of BALB/c mice with a heat-killed preparation of Shigella. Antibody-producing hybridomas were screened in an indirect enzyme-linked immunoadsorbent assay (ELISA) and epitope specificity determined using chemically defined lipopolysaccharide, lipid, and KDO fragments. Five MAbs were characterized and the following specificities identified: 2C32E6 and 4D64B9 (reactive to S. flexneri and S. boydii), 5E45D8 (reactive with S. flexneri), 4B33D10 and 1B52F10 (all species of Shigella). The properties of 1B52F10 revealed its potential importance in immunological detection of Shigella from unknown samples, as it was able to bind to all strains of Shigella. JF - Hybridoma AU - Rahman AU - Stimson, W H AD - Department of Immunology, University of Strathclyde, 31 Taylor Street, Glasgow G4 ONR, UK, w.h.stimson@strath.ac.uk Y1 - 2001/04// PY - 2001 DA - Apr 2001 SP - 85 EP - 90 VL - 20 IS - 2 SN - 0272-457X, 0272-457X KW - BALB/c mice KW - Shigella boydii KW - Shigella flexneri KW - lipopolysaccharides KW - oligosaccharides KW - Biotechnology and Bioengineering Abstracts; Medical and Pharmaceutical Biotechnology Abstracts; Immunology Abstracts KW - Hybridoma KW - Enzyme-linked immunosorbent assay KW - Monoclonal antibodies KW - W3 33375:Antibodies KW - F 06711:Monoclonal antibodies, hybridomas, antigens and antisera KW - W 30965:Miscellaneous, Reviews UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18073904?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Hybridoma&rft.atitle=Characterization+of+Monoclonal+Antibodies+with+Specificity+for+the+Core+Oligosaccharide+of+Shigella+Lipopolysaccharide&rft.au=Rahman%3BStimson%2C+W+H&rft.aulast=Rahman&rft.aufirst=&rft.date=2001-04-01&rft.volume=20&rft.issue=2&rft.spage=85&rft.isbn=&rft.btitle=&rft.title=Hybridoma&rft.issn=0272457X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Shigella flexneri; Shigella boydii; Enzyme-linked immunosorbent assay; Monoclonal antibodies; Hybridoma ER - TY - JOUR T1 - Improvement of parabolic nonlinear dispersive wave model AN - 18071515; 4876167 AB - Improvements to a previously published nonlinear parabolic wave model are developed and implemented. A second-order correction to a free-surface boundary condition used to develop the original model is formulated. The correction takes into account the complete second-order transformation between amplitudes of the velocity potential and those of the free-surface elevation. Additionally, wide-angle propagation terms are included in the model. It is shown that the model with the second-order correction retains the properties of third-order Stokes theory quite well in deep water. Comparisons of model behavior to data reveal that both nonlinearity and wide-angle propagation effects need to be included in the model for general wave transformation problems in shallow water. Skewness predictions are considerably improved by using both the second-order correction and by retaining a greater number of frequency components in the calculation. Asymmetry calculations are aided by incorporation of frequency-squared weighting for distribution of the dissipation function. Further improvement may entail a different form of the breaking model. JF - Journal of Waterway, Port, Coastal and Ocean Engineering AU - Kaihatu, J M AD - Oceanographer, Oc. Dyn. and Prediction Branch, Oceanography Div., Code 7322, Naval Res. Lab., Stennis Space Center, MS 39529-5004, USA, kaihatu@nrlssc.navy.mil Y1 - 2001/04// PY - 2001 DA - Apr 2001 SP - 113 EP - 122 VL - 127 IS - 2 SN - 0733-950X, 0733-950X KW - Water Resources Abstracts; Aqualine Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Hydraulics KW - Hydraulic models KW - Deep Water KW - Wave dispersion KW - Shallow Water KW - Boundary conditions KW - Deep water KW - Wave Propagation KW - Viscosity KW - Waves KW - Wave velocity KW - Boundary Conditions KW - Waves (Water) KW - Wave propagation KW - Model Studies KW - Wave Height KW - Stokes Law KW - Wave Velocity KW - Shallow water KW - Wave breaking KW - Wave height KW - Analytical techniques KW - AQ 00001:Water Resources and Supplies KW - O 2090:Instruments/Methods KW - SW 6020:Hydraulics KW - Q2 09162:Methods and instruments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18071515?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Waterway%2C+Port%2C+Coastal+and+Ocean+Engineering&rft.atitle=Improvement+of+parabolic+nonlinear+dispersive+wave+model&rft.au=Kaihatu%2C+J+M&rft.aulast=Kaihatu&rft.aufirst=J&rft.date=2001-04-01&rft.volume=127&rft.issue=2&rft.spage=113&rft.isbn=&rft.btitle=&rft.title=Journal+of+Waterway%2C+Port%2C+Coastal+and+Ocean+Engineering&rft.issn=0733950X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-06 N1 - SubjectsTermNotLitGenreText - Shallow water; Hydraulic models; Wave height; Wave breaking; Analytical techniques; Wave dispersion; Boundary conditions; Wave velocity; Wave propagation; Hydraulics; Viscosity; Waves (Water); Deep water; Wave Propagation; Stokes Law; Wave Velocity; Boundary Conditions; Deep Water; Waves; Shallow Water; Wave Height; Model Studies ER - TY - JOUR T1 - Wave localization on a submerged cylindrical shell with rib aperiodicity. AN - 85371392; pmid-11303939 AB - The results of a numerical study of vibration localization due to stiffener variability in a framed shell are reported. An axisymmetric finite element (FE)-infinite element model is used to obtain predictions in good general agreement with previously reported experimental results. Over the frequency band of this study, up to three times the ring frequency, two structural resonances dominate the vibratory response of the shell for high circumferential orders (n > 10). Localization is shown to be linked to the sensitivity of the local resonance frequencies of the system to specific geometrical parameters. Specifically, rib thickness variations strongly affect the first pass band, while rib spacing variations strongly affect the second pass band. JF - The Journal of the Acoustical Society of America AU - Marcus, M H AU - Houston, B H AU - Photiadis, D M AD - Naval Research Laboratory, Washington, DC 20375-5320, USA. Y1 - 2001/03// PY - 2001 DA - Mar 2001 SP - 865 EP - 869 VL - 109 IS - 3 SN - 0001-4966, 0001-4966 KW - National Library of Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85371392?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Journal+of+the+Acoustical+Society+of+America&rft.atitle=Wave+localization+on+a+submerged+cylindrical+shell+with+rib+aperiodicity.&rft.au=Marcus%2C+M+H%3BHouston%2C+B+H%3BPhotiadis%2C+D+M&rft.aulast=Marcus&rft.aufirst=M&rft.date=2001-03-01&rft.volume=109&rft.issue=3&rft.spage=865&rft.isbn=&rft.btitle=&rft.title=The+Journal+of+the+Acoustical+Society+of+America&rft.issn=00014966&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Congenital macrostomia. AN - 85355610; pmid-11241011 JF - Otolaryngology--head and neck surgery : official journal of American Academy of Otolaryngology-Head and Neck Surgery AU - Yencha, M W AD - Department of Otolaryngology-Head and Neck Surgery, Naval Hospital, Pensacola, Florida, USA. mwyencha@psa10.med.navy.mil Y1 - 2001/03// PY - 2001 DA - Mar 2001 SP - 353 EP - 354 VL - 124 IS - 3 SN - 0194-5998, 0194-5998 KW - Index Medicus KW - National Library of Medicine KW - *Fetal Macrosomia: diagnosis KW - Humans KW - Infant, Newborn KW - Male UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85355610?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Otolaryngology--head+and+neck+surgery+%3A+official+journal+of+American+Academy+of+Otolaryngology-Head+and+Neck+Surgery&rft.atitle=Congenital+macrostomia.&rft.au=Yencha%2C+M+W&rft.aulast=Yencha&rft.aufirst=M&rft.date=2001-03-01&rft.volume=124&rft.issue=3&rft.spage=353&rft.isbn=&rft.btitle=&rft.title=Otolaryngology--head+and+neck+surgery+%3A+official+journal+of+American+Academy+of+Otolaryngology-Head+and+Neck+Surgery&rft.issn=01945998&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Long-term near-bed observations of velocity and hydrographic properties in the Northwest Barents Sea with implications for sediment transport AN - 51335140; 2003-033144 JF - Continental Shelf Research AU - Sternberg, R W AU - Aagaard, K AU - Cacchione, D AU - Wheatcroft, R A AU - Beach, R A AU - Roach, A T AU - Marsden, M A H Y1 - 2001/03// PY - 2001 DA - March 2001 SP - 509 EP - 529 PB - Pergamon, Oxford VL - 21 IS - 5 SN - 0278-4343, 0278-4343 KW - currents KW - time series analysis KW - Svalbard KW - sediment transport KW - Arctic region KW - sea ice KW - stress KW - statistical analysis KW - ice cover KW - bottom currents KW - salinity KW - ocean currents KW - temperature KW - observations KW - marine sediments KW - Barents Sea KW - ice KW - sediments KW - velocity KW - Arctic Ocean KW - seasonal variations KW - ocean floors KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51335140?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Continental+Shelf+Research&rft.atitle=Long-term+near-bed+observations+of+velocity+and+hydrographic+properties+in+the+Northwest+Barents+Sea+with+implications+for+sediment+transport&rft.au=Sternberg%2C+R+W%3BAagaard%2C+K%3BCacchione%2C+D%3BWheatcroft%2C+R+A%3BBeach%2C+R+A%3BRoach%2C+A+T%3BMarsden%2C+M+A+H&rft.aulast=Sternberg&rft.aufirst=R&rft.date=2001-03-01&rft.volume=21&rft.issue=5&rft.spage=509&rft.isbn=&rft.btitle=&rft.title=Continental+Shelf+Research&rft.issn=02784343&rft_id=info:doi/ L2 - http://www.sciencedirect.com/science/journal/02784343 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 14 N1 - Document feature - illus. incl. 6 tables, geol. sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - CSHRDZ N1 - SubjectsTermNotLitGenreText - Arctic Ocean; Arctic region; Barents Sea; bottom currents; currents; ice; ice cover; marine sediments; observations; ocean currents; ocean floors; salinity; sea ice; seasonal variations; sediment transport; sediments; statistical analysis; stress; Svalbard; temperature; time series analysis; velocity ER - TY - JOUR T1 - Variable swash motions associated with foreshore profile change AN - 50156936; 2001-054810 AB - Variations in swash motions over a temporally changing foreshore surface are examined over the first tidal cycle following the onset of a storm using high-resolution video observations obtained at Duck, North Carolina. A dramatic example of profile adjustment was observed where nearly 1 m of vertical change occurred over a 4 hour time period. Swash edge excursion measurements during this study compare favorably with predictions from standard equations describing ballistic motions of an object on a plane slope under quadratic friction and showed no strong asymmetries between uprush and backwash that might explain the profile adjustment. Instead, these unique observations showed a tendency toward a predictable equilibrium between swash motions and profile response where the stability condition relates foreshore slope to incident wave period and initial uprush velocity using the ballistic equations. Under these conditions the foreshore adjusts to minimize the difference between swash duration and incident wave period. On the basis of this finding a simple morphodynamic model for changes in foreshore slope as a function of swash and surf conditions is presented and allows prediction of the transition from an erosive to stable condition. Copyright 2001 by the American Geophysical Union. JF - Journal of Geophysical Research AU - Holland, K T AU - Puleo, J A Y1 - 2001/03// PY - 2001 DA - March 2001 SP - 4613 EP - 4623 PB - American Geophysical Union, Washington, DC VL - 106 IS - C3 SN - 0148-0227, 0148-0227 KW - United States KW - Northwest Atlantic KW - swash edge excursion measuements KW - ocean circulation KW - sediment transport KW - erosion KW - Duck North Carolina KW - Dare County North Carolina KW - ballistic swash hydrodynamic model KW - equations KW - tides KW - kinematics KW - swash motions KW - North Carolina KW - foreshore surface KW - coastal environment KW - surf zone KW - ocean floors KW - North Atlantic KW - littoral erosion KW - Atlantic Ocean KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50156936?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Geophysical+Research&rft.atitle=Variable+swash+motions+associated+with+foreshore+profile+change&rft.au=Holland%2C+K+T%3BPuleo%2C+J+A&rft.aulast=Holland&rft.aufirst=K&rft.date=2001-03-01&rft.volume=106&rft.issue=C3&rft.spage=4613&rft.isbn=&rft.btitle=&rft.title=Journal+of+Geophysical+Research&rft.issn=01480227&rft_id=info:doi/10.1029%2F1999JC000172 L2 - http://www.agu.org/journals/jgr/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2001-01-01 N1 - Number of references - 37 N1 - PubXState - DC N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Atlantic Ocean; ballistic swash hydrodynamic model; coastal environment; Dare County North Carolina; Duck North Carolina; equations; erosion; foreshore surface; kinematics; littoral erosion; North Atlantic; North Carolina; Northwest Atlantic; ocean circulation; ocean floors; sediment transport; surf zone; swash edge excursion measuements; swash motions; tides; United States DO - http://dx.doi.org/10.1029/1999JC000172 ER - TY - JOUR T1 - The thermal structure of an air-water interface at low wind speeds AN - 18197389; 5223993 AB - High-resolution infrared imagery of an air-water interface at wind speeds of 1 to 4 ms super(-1) was obtained. Spectral analysis of the data reveals several important features of the thermal structure of the so-called cool skin. At wind speeds for which wind waves are not generated, the interfacial boundary layer appears to be composed of buoyant plumes that are stretched by the surface shear as they reach the interface. The plumes appear to form overlapping laminae with a head-tail structure which we have termed fish-scales. At higher wind speeds, gravity waves appearing on the surface give rise to distinct signatures in the infrared imagery. The wave system appears to modulate the surface temperature with sufficient strength so that the length and time scales of the waves are readily revealed in a k- omega spectrum. A surface drift speed can also be easily inferred from the spectrum. A direct numerical simulation of the cool-skin of a sheared water interface has also been performed. For Richardson numbers less than about 10 super(-3), the simulations reveal a surface temperature pattern dominated by a streaky structure with a characteristic spanwise length scale on the order of 100l super(+) where l super(+) = v/u*. The simulations confirm that this streaky structure is formed as slow moving fluid originating from below encounters a surface shear. The thermal structure of the surface appears virtually unchanged when buoyancy is turned off in the simulations and shear remains. This indicates that the fish-scale pattern has universal features in the sense that it forms independently of the mechanism by which the turbulence is generated. The simulations are found to be in remarkable agreement with the experimental results for which the same streaky, fish-scale structure was observed and the same streak spacing was obtained. JF - Tellus. Series A: Dynamic Meteorology and Oceanography AU - Handler, R A AU - Smith, G B AU - Leighton, R I AD - Naval Research Laboratory, Remote Sensing Division, Washington, DC 20375, USA, handler@raphael.nrl.navy.mil Y1 - 2001/03// PY - 2001 DA - Mar 2001 SP - 233 EP - 244 VL - 53A IS - 2 SN - 0280-6495, 0280-6495 KW - Oceanic Abstracts; Water Resources Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Remote Sensing KW - Meteorological Data Collection KW - Air-water Interfaces KW - Spectral Analysis KW - Temperature KW - Spectral analysis KW - Simulation KW - Water temperature KW - Atmosphere KW - Air-water interface KW - Model Studies KW - Wind speed KW - Plumes KW - Wind KW - Buoyancy KW - SW 5040:Data acquisition KW - SW 0810:General KW - Q2 09244:Air-sea coupling KW - O 2070:Meteorology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18197389?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Tellus.+Series+A%3A+Dynamic+Meteorology+and+Oceanography&rft.atitle=The+thermal+structure+of+an+air-water+interface+at+low+wind+speeds&rft.au=Handler%2C+R+A%3BSmith%2C+G+B%3BLeighton%2C+R+I&rft.aulast=Handler&rft.aufirst=R&rft.date=2001-03-01&rft.volume=53A&rft.issue=2&rft.spage=233&rft.isbn=&rft.btitle=&rft.title=Tellus.+Series+A%3A+Dynamic+Meteorology+and+Oceanography&rft.issn=02806495&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Wind speed; Spectral analysis; Water temperature; Plumes; Air-water interface; Buoyancy; Remote Sensing; Meteorological Data Collection; Spectral Analysis; Air-water Interfaces; Temperature; Simulation; Atmosphere; Wind; Model Studies ER - TY - JOUR T1 - A field-based population model for the sediment toxicity test organism Leptocheirus plumulosus: 2. model application. AN - 18093783; 5177124 AB - A stage-structured population model has been developed for the estuarine amphipod Leptocheirus plumulosus to provide interpretive guidance for sediment toxicity tests with this species. This time-varying, field-based model includes several matrices to reflect seasonal changes in demographics. In this paper, we conduct sensitivity analysis of the model to identify which life history parameters have the greatest potential impact on population growth rate ( lambda ). Results indicate seasonal variability in the relative demographic importance of vital rates. Over winter, annual population growth is most sensitive to the persistence of juveniles and adults and growth from the juvenile to the adult stage. In spring and fall, changes in fecundity are likely to have large effects on population dynamics. In addition, we demonstrate the applicability of the model by using it to interpret toxicological data from an assessment of sediment contamination in Baltimore Harbor, MD. The model was parameterized with survival data from acute toxicity tests with L. plumulosus to project effects on population growth rate ( lambda ). Results of these model simulations indicate that relatively small changes in survival can result in large changes in lambda , indicating high risk to benthic populations. Furthermore, population projections mirror observed abundances of L. plumulosus at the test sites. These analyses provide a first indication of the usefulness of the Leptocheirus population model as a tool for exploring ecological effects of sediment contamination. JF - Marine Environmental Research AU - McGee, B L AU - Spencer, M AD - US Fish and Wildlife Service, Chespeake Bay Field Office 177 Admiral Cochrane Drive, Annapolis, MD 21401 USA, beth_mcgee@fws.gov Y1 - 2001/03// PY - 2001 DA - Mar 2001 SP - 347 EP - 363 VL - 51 IS - 4 SN - 0141-1136, 0141-1136 KW - ASFA 3: Aquatic Pollution & Environmental Quality KW - Marine KW - ANW, USA, Maryland, Baltimore, Baltimore Harbor KW - Leptocheirus plumulosus KW - Sediment pollution KW - Bioassays KW - Mathematical models KW - Population characteristics KW - Temporal variations KW - Brackishwater environment KW - Toxicity tests KW - Q5 08504:Effects on organisms KW - Q5 08502:Methods and instruments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18093783?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Environmental+Research&rft.atitle=A+field-based+population+model+for+the+sediment+toxicity+test+organism+Leptocheirus+plumulosus%3A+2.+model+application.&rft.au=McGee%2C+B+L%3BSpencer%2C+M&rft.aulast=McGee&rft.aufirst=B&rft.date=2001-03-01&rft.volume=51&rft.issue=4&rft.spage=347&rft.isbn=&rft.btitle=&rft.title=Marine+Environmental+Research&rft.issn=01411136&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-06 N1 - SubjectsTermNotLitGenreText - Sediment pollution; Mathematical models; Bioassays; Population characteristics; Temporal variations; Brackishwater environment; Toxicity tests; Leptocheirus plumulosus; ANW, USA, Maryland, Baltimore, Baltimore Harbor; Marine ER - TY - JOUR T1 - Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice AN - 17855951; 4884614 AB - Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN- gamma ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN- gamma . Moreover, CD8 super(+) T cells (but not CD4 super(+) T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8 super(+) T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. JF - Infection and Immunity AU - Gramzinski, R A AU - Doolan, D L AU - Sedegah, M AU - Davis, H L AU - Krieg, A M AU - Hoffman, S L AD - Malaria Program, Naval Medical Research Center, 503 Robert Grant Ave., Silver Spring, MD 20910-7500, USA, hoffmans@nmrc.navy.mil Y1 - 2001/03// PY - 2001 DA - Mar 2001 SP - 1643 EP - 1649 VL - 69 IS - 3 SN - 0019-9567, 0019-9567 KW - mice KW - animal models KW - CD8 antigen KW - CpG oligonucleotides KW - Plasmodium yoelii KW - gamma -Interferon KW - oligodeoxynucleotides KW - oligonucleotides KW - Biotechnology and Bioengineering Abstracts; Medical and Pharmaceutical Biotechnology Abstracts; Biochemistry Abstracts 2: Nucleic Acids; Immunology Abstracts; Microbiology Abstracts C: Algology, Mycology & Protozoology KW - ^g-Interferon KW - Animal models KW - Malaria KW - Disease resistance KW - Interleukin 12 KW - DNA vaccines KW - Lymphocytes T KW - Immunoglobulins KW - g-Interferon KW - Plasmids KW - Nitric oxide KW - Vaccines KW - K 03086:Immunology & vaccination KW - F 06807:Active immunization KW - W3 33345:DNA vaccines KW - W 30965:Miscellaneous, Reviews KW - N 14800:Immunological aspects UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17855951?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Abiotechresearch&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Infection+and+Immunity&rft.atitle=Interleukin-12-+and+gamma+interferon-dependent+protection+against+malaria+conferred+by+CpG+oligodeoxynucleotide+in+mice&rft.au=Gramzinski%2C+R+A%3BDoolan%2C+D+L%3BSedegah%2C+M%3BDavis%2C+H+L%3BKrieg%2C+A+M%3BHoffman%2C+S+L&rft.aulast=Gramzinski&rft.aufirst=R&rft.date=2001-03-01&rft.volume=69&rft.issue=3&rft.spage=1643&rft.isbn=&rft.btitle=&rft.title=Infection+and+Immunity&rft.issn=00199567&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Plasmodium yoelii; Malaria; Animal models; Disease resistance; Interleukin 12; g-Interferon; Lymphocytes T; Nitric oxide; ^g-Interferon; Immunoglobulins; Vaccines; DNA vaccines; Plasmids ER - TY - JOUR T1 - Watersheds in Watershed Restoration: The Role of Public and Private Partnerships in Implementing Restoration Programs in the Chesapeake Bay Region AN - 16132734; 5334001 AB - The Chesapeake Bay (Bay) is legendary for its tremendous fish, shellfish and wildlife production. Once known as the premier wintering grounds for migratory waterfowl and the largest producer of fish and shellfish in the country, the Bay's health is now a mere shadow of its former glory. At the root of its decline is increased nutrient and sediment pollution entering the bay as a result of the development of the Bay's shoreline and surrounding watershed. The state-of-the-art water quality model of the US Environmental Protection Agency Chesapeake Bay Program calculates that the Bay is receiving over five times the amount of nitrogen that it would under predevelopment conditions and that 57 percent of the current nitrogen loads are derived from non-point sources (Blankenship 2001). Like most watersheds across the country, finding an effective means to reducing non-point source pollution has been very challenging. However, the Chesapeake region has recently increased its focus on restoring natural filtering mechanisms to the landscape, specifically wetlands and riparian buffers. While these efforts are primarily driven by water quality goals, they also have tremendous benefits for wildlife habitat. JF - Transactions of the North American Wildlife and Natural Resources Conference AU - Street, W H AD - Chesapeake Bay Foundation, Annapolis, Maryland, USA A2 - Rahm, J A2 - McCabe, R Y1 - 2001/03// PY - 2001 DA - March 2001 SP - 588 EP - 597 PB - Wildlife Management Institute, 1101 14th St. NW Suite 801 Washington DC 20005 USA IS - 66 SN - 0078-1355, 0078-1355 KW - USA, Chesapeake Bay KW - Pollution Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Water Resources Abstracts KW - Catchment area KW - water quality KW - buffers KW - Agricultural pollution KW - Watershed Management KW - Freshwater KW - Water Resources Management KW - Watersheds KW - Restoration KW - Riparian environments KW - Environmental Policy KW - Wetlands KW - Marine KW - North America KW - Sediment pollution KW - Biofilters KW - Conferences KW - Wildlife KW - Landscape KW - Brackish KW - Habitat KW - Nonpoint pollution KW - ANW, USA, Chesapeake Bay KW - Water quality control KW - EPA KW - waterfowl KW - Natural resources KW - Shellfish KW - Fish KW - Environment management KW - Public Opinion KW - Pollution control KW - Nitrogen KW - P 2000:FRESHWATER POLLUTION KW - SW 4020:Evaluation process KW - Q5 08522:Protective measures and control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/16132734?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=Transactions+of+the+North+American+Wildlife+and+Natural+Resources+Conference&rft.atitle=Watersheds+in+Watershed+Restoration%3A+The+Role+of+Public+and+Private+Partnerships+in+Implementing+Restoration+Programs+in+the+Chesapeake+Bay+Region&rft.au=Street%2C+W+H&rft.aulast=Street&rft.aufirst=W&rft.date=2001-03-01&rft.volume=&rft.issue=66&rft.spage=588&rft.isbn=&rft.btitle=&rft.title=Transactions+of+the+North+American+Wildlife+and+Natural+Resources+Conference&rft.issn=00781355&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2003-04-01 N1 - Last updated - 2016-12-22 N1 - SubjectsTermNotLitGenreText - Catchment area; Water quality control; Biofilters; Agricultural pollution; Riparian environments; Wetlands; Watersheds; Environment management; Nitrogen; Restoration; Pollution control; Sediment pollution; water quality; Conferences; buffers; Landscape; Wildlife; Nonpoint pollution; Habitat; EPA; waterfowl; Natural resources; Fish; Shellfish; Environmental Policy; Watershed Management; Water Resources Management; Public Opinion; North America; ANW, USA, Chesapeake Bay; Freshwater; Brackish; Marine ER - TY - CPAPER T1 - Prediction of extreme precipitation associated with landfalling tropical cyclones AN - 39412494; 3580855 AU - Abbey, RF Jr AU - Leslie, L M AU - Speer AU - Qi, L Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39412494?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Prediction+of+extreme+precipitation+associated+with+landfalling+tropical+cyclones&rft.au=Abbey%2C+RF+Jr%3BLeslie%2C+L+M%3BSpeer%3BQi%2C+L&rft.aulast=Abbey&rft.aufirst=RF&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Poster Paper No. P3.13 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Study of data selection and quality control and their impact in the North Pacific AN - 39364420; 3580214 AU - Pauley, P M AU - Barker, E H Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39364420?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Study+of+data+selection+and+quality+control+and+their+impact+in+the+North+Pacific&rft.au=Pauley%2C+P+M%3BBarker%2C+E+H&rft.aulast=Pauley&rft.aufirst=P&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Paper No. 4.12 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Experimental and modeling studies of processes which govern the marine boundary layer aerosol AN - 39364262; 3580190 AU - Hoppel, WA AU - Fitzgerald, J AU - Frick, G AU - Caffrey, P AU - Pasternack, L Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39364262?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Experimental+and+modeling+studies+of+processes+which+govern+the+marine+boundary+layer+aerosol&rft.au=Hoppel%2C+WA%3BFitzgerald%2C+J%3BFrick%2C+G%3BCaffrey%2C+P%3BPasternack%2C+L&rft.aulast=Hoppel&rft.aufirst=WA&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Paper No. 2.13 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Datastreme in the secondary geography classroom AN - 39356821; 3579997 AU - Lynne, P AU - Smith, K AU - Hottle-Schultz, S Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39356821?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Datastreme+in+the+secondary+geography+classroom&rft.au=Lynne%2C+P%3BSmith%2C+K%3BHottle-Schultz%2C+S&rft.aulast=Lynne&rft.aufirst=P&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Poster Paper No. P1.20 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - NCDDC prototype interoperability architecture AN - 39355644; 3580423 AU - Ellis, J W Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39355644?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=NCDDC+prototype+interoperability+architecture&rft.au=Ellis%2C+J+W&rft.aulast=Ellis&rft.aufirst=J&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Paper No. 11.4 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - How the Maury project supports teaching and learning about marine and coastal environments AN - 39332043; 3580033 AU - Smith AU - Geer, I W AU - McManus, DE Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39332043?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=How+the+Maury+project+supports+teaching+and+learning+about+marine+and+coastal+environments&rft.au=Smith%3BGeer%2C+I+W%3BMcManus%2C+DE&rft.aulast=Smith&rft.aufirst=&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Paper No. J1.5 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Maryland's stream corridor assessment survey AN - 39284828; 3565424 AU - Yetman, K T Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39284828?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Maryland%27s+stream+corridor+assessment+survey&rft.au=Yetman%2C+K+T&rft.aulast=Yetman&rft.aufirst=K&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Virginia Polytechnic Institute and State University, Blacksburg VA, 24061, USA; phone: 540 231 5265; fax: 540 231 7417; email: http://www.conted.vt.edu/watershed.htm; URL: http://www.conted.vt.edu/watershed.htm N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Potential nitrogen and phosphorus loadings from agriculture in the Chesapeake Bay watershed AN - 39284676; 3565410 AU - Weber, A J AU - Mader, RL Jr AU - Kellogg, R AU - Griswold, J Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39284676?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Potential+nitrogen+and+phosphorus+loadings+from+agriculture+in+the+Chesapeake+Bay+watershed&rft.au=Weber%2C+A+J%3BMader%2C+RL+Jr%3BKellogg%2C+R%3BGriswold%2C+J&rft.aulast=Weber&rft.aufirst=A&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Virginia Polytechnic Institute and State University, Blacksburg VA, 24061, USA; phone: 540 231 5265; fax: 540 231 7417; email: http://www.conted.vt.edu/watershed.htm; URL: http://www.conted.vt.edu/watershed.htm N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Capabilities and characteristics of rainfall estimates from geostationary- and geostationary+ microwave-based satellite techniques AN - 39257177; 3580793 AU - Turk, J AU - Liou, C-S AU - Qiu, S AU - Scofield, R A AU - Ba, M B AU - Gruber, A Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39257177?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Capabilities+and+characteristics+of+rainfall+estimates+from+geostationary-+and+geostationary%2B+microwave-based+satellite+techniques&rft.au=Turk%2C+J%3BLiou%2C+C-S%3BQiu%2C+S%3BScofield%2C+R+A%3BBa%2C+M+B%3BGruber%2C+A&rft.aulast=Turk&rft.aufirst=J&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon St., Boston, MA 02108-3693, USA; URL: www.ametsoc.org. Poster Paper No. P2.27 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Salt marshes and reserves AN - 39245843; 3566938 AU - Percy, J Y1 - 2001/02/26/ PY - 2001 DA - 2001 Feb 26 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39245843?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Salt+marshes+and+reserves&rft.au=Percy%2C+J&rft.aulast=Percy&rft.aufirst=J&rft.date=2001-02-26&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Sybertooth Inc. Informatics and Information Services, 59 Salem Street, Sackville, New Brunswick, Canada E4L 4J6; phone: (506) 364-10943; fax: (506) 536-2949; URL: http://www.sybertooth.ca N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Mortality of migratory waterbirds in mid-Atlantic coastal anchored gillnets during March and April, 1998 AN - 39308957; 3566565 AU - Forsell, D Y1 - 2001/02/22/ PY - 2001 DA - 2001 Feb 22 KW - CPI, Conference Papers Index KW - U 1200:Aquatic Science KW - U 2000:Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/39308957?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Mortality+of+migratory+waterbirds+in+mid-Atlantic+coastal+anchored+gillnets+during+March+and+April%2C+1998&rft.au=Forsell%2C+D&rft.aulast=Forsell&rft.aufirst=D&rft.date=2001-02-22&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Waterbird Society, OSNA, PO Box 1897, Lawrence, KS 66044-8897, USA; URL: http://www.nmnh.si.edu/BIRDNET/CWS. Paper No. 81 N1 - Last updated - 2010-05-03 ER - TY - JOUR T1 - Susceptibility of PharmChek drugs of abuse patch to environmental contamination AN - 17841503; 4879942 AB - The key component of the PharmChek sweat patch, the membrane, has been tested for the passage of externally applied materials. Drugs in the uncharged state rapidly penetrated the membrane but charged species were greatly slowed. In basic media, detectable concentrations of cocaine, methamphetamine, and heroin were observed at the earliest collection time (ca. 30 s), after drugs were placed on the outside of the membrane. Drug concentrations increased over the 2 h time course, when amounts detected (1710 ng cocaine, 1060 ng methamphetamine, 550 ng heroin per pad at 2 h) represented 5-17% of the drug deposited on the surface of the sweat patch. Drugs externally applied to human skin were shown to bind readily. Drugs deposited on the skin of drug-free volunteers several days prior to application of the sweat patch were not completely removed by normal hygiene or the cleaning procedures recommended before application of the sweat patch. Even 6 days of normal hygiene did not remove all drugs from externally contaminated skin and positive sweat patches resulted. A mechanism for passage of drugs through the sweat patch membrane, a mechanism for retention of drugs on skin, and a redesign of the sweat patch and modification of its use to reduce external contamination are proposed. Appropriate care should be taken in the interpretation of positive results from a sweat patch test until more research is conducted. JF - Forensic Science International AU - Kidwell, DA AU - Smith, F P AD - Chemistry Division, Code 6177, US Naval Research Laboratory, Washington, DC 20375, USA, kidwell@ccf.nrl.navy.mil Y1 - 2001/02/15/ PY - 2001 DA - 2001 Feb 15 SP - 89 EP - 106 VL - 116 IS - 2-3 SN - 0379-0738, 0379-0738 KW - man KW - PharmChek sweat patch KW - Toxicology Abstracts KW - Contamination KW - Drug abuse KW - X 24222:Analytical procedures UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17841503?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Forensic+Science+International&rft.atitle=Susceptibility+of+PharmChek+drugs+of+abuse+patch+to+environmental+contamination&rft.au=Kidwell%2C+DA%3BSmith%2C+F+P&rft.aulast=Kidwell&rft.aufirst=DA&rft.date=2001-02-15&rft.volume=116&rft.issue=2-3&rft.spage=89&rft.isbn=&rft.btitle=&rft.title=Forensic+Science+International&rft.issn=03790738&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Drug abuse; Contamination ER - TY - JOUR T1 - Head and neck pilomatricoma in the pediatric age group: a retrospective study and literature review. AN - 85361715; pmid-11165649 AB - To discuss the clinical course and management of pilomatricoma involving the head and neck in the pediatric age group and to review the literature.Retrospective analysis of the author's case files between the years of 1996 and 2000, revealed seven cases of head and neck pilomatricoma involving children. A literature review was employed to compare this study to others.In all cases, the presenting sign was a superficially located rock-hard mass in the head and neck. The mean duration the mass was present at the initial otolaryngologic evaluation was 11 months. There was a total of seven patients of which five (71%) were female while two (29%) were male. Each patient presented with a single pilomatricoma. Five (71%) occurred in the neck while two (29%) occurred in the face. All were treated with surgical excision. There were no recurrences.Pilomatricoma is a rare, benign, skin neoplasm that is superficially located and most commonly occurs in the head and neck, thus otolaryngologists should be aware of its clinical presentation. Although malignant transformation has been described, it is exceedingly rare. Diagnosis is usually suspected based on palpation of a superficial, rock-hard mass and confirmed by histopathologic examination. Since this neoplasm doesn't spontaneously regress, surgical excision is both curative and the treatment of choice. Recurrence is rare. JF - International journal of pediatric otorhinolaryngology AU - Yencha, M W AD - Department of Otolaryngology, Head and Neck Surgery, NH-Pensacola, 6000 West Highway 98, Pensacola, FL 32512, USA. mwyencha@psa10.med.navy.mil Y1 - 2001/02// PY - 2001 DA - Feb 2001 SP - 123 EP - 128 VL - 57 IS - 2 SN - 0165-5876, 0165-5876 KW - Index Medicus KW - National Library of Medicine KW - Child KW - Child, Preschool KW - Female KW - *Hair Diseases: epidemiology KW - Hair Diseases: surgery KW - *Head and Neck Neoplasms: epidemiology KW - Head and Neck Neoplasms: surgery KW - Humans KW - Male KW - *Pilomatrixoma: epidemiology KW - Pilomatrixoma: surgery KW - Retrospective Studies KW - *Skin Neoplasms: epidemiology KW - Skin Neoplasms: surgery UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/85361715?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acomdisdome&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+journal+of+pediatric+otorhinolaryngology&rft.atitle=Head+and+neck+pilomatricoma+in+the+pediatric+age+group%3A+a+retrospective+study+and+literature+review.&rft.au=Yencha%2C+M+W&rft.aulast=Yencha&rft.aufirst=M&rft.date=2001-02-01&rft.volume=57&rft.issue=2&rft.spage=123&rft.isbn=&rft.btitle=&rft.title=International+journal+of+pediatric+otorhinolaryngology&rft.issn=01655876&rft_id=info:doi/ LA - English (eng) DB - ComDisDome N1 - Date revised - 2011-12-15 N1 - Last updated - 2012-07-13 ER - TY - JOUR T1 - Introduction: Growing Pains -- China Debates Its International Future AN - 60574603; 200111646 AB - Liberal democracies in North America, Europe, & Japan have coalesced into a global power center with shared ingroup values & a common foreign policy outlook. Despite its growing materialist capacities, the People's Republic of China finds itself hardly closer to the great power center, perceiving itself instead condemned to the periphery & victimized by the assertion of the emerging global center. Confronted with this predicament, Chinese intellectuals & policy elites have debated over how China should relate to the world & the US. Their answer remains uncertain, as China is still struggling to find the way out of the periphery. However, so long as it believes that the great power club is open to its membership, China will likely continue to try to live up to its self-identification as a responsible power. Adapted from the source document. JF - Journal of Contemporary China AU - Deng, Yong AU - Garay, Sherry AD - US Naval Academy, Annapolis, MD Y1 - 2001/02// PY - 2001 DA - February 2001 SP - 5 EP - 16 VL - 10 IS - 26 SN - 1067-0564, 1067-0564 KW - Peoples Republic of China KW - North America KW - Liberal Democratic Societies KW - Center and Periphery KW - United States of America KW - Europe KW - Foreign Policy KW - Japan KW - article KW - 9063: international relations; international relations UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60574603?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Contemporary+China&rft.atitle=Introduction%3A+Growing+Pains+--+China+Debates+Its+International+Future&rft.au=Deng%2C+Yong%3BGaray%2C+Sherry&rft.aulast=Deng&rft.aufirst=Yong&rft.date=2001-02-01&rft.volume=10&rft.issue=26&rft.spage=5&rft.isbn=&rft.btitle=&rft.title=Journal+of+Contemporary+China&rft.issn=10670564&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - SubjectsTermNotLitGenreText - Center and Periphery; Liberal Democratic Societies; United States of America; Europe; Japan; North America; Peoples Republic of China; Foreign Policy ER - TY - JOUR T1 - Arsenic and mercury contamination in 31 cores taken in 1965, St. Anna Trough, Kara Sea, Arctic Ocean AN - 51184608; 2001-037719 JF - Environmental Geology (Berlin) AU - Siegel, Frederic R AU - Kravitz, Joseph H AU - Galasso, Jennifer J Y1 - 2001/02// PY - 2001 DA - February 2001 SP - 528 EP - 542 PB - Springer International, Berlin VL - 40 IS - 4-5 SN - 0943-0105, 0943-0105 KW - Saint Anna Trough KW - factor analysis KW - Svyataya Anna Trough KW - bioavailability KW - environmental analysis KW - cores KW - cluster analysis KW - bioaccumulation KW - marine sediments KW - transport KW - sediments KW - drainage basins KW - Arctic Ocean KW - ocean floors KW - discharge KW - mercury KW - granulometry KW - concentration KW - toxic materials KW - effluents KW - statistical analysis KW - arsenic KW - pollution KW - biota KW - Kara Sea KW - metals KW - industrial waste KW - nuclear facilities KW - waste disposal KW - 07:Oceanography KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51184608?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Geology+%28Berlin%29&rft.atitle=Arsenic+and+mercury+contamination+in+31+cores+taken+in+1965%2C+St.+Anna+Trough%2C+Kara+Sea%2C+Arctic+Ocean&rft.au=Siegel%2C+Frederic+R%3BKravitz%2C+Joseph+H%3BGalasso%2C+Jennifer+J&rft.aulast=Siegel&rft.aufirst=Frederic&rft.date=2001-02-01&rft.volume=40&rft.issue=4-5&rft.spage=528&rft.isbn=&rft.btitle=&rft.title=Environmental+Geology+%28Berlin%29&rft.issn=09430105&rft_id=info:doi/ L2 - http://www.springerlink.com/content/1432-0495/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2001-01-01 N1 - Number of references - 25 N1 - Document feature - illus. incl. 4 tables, sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - Arctic Ocean; arsenic; bioaccumulation; bioavailability; biota; cluster analysis; concentration; cores; discharge; drainage basins; effluents; environmental analysis; factor analysis; granulometry; industrial waste; Kara Sea; marine sediments; mercury; metals; nuclear facilities; ocean floors; pollution; Saint Anna Trough; sediments; statistical analysis; Svyataya Anna Trough; toxic materials; transport; waste disposal ER - TY - JOUR T1 - Dynamic Strength Capabilities of Small-Stature Females to Perform High-Performance Flight Tasks AN - 17816909; 4858917 AB - Naval Air Warfare Center Aircraft Division investigated the abilities of small-stature females ( less than or equal to 120 lb.) to fly under G-stress using the Dynamic Flight Simulator (DFS) and its tactical fight/attack cockpit, displays and controls. The objective was to determine if these individuals possess sufficient upper-body muscular endurance to perform tasks required during fighter-pilot training, aerial combat maneuvers, and failure modes. Five female subjects (four small-stature and one medium) participated. DFS tasks featured bombing runs, surface-to-air missile (SAM) avoidance, and single engine failure. Muscular exertion and fatigue (arm, shoulder, neck) were assessed using electromyography. During the most physically taxing simulation (SAM avoidance), flight performance did not significantly degrade over time. No statistically significant increase in muscular fatigue was found during the bombing simulation, though there was some evidence of degraded fine muscle control. Evidence of flexor and extensor muscular fatigue was associated with the single-engine-failure simulation. Within the scope of these tests, small-stature individuals demonstrated the strength and endurance to safely fly physically strenuous missions. However, a larger subject sample is necessary to increase the statistical power of the results. JF - Aviation, Space and Environmental Medicine AU - Shender, B S AU - Heffner, P L AD - NAWCAD, BLDG 2187 SUITE 2280, 48110 Shaw Road UNIT 5, Patuxent River, MD 20670-1906, USA, ShenderBS@navair.navy.mil Y1 - 2001/02// PY - 2001 DA - Feb 2001 SP - 89 EP - 99 VL - 72 IS - 2 SN - 0095-6562, 0095-6562 KW - small stature females KW - gravity KW - musculoskeletal system KW - pilots KW - Health & Safety Science Abstracts KW - Females KW - Military KW - Occupational exposure KW - H 1000:Occupational Safety and Health UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17816909?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Aviation%2C+Space+and+Environmental+Medicine&rft.atitle=Dynamic+Strength+Capabilities+of+Small-Stature+Females+to+Perform+High-Performance+Flight+Tasks&rft.au=Shender%2C+B+S%3BHeffner%2C+P+L&rft.aulast=Shender&rft.aufirst=B&rft.date=2001-02-01&rft.volume=72&rft.issue=2&rft.spage=89&rft.isbn=&rft.btitle=&rft.title=Aviation%2C+Space+and+Environmental+Medicine&rft.issn=00956562&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Females; Military; Occupational exposure ER - TY - JOUR T1 - Toxicology and environmental digital resources from and for citizen groups. AN - 70640478; 11164976 AB - Since the late 1970s, grass-roots community groups, consumer advocates, and national (and international) environmental organizations have made two main contributions to public discussions, and public policies, affecting the production, use, and disposal of toxic materials. With the advent of e-mail, listservs, and the World Wide Web, such groups formed global "early warning" networks that have (1) alerted people to many uses of toxic materials and their effects on wildlife and humans, and (2) advocated new prevention-based public policies, including: assessment of available alternatives as a means of supplementing risk assessments; clean production as a way of avoiding the use of toxic materials; the substitution principle as a way of systematically reducing the use of toxic materials as time passes; the precautionary principle as a policy response to uncertainties in toxicological science; and zero discharge of persistent or bioaccumulative substances. We describe and discuss numerous important digital resources (web sites, discussion lists, and databases) created and maintained by and for citizen groups. JF - Toxicology AU - Montague, P AU - Pellerano, M B AD - Environmental Research Foundation, PO Box 5036, Annapolis, MD 21403-7036, USA. Y1 - 2001/01/12/ PY - 2001 DA - 2001 Jan 12 SP - 77 EP - 88 VL - 157 IS - 1-2 SN - 0300-483X, 0300-483X KW - Index Medicus KW - Occupational Health KW - Animals KW - Humans KW - Databases as Topic KW - Animal Rights KW - Environmental Health KW - Toxicology KW - Internet UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/70640478?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Toxicology&rft.atitle=Toxicology+and+environmental+digital+resources+from+and+for+citizen+groups.&rft.au=Montague%2C+P%3BPellerano%2C+M+B&rft.aulast=Montague&rft.aufirst=P&rft.date=2001-01-12&rft.volume=157&rft.issue=1-2&rft.spage=77&rft.isbn=&rft.btitle=&rft.title=Toxicology&rft.issn=0300483X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-03-15 N1 - Date created - 2001-02-22 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Fast thin-layer inversion (theory) AN - 911679089; 2012-005999 AB - Conventional analysis of seismic data for layered medium properties breaks down when the layers are thinner than the seismic wavelength. We describe a fast and accurate method to calculate the reflection response of a thin layer and then use this method to invert seismic data for the thickness and physical properties of the thin layer. A reflectivity forward model is used because it includes all the spectral effects of the thin layer interference and can be used for any elastic for fluid case. The data are prepared for the inversion by time windowing the thin layer reflection which is then transformed to the frequency rayparameter (omega -p) domain. The error function calculation for the inversion is done in the omega -p domain so that many fewer loops are used in the reflectivity calculation. By isolating the layer and doing all the calculation in the omega -p domain, the speed of the inversion calculation is increased by a factor of approximately 1000. JF - SEG Annual Meeting Expanded Technical Program Abstracts with Biographies AU - Lindwall, Dennis AU - Theophanis, Stephen AU - Anonymous Y1 - 2001 PY - 2001 DA - 2001 SP - 1237 EP - 1240 PB - Society of Exploration Geophysicists, Tulsa, OK VL - 71 SN - 1052-3812, 1052-3812 KW - velocity analysis KW - AVO methods KW - numerical analysis KW - data acquisition KW - geophysical methods KW - data processing KW - reflection methods KW - elastic waves KW - layered materials KW - seismic methods KW - theoretical studies KW - mathematical methods KW - seismic waves KW - anisotropy KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911679089?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=SEG+Annual+Meeting+Expanded+Technical+Program+Abstracts+with+Biographies&rft.atitle=Fast+thin-layer+inversion+%28theory%29&rft.au=Lindwall%2C+Dennis%3BTheophanis%2C+Stephen%3BAnonymous&rft.aulast=Lindwall&rft.aufirst=Dennis&rft.date=2001-01-01&rft.volume=71&rft.issue=&rft.spage=1237&rft.isbn=&rft.btitle=&rft.title=SEG+Annual+Meeting+Expanded+Technical+Program+Abstracts+with+Biographies&rft.issn=10523812&rft_id=info:doi/ L2 - http://www.seg.org/ LA - English DB - GeoRef N1 - Conference title - Society of Exploration Geophysicists, 71st annual meeting N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by Society of Exploration Geophysicists, Tulsa, OK, United States N1 - Date revised - 2012-01-01 N1 - Number of references - 7 N1 - PubXState - OK N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - anisotropy; AVO methods; data acquisition; data processing; elastic waves; geophysical methods; layered materials; mathematical methods; numerical analysis; reflection methods; seismic methods; seismic waves; theoretical studies; velocity analysis ER - TY - JOUR T1 - Fast thin-layer inversion (numerical and laboratory model examples) AN - 911676483; 2012-006005 AB - Establishing layer thickness and layer properties from seismic data when the layer is smaller than an acoustic wavelength is a common problem in exploration geophysics. Many hydrocarbon reservoirs fall into this category, while estimates of their volume rely directly on our ability to resolve the thickness. Estimates of the world's supply of methane hydrate are also based on our ability to measure the thickness of hydrate cemented sediments often in the 1-10 m range. In this abstract we demonstrate a very fast inversion method that solves for the layer thickness and layer properties of a thin layer from the seismic data. The signal from the thin layer is isolated (windowed) from the seismogram and converted to the reflection coefficient in the ?-p domain. The reflectivity based forward model calculates the reflection coefficient for a given layered earth model. The very fast simulated annealing inversion routine finds the layer properties by performing a global minimization of the L norm between the measured and modeled reflection coefficients. We present two demonstrations, a numerical example using synthesized data consistent with a DTAGS shot over a hydrate bearing sediment, and a laboratory physical modeling example where the model is a thin aluminum layer embedded in a Lucite background. JF - SEG Annual Meeting Expanded Technical Program Abstracts with Biographies AU - Theophanis, Stephen AU - Lindwall, Dennis AU - Anonymous Y1 - 2001 PY - 2001 DA - 2001 SP - 1261 EP - 1264 PB - Society of Exploration Geophysicists, Tulsa, OK VL - 71 SN - 1052-3812, 1052-3812 KW - petroleum exploration KW - AVO methods KW - numerical models KW - gas hydrates KW - natural gas KW - data acquisition KW - geophysical methods KW - data processing KW - petroleum KW - physical models KW - seismic methods KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/911676483?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=SEG+Annual+Meeting+Expanded+Technical+Program+Abstracts+with+Biographies&rft.atitle=Fast+thin-layer+inversion+%28numerical+and+laboratory+model+examples%29&rft.au=Theophanis%2C+Stephen%3BLindwall%2C+Dennis%3BAnonymous&rft.aulast=Theophanis&rft.aufirst=Stephen&rft.date=2001-01-01&rft.volume=71&rft.issue=&rft.spage=1261&rft.isbn=&rft.btitle=&rft.title=SEG+Annual+Meeting+Expanded+Technical+Program+Abstracts+with+Biographies&rft.issn=10523812&rft_id=info:doi/ L2 - http://www.seg.org/ LA - English DB - GeoRef N1 - Conference title - Society of Exploration Geophysicists, 71st annual meeting N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data supplied by Society of Exploration Geophysicists, Tulsa, OK, United States N1 - Date revised - 2012-01-01 N1 - Number of references - 6 N1 - PubXState - OK N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - AVO methods; data acquisition; data processing; gas hydrates; geophysical methods; natural gas; numerical models; petroleum; petroleum exploration; physical models; seismic methods ER - TY - JOUR T1 - Modeling the potential radionuclide transport by the Ob and Yenisey Rivers to the Kara Sea. AN - 72200614; 11601529 AB - A major portion of the former Soviet Union (FSU) nuclear program is located in the West Siberian Basin. Among the many nuclear facilities are three production reactors and the spent nuclear fuel reprocessing sites, Mayak, Tomsk-7, and Krasnoyarsk-26, which together are probably responsible for the majority of the radioactive contamination found in the Ob and Yenisey River systems that feed into the Arctic Ocean through the Kara Sea. This manuscript describes ongoing research to estimate radionuclide fluxes to the Kara Sea from these river systems. Our approach is to apply a hierarchy of simple models that use existing and forthcoming data to quantify the transport and fate of radionuclide contaminants via various environmental pathways. We present an initial quantification of the contaminant inventory, hydrology, meteorology, and sedimentology of the Ob River system and preliminary conclusions from portions of the Ob River model. JF - Marine pollution bulletin AU - Paluszkiewicz, T AU - Hibler, L F AU - Richmond, M C AU - Bradley, D J AU - Thomas, S A AD - Pacific Northwest Laboratory, Battelle, Sequim, WA 98382, USA. paluszt@onr.navy.mil PY - 2001 SP - 111 EP - 121 VL - 43 IS - 1-6 SN - 0025-326X, 0025-326X KW - Radioisotopes KW - 0 KW - Water Pollutants, Radioactive KW - Plutonium KW - 53023GN24M KW - Index Medicus KW - Seawater -- chemistry KW - Oceans and Seas KW - Geologic Sediments -- chemistry KW - Water Movements KW - Models, Chemical KW - Russia KW - Radioisotopes -- analysis KW - Arctic Regions KW - Fresh Water -- chemistry KW - Water Pollution, Radioactive -- analysis KW - Water Pollutants, Radioactive -- analysis KW - Plutonium -- analysis UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/72200614?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+pollution+bulletin&rft.atitle=Modeling+the+potential+radionuclide+transport+by+the+Ob+and+Yenisey+Rivers+to+the+Kara+Sea.&rft.au=Paluszkiewicz%2C+T%3BHibler%2C+L+F%3BRichmond%2C+M+C%3BBradley%2C+D+J%3BThomas%2C+S+A&rft.aulast=Paluszkiewicz&rft.aufirst=T&rft.date=2001-01-01&rft.volume=43&rft.issue=1-6&rft.spage=111&rft.isbn=&rft.btitle=&rft.title=Marine+pollution+bulletin&rft.issn=0025326X&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2002-03-14 N1 - Date created - 2001-10-16 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Ethanol blocks cytosolic Ca2+ responses triggered by activation of GABA(A) receptor/Cl- channels in cultured proliferating rat neuroepithelial cells. AN - 71008660; 11440820 AB - GABA(A) receptor/Cl- channels and voltage-gated Ca2+ channels are believed to be important sites of ethanol action in the CNS. Acute exposure of ethanol potentiates GABA(A) receptor/Cl- channel activity and inhibits voltage-gated Ca2+ channels in a number of preparations, mostly post-mitotic neurons. The effects of ethanol on these channels in primary cultures of undifferentiated neural precursor cells remain unknown. To address this issue, we examined the effects of ethanol on GABA(A) agonist-activated elevation of cytosolic Ca2+ in an in vitro model of the cortical neuroepithelium derived from rat basic fibroblast growth factor-expanded neural precursor cells. We found a potent inhibition of GABA(A)-activated elevation of cytosolic Ca2+ by ethanol in actively proliferating cells. Since we had recently demonstrated that GABA(A) receptor activation depolarizes these cells and elevates their cytosolic Ca2+, we tested whether the effects of ethanol involved both GABA(A) receptors and voltage-gated Ca2+ channels. Both extracellular K+- and muscimol-induced cytosolic Ca2+ elevations were abolished by nitrendipine, indicating that both depolarizing stimuli triggered Ca2+ influx through L-type voltage-gated Ca2+ channels. Exposure of proliferating cells to different concentrations of ethanol revealed that the drug was more potent in blocking muscimol-induced compared to K+-evoked cytosolic Ca2+ elevations. These results raise the possibility that ethanol blocks GABAergic stimulation of cytosolic Ca2+ levels in proliferating precursors primarily by interacting with GABA(A) receptor/Cl- channels and secondarily with voltage-gated Ca2+ channels. JF - Neuroscience AU - Ma, W AU - Pancrazio, J J AU - Andreadis, J D AU - Shaffer, K M AU - Stenger, D A AU - Li, B S AU - Zhang, L AU - Barker, J L AU - Maric, D AD - Center for Bio/Molecular Science and Engineering, Naval Research Laboratory, Washington, DC 20375, USA. wma@ccsalpha4.nrl.navy.mil Y1 - 2001 PY - 2001 DA - 2001 SP - 913 EP - 922 VL - 104 IS - 3 SN - 0306-4522, 0306-4522 KW - Calcium Channel Blockers KW - 0 KW - Calcium Channels, L-Type KW - Chloride Channels KW - Receptors, GABA-A KW - Ethanol KW - 3K9958V90M KW - Potassium Chloride KW - 660YQ98I10 KW - Calcium KW - SY7Q814VUP KW - Index Medicus KW - Cerebral Cortex -- cytology KW - Animals KW - Fetus KW - Cerebral Cortex -- drug effects KW - Potassium Chloride -- pharmacology KW - Cell Division -- physiology KW - Membrane Potentials -- physiology KW - Disease Models, Animal KW - Cells, Cultured -- drug effects KW - Cells, Cultured -- cytology KW - Rats KW - Calcium Channel Blockers -- pharmacology KW - Cerebral Cortex -- embryology KW - Fetal Alcohol Spectrum Disorders -- metabolism KW - Calcium Channels, L-Type -- metabolism KW - Extracellular Space -- drug effects KW - Cell Division -- drug effects KW - Pregnancy KW - Calcium Channels, L-Type -- drug effects KW - Rats, Sprague-Dawley KW - Calcium Signaling -- drug effects KW - Fetal Alcohol Spectrum Disorders -- physiopathology KW - Cells, Cultured -- metabolism KW - Calcium Signaling -- physiology KW - Extracellular Space -- metabolism KW - Membrane Potentials -- drug effects KW - Immunohistochemistry KW - Female KW - Prenatal Exposure Delayed Effects KW - Stem Cells -- drug effects KW - Calcium -- metabolism KW - Cytosol -- metabolism KW - Neurons -- metabolism KW - Ethanol -- pharmacology KW - Cytosol -- drug effects KW - Neurons -- drug effects KW - Receptors, GABA-A -- metabolism KW - Chloride Channels -- metabolism KW - Chloride Channels -- drug effects KW - Receptors, GABA-A -- drug effects KW - Stem Cells -- metabolism UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/71008660?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Neuroscience&rft.atitle=Ethanol+blocks+cytosolic+Ca2%2B+responses+triggered+by+activation+of+GABA%28A%29+receptor%2FCl-+channels+in+cultured+proliferating+rat+neuroepithelial+cells.&rft.au=Ma%2C+W%3BPancrazio%2C+J+J%3BAndreadis%2C+J+D%3BShaffer%2C+K+M%3BStenger%2C+D+A%3BLi%2C+B+S%3BZhang%2C+L%3BBarker%2C+J+L%3BMaric%2C+D&rft.aulast=Ma&rft.aufirst=W&rft.date=2001-01-01&rft.volume=104&rft.issue=3&rft.spage=913&rft.isbn=&rft.btitle=&rft.title=Neuroscience&rft.issn=03064522&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-08-30 N1 - Date created - 2001-07-06 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - Potential health and environmental issues of mercury-contaminated amalgamators. AN - 70586069; 11194400 AB - Dental amalgamators may become contaminated internally with metallic mercury. This contamination may result from mercury leakage from capsules during trituration or from the long-term accrual from microscopic exterior contaminants that result from the industrial assembly process. The potential health risk to dental personnel from this contamination is unknown. The authors assessed used amalgamators from the federal service inventory for the amounts of mercury vapor levels, as well as the visual presence of mercury contamination. They evaluated these amalgamators for potential mercury vapor health risk, using established National Institute for Occupational Safety and Health methods and American Conference of Governmental Industrial Hygienists standards. Ten of the 11 amalgamators assessed had measurable mercury vapor levels. Four amalgamators were found to have internal static mercury vapor levels above Occupational Safety and Health Administration ceiling limit thresholds. During a simulated worst-case clinical use protocol, the authors found that no amalgamators produced mercury vapor in the breathing space of dental personnel that exceeded established time-weighted federal mercury vapor limits. Amalgamators may be contaminated internally with metallic mercury. Although the authors detected mercury vapor from these units during aggressive, simulated clinical use, dilution factors combined with room air exchange were found to keep health risks below established federal safety thresholds. Dental personnel should be aware that amalgamators may be contaminated with mercury and produce minute amounts of mercury vapor. These contaminated amalgamators may require disposal as environmentally hazardous waste. JF - Journal of the American Dental Association (1939) AU - Roberts, H W AU - Leonard, D AU - Osborne, J AD - USAF Dental Investigation Service, Detachment 1, USAFSAM, 310C B St., Building 1H, Great Lakes, Ill. 60088, USA. howard.roberts@ndri.med.navy.mil Y1 - 2001/01// PY - 2001 DA - January 2001 SP - 58 EP - 64 VL - 132 IS - 1 SN - 0002-8177, 0002-8177 KW - Dental Waste KW - 0 KW - Hazardous Waste KW - Dental Amalgam KW - 8049-85-2 KW - Mercury KW - FXS1BY2PGL KW - Dentistry KW - Index Medicus KW - Air Pollution, Indoor -- analysis KW - Equipment Contamination KW - Humans KW - Volatilization KW - Dental Staff KW - Dental Technicians KW - Occupational Exposure KW - Mercury -- analysis KW - Dental Equipment KW - Dental Amalgam -- chemistry UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/70586069?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxline&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+the+American+Dental+Association+%281939%29&rft.atitle=Potential+health+and+environmental+issues+of+mercury-contaminated+amalgamators.&rft.au=Roberts%2C+H+W%3BLeonard%2C+D%3BOsborne%2C+J&rft.aulast=Roberts&rft.aufirst=H&rft.date=2001-01-01&rft.volume=132&rft.issue=1&rft.spage=58&rft.isbn=&rft.btitle=&rft.title=Journal+of+the+American+Dental+Association+%281939%29&rft.issn=00028177&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date completed - 2001-02-08 N1 - Date created - 2001-01-18 N1 - Date revised - 2017-01-13 N1 - Last updated - 2017-01-18 ER - TY - JOUR T1 - 'In God We Trusted, in China We Busted': The China Commando Group of the Special Operations Executive (SOE) AN - 60593724; 200305678 AB - In summer 1941, the British Special Operations Executive (SOE) & the Chinese government began a joint intelligence & special operations project called the China Commando Group. It was meant to be a grand scheme of military operation designed to benefit both the British & the Chinese in their common objective of thwarting the aggressive Japanese advances in Asia. Yet the China Commando Group evolved into a fiasco that lasted only eight months. The demise of the China Commando Group is a story that epitomizes the complex environment in which the war was fought on the East Asian mainland. This article tells a tale of policy failures in London, a thick cloud of mutual suspicions between Britain & Nationalist China, & the chasm between colonial & nationalist mindsets that led to the bitter end of the China Commando Group. Adapted from the source document. JF - Intelligence and National Security AU - Yu, Maochun AD - US Naval Academy, Annapolis, MD Y1 - 2001/01// PY - 2001 DA - January 2001 SP - 37 EP - 60 VL - 16 IS - 4 SN - 0268-4527, 0268-4527 KW - Intelligence KW - Covert Operations KW - Security Policy KW - World War II KW - Foreign Policy KW - China KW - Great Britain KW - article KW - 9001: history and theory; political history/historiography KW - 9063: international relations; international relations UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60593724?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Intelligence+and+National+Security&rft.atitle=%27In+God+We+Trusted%2C+in+China+We+Busted%27%3A+The+China+Commando+Group+of+the+Special+Operations+Executive+%28SOE%29&rft.au=Yu%2C+Maochun&rft.aulast=Yu&rft.aufirst=Maochun&rft.date=2001-01-01&rft.volume=16&rft.issue=4&rft.spage=37&rft.isbn=&rft.btitle=&rft.title=Intelligence+and+National+Security&rft.issn=02684527&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - INNSEW N1 - SubjectsTermNotLitGenreText - Intelligence; Covert Operations; World War II; Foreign Policy; Security Policy; Great Britain; China ER - TY - JOUR T1 - The "Drug War" in Colombia: Echoes of Vietnam AN - 60527209; 200205187 AB - Under the auspices of its "war on drugs," the US has sponsored herbicide spraying of opium poppies & coca plants in Colombia. This costly strategy has failed to reduce US consumption & Colombian production, & has poisoned food crops & sickened people, despite US official insistence that glyphosate herbicides are no more toxic than table salt. US policy ignores evidence that drug treatment is the most effective way to deal with the problem of substance abuse. The author suggests a Vietnam parallel: that the failed "war on drugs" is a smokescreen for US intervention in the Colombian civil war. The focus on Colombia serves as a pretext for avoiding the real toll of American drug policy: ecological & human harm; & a US prison system with ballooning populations of drug offenders, most of whom are black males. 15 References. K. S. Coddon JF - Journal of Public Health Policy AU - Massey, Rachel AD - Environmental Research Foundation, Annapolis, MD Y1 - 2001///0, PY - 2001 DA - 0, 2001 SP - 280 EP - 285 VL - 22 IS - 3 SN - 0197-5897, 0197-5897 KW - Environmental Degradation KW - United States of America KW - International Relations KW - Foreign Policy KW - Colombia KW - Criminal Justice Policy KW - Drug Trafficking KW - Drug Abuse KW - article KW - 9063: international relations; international relations UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60527209?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awpsa&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Public+Health+Policy&rft.atitle=The+%22Drug+War%22+in+Colombia%3A+Echoes+of+Vietnam&rft.au=Massey%2C+Rachel&rft.aulast=Massey&rft.aufirst=Rachel&rft.date=2001-01-01&rft.volume=22&rft.issue=3&rft.spage=280&rft.isbn=&rft.btitle=&rft.title=Journal+of+Public+Health+Policy&rft.issn=01975897&rft_id=info:doi/ LA - English DB - Worldwide Political Science Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - JPPODK N1 - SubjectsTermNotLitGenreText - Drug Trafficking; Colombia; Drug Abuse; Foreign Policy; Criminal Justice Policy; Environmental Degradation; International Relations; United States of America ER - TY - JOUR T1 - The Contribution of the Truth and Reconciliation Commission toward the Promotion of Women's Rights in South Africa AN - 60440587; 200114450 AB - South Africa has been in the forefront of countries that articulate gender rights as vital human rights. Therefore, it came as no surprise to many observers that when the Truth & Reconciliation Commission (TRC) began hearings in 1996 to investigate human rights abuses during the apartheid era, women's stories were being neglected, & the country was getting a distorted view of the past. In response to pressure from women's organizations, the TRC held three all-women hearings in which women were encouraged to tell their own stories of human rights violations. This article highlights women's oppression during the period of review (1960-1964), the TRC's handling of gender issues, & an evaluation of the TRC's contribution toward the promotion of gender rights. 36 References. Adapted from the source document. JF - Women's Studies International Forum AU - Graybill, Lyn AD - Center Study Professional Military Ethics, US Naval Academy, Annapolis, MD Y1 - 2001/01// PY - 2001 DA - January 2001 SP - 1 EP - 10 VL - 24 IS - 1 SN - 0277-5395, 0277-5395 KW - Oppression KW - Commissions KW - Feminism KW - South Africa KW - Human Rights KW - Womens Rights KW - Apartheid KW - article KW - 0925: political sociology/interactions; sociology of political systems, politics, & power KW - 2959: feminist/gender studies; feminist studies UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/60440587?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Asocabs&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Women%27s+Studies+International+Forum&rft.atitle=The+Contribution+of+the+Truth+and+Reconciliation+Commission+toward+the+Promotion+of+Women%27s+Rights+in+South+Africa&rft.au=Graybill%2C+Lyn&rft.aulast=Graybill&rft.aufirst=Lyn&rft.date=2001-01-01&rft.volume=24&rft.issue=1&rft.spage=1&rft.isbn=&rft.btitle=&rft.title=Women%27s+Studies+International+Forum&rft.issn=02775395&rft_id=info:doi/ LA - English DB - Sociological Abstracts N1 - Date revised - 2007-04-01 N1 - Last updated - 2016-09-28 N1 - CODEN - WSINDA N1 - SubjectsTermNotLitGenreText - Womens Rights; South Africa; Apartheid; Human Rights; Feminism; Commissions; Oppression ER - TY - JOUR T1 - Geochemistry of thirteen Voronin Trough cores, Kara Sea, European Arctic; Hg and As contaminants at a 1965 timeline AN - 52286384; 2001-002717 AB - The potentially toxic elements Hg and As are found at high concentrations in surface/near-surface sediments from Arctic ocean cores collected from the Voronin Trough, Kara Sea, during 1965. The levels reach 2045 ppb for Hg and 270 ppm for As. Manganese high values (up to 1.27%) are also found in the cores" surface/near-surface sections. Other heavy metals tracked by the Arctic Monitoring and Assessment Program (e.g., Cu, Ni, Pb, Sb, Ti, Zn) have baseline concentrations in the cores. The cores average >57% clay-size and >35% silt-size in their textural composition. The elevated contents may result from anthropogenic input for Hg and As with diagenesis adding to the As concentration. Possible sources for these elements are emissions and effluents from industry such as mining and smelting operations, and burning of fossil fuels in Siberia and the Urals. When discharged into the Kara Sea from Siberian catchments, the As and Hg likely attach to charged particulate surfaces of Fe oxy/hydroxides (for As) and particulate organic matter or clay minerals (for Hg). These are transported, entrained in ocean currents or adhered to pack ice, to the Voronin Trough where they deposit according to size and specific gravity. JF - Applied Geochemistry AU - Siegel, Frederic R AU - Galasso, Jennifer J AU - Kravitz, Joseph H Y1 - 2001/01// PY - 2001 DA - January 2001 SP - 19 EP - 34 PB - Pergamon, Oxford-New York-Beijing VL - 16 IS - 1 SN - 0883-2927, 0883-2927 KW - magnesium KW - marine transport KW - cores KW - cluster analysis KW - marine sediments KW - Siberia KW - Commonwealth of Independent States KW - sediments KW - Eurasia KW - Arctic Ocean KW - particulate materials KW - Asia KW - mobility KW - geochemistry KW - heavy metals KW - mercury KW - Urals KW - concentration KW - alkaline earth metals KW - toxic materials KW - monitoring KW - pollutants KW - human activity KW - statistical analysis KW - arsenic KW - pollution KW - troughs KW - organic compounds KW - Kara Sea KW - Voronin Trough KW - metals KW - diagenesis KW - 02C:Geochemistry of rocks, soils, and sediments KW - 22:Environmental geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52286384?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Applied+Geochemistry&rft.atitle=Geochemistry+of+thirteen+Voronin+Trough+cores%2C+Kara+Sea%2C+European+Arctic%3B+Hg+and+As+contaminants+at+a+1965+timeline&rft.au=Siegel%2C+Frederic+R%3BGalasso%2C+Jennifer+J%3BKravitz%2C+Joseph+H&rft.aulast=Siegel&rft.aufirst=Frederic&rft.date=2001-01-01&rft.volume=16&rft.issue=1&rft.spage=19&rft.isbn=&rft.btitle=&rft.title=Applied+Geochemistry&rft.issn=08832927&rft_id=info:doi/10.1016%2FS0883-2927%2800%2900017-2 L2 - http://www.sciencedirect.com/science/journal/08832927 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. Reference includes data from CAPCAS, Elsevier Scientific Publishers, Amsterdam, Netherlands N1 - Date revised - 2001-01-01 N1 - Number of references - 28 N1 - Document feature - illus. incl. 2 tables, sketch maps N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - alkaline earth metals; Arctic Ocean; arsenic; Asia; cluster analysis; Commonwealth of Independent States; concentration; cores; diagenesis; Eurasia; geochemistry; heavy metals; human activity; Kara Sea; magnesium; marine sediments; marine transport; mercury; metals; mobility; monitoring; organic compounds; particulate materials; pollutants; pollution; sediments; Siberia; statistical analysis; toxic materials; troughs; Urals; Voronin Trough DO - http://dx.doi.org/10.1016/S0883-2927(00)00017-2 ER - TY - JOUR T1 - Geologic controls on the initiation of rapid basal motion for West Antarctic ice streams; a geophysical perspective including new airborne radar sounding and laser altimetry results AN - 52174627; 2001-074396 AB - The Siple Coast ice streams of the Ross Embayment are examined for the causes and initiation of rapid basal motion (RBM). Seismic and airborne geophysical observations are compatible with a model of tectonic evolution for this region that implies Cretaceous rifting with a generally quiescent mid-Cenozoic punctuated by localized volcanism. This volcanism is associated with zones of crustal weakness. From the airborne geophysical results a band of transitional ice flow that separates the internally deforming interior ice and the fully developed ice stream system characterized by RBM is identified. Four ice stream branches are defined at the down-stream limit of this ice flow. Strong correspondence exists between this zone of RBM initiation and the transitional crust lying between the cold, thick, and elevated crust of the Ellsworth/Whitmore crustal block and the warm, thin and depressed crust of the Ross Embayment. Ice stream initiation relies on the availability of mid-Cenozoic sediments on the pre-existing rift-controlled topography of the embayment and on the flanks of the surrounding crustal blocks. Geothermal gradient across this zone is potentially important as is focused geothermal flux associated with localized volcanics along the crustal block boundaries and within the Southeastern Ross Embayment. (Mod. auth. abstr.) JF - Antarctic Research Series AU - Blankenship, D D AU - Morse, D L AU - Finn, C A AU - Bell, R E AU - Peters, M E AU - Kempf, S D AU - Hodge, S M AU - Studinger, M AU - Behrendt, J C AU - Brozena, J M Y1 - 2001 PY - 2001 DA - 2001 SP - 105 EP - 121 PB - American Geophysical Union, Washington, DC VL - 77 SN - 0066-4634, 0066-4634 KW - Southern Ocean KW - West Antarctica KW - geophysical surveys KW - Ross Embayment KW - gravity anomalies KW - ice streams KW - Ross Sea KW - movement KW - West Antarctic ice sheet KW - Siple Coast KW - processes KW - rift zones KW - Antarctic Ocean KW - geophysical methods KW - radar methods KW - magnetic methods KW - altimetry KW - ice sheets KW - seismic methods KW - embayments KW - Antarctic ice sheet KW - Antarctica KW - surveys KW - Bouguer anomalies KW - glacial geology KW - remote sensing KW - airborne methods KW - 24:Quaternary geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52174627?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Antarctic+Research+Series&rft.atitle=Geologic+controls+on+the+initiation+of+rapid+basal+motion+for+West+Antarctic+ice+streams%3B+a+geophysical+perspective+including+new+airborne+radar+sounding+and+laser+altimetry+results&rft.au=Blankenship%2C+D+D%3BMorse%2C+D+L%3BFinn%2C+C+A%3BBell%2C+R+E%3BPeters%2C+M+E%3BKempf%2C+S+D%3BHodge%2C+S+M%3BStudinger%2C+M%3BBehrendt%2C+J+C%3BBrozena%2C+J+M&rft.aulast=Blankenship&rft.aufirst=D&rft.date=2001-01-01&rft.volume=77&rft.issue=&rft.spage=105&rft.isbn=9781118668320&rft.btitle=&rft.title=Antarctic+Research+Series&rft.issn=00664634&rft_id=info:doi/10.1029%2FAR077p0105 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. N1 - Date revised - 2001-01-01 N1 - Number of references - 67 N1 - PubXState - DC N1 - Document feature - illus. incl. geol. sketch maps N1 - Last updated - 2014-03-14 N1 - CODEN - ANTSA4 N1 - SubjectsTermNotLitGenreText - airborne methods; altimetry; Antarctic ice sheet; Antarctic Ocean; Antarctica; Bouguer anomalies; embayments; geophysical methods; geophysical surveys; glacial geology; gravity anomalies; ice sheets; ice streams; magnetic methods; movement; processes; radar methods; remote sensing; rift zones; Ross Embayment; Ross Sea; seismic methods; Siple Coast; Southern Ocean; surveys; West Antarctic ice sheet; West Antarctica DO - http://dx.doi.org/10.1029/AR077p0105 ER - TY - JOUR T1 - Biogeochemical consequences of macrofauna burrow ventilation AN - 52126169; 2002-029609 AB - The burrow walls created by macrofauna in aquatic sediments are sites of intense chemical mass transfer. Quantitative measurement of their significance is, however, difficult because chemistry in the immediate vicinity of burrow walls is temporally dynamic due to periodic ventilation of burrows by macrofauna. A temporally dynamic, 2D multicomponent diffusion-reaction model was utilized to depict the magnitude and time dependency of chemical mass transfer in the immediate vicinity of burrow walls as well as at the water/sediment interface. The simulation results illustrate that sediment particles, pore water, and microorganisms within a few millimeters of burrow walls experience significant oscillation in pH (as much as two pH units) and dissolved oxygen concentration (between saturation and near anoxia) whereas such oscillation is absent at the water/sediment interface. The geochemical oscillation is expected to affect the net stability of mineral phases, activities and community structures of microorganisms, and rates and magnitudes of microbial diagenetic reactions. JF - Geochemical Transactions AU - Furukawa, Yoko Y1 - 2001 PY - 2001 DA - 2001 PB - Royal Society of Chemistry, American Chemical Society, Division of Geochemistry VL - 2001 SN - 1467-4866, 1467-4866 KW - numerical models KW - numerical analysis KW - faunal studies KW - equations KW - ventilation KW - marine sediments KW - biogenic processes KW - quantitative analysis KW - diagenesis KW - sediments KW - burrows KW - mass transfer KW - aquatic environment KW - microorganisms KW - 02C:Geochemistry of rocks, soils, and sediments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52126169?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Geochemical+Transactions&rft.atitle=Biogeochemical+consequences+of+macrofauna+burrow+ventilation&rft.au=Furukawa%2C+Yoko&rft.aulast=Furukawa&rft.aufirst=Yoko&rft.date=2001-01-01&rft.volume=2001&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Geochemical+Transactions&rft.issn=14674866&rft_id=info:doi/ L2 - http://link.springer.com/journal/12932 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 35 N1 - Document feature - illus. incl. 3 tables N1 - SuppNotes - Accessed on Dec. 14, 2001 N1 - Last updated - 2014-09-18 N1 - SubjectsTermNotLitGenreText - aquatic environment; biogenic processes; burrows; diagenesis; equations; faunal studies; marine sediments; mass transfer; microorganisms; numerical analysis; numerical models; quantitative analysis; sediments; ventilation ER - TY - JOUR T1 - Quantifying terrain fabric in digital evaluation models AN - 52065057; 2002-066762 AB - Eigenvector analysis of a topographic landform reveals a directional fabric consisting of surface roughness or slope, organization or fabric strength, and preferred orientation. This analysis uses a digital elevation model (DEM) to compute slope and aspect at all points in a region and uses those values to define the normal surface. Standard techniques contour the distributions, extract eigenvectors and eigenvalues from the matrix of the sum of cross products of the directional cosines, and compute eigenvalue ratios. The terrain fabric at a point depends on the size of the region used for the computation and reveals different scales over which directional fabrics operate. With large-scale DEMs, the directional fabric varies in a systematic manner and proves relatively insensitive to the horizontal resolution of the DEM or its quality and creation method. Quantitative measurement of terrain fabric belongs in all studies of terrain analysis and geomorphometry. JF - Reviews in Engineering Geology AU - Guth, Peter L Y1 - 2001 PY - 2001 DA - 2001 SP - 13 EP - 25 PB - Geological Society of America (GSA), Boulder, CO VL - 14 SN - 0080-2018, 0080-2018 KW - methods KW - topography KW - terrains KW - military geology KW - landforms KW - eigenvalues KW - digital terrain models KW - terrain classification KW - 23:Geomorphology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52065057?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Reviews+in+Engineering+Geology&rft.atitle=Quantifying+terrain+fabric+in+digital+evaluation+models&rft.au=Guth%2C+Peter+L&rft.aulast=Guth&rft.aufirst=Peter&rft.date=2001-01-01&rft.volume=14&rft.issue=&rft.spage=13&rft.isbn=0813741149&rft.btitle=&rft.title=Reviews+in+Engineering+Geology&rft.issn=00802018&rft_id=info:doi/10.1130%2FREG14-p13 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2014, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 24 N1 - PubXState - CO N1 - Document feature - illus. incl. 6 tables N1 - Last updated - 2014-07-17 N1 - CODEN - GAEGA4 N1 - SubjectsTermNotLitGenreText - digital terrain models; eigenvalues; landforms; methods; military geology; terrain classification; terrains; topography DO - http://dx.doi.org/10.1130/REG14-p13 ER - TY - JOUR T1 - Effects of time series imagery on automated classification of coastal wetland environments using projection pursuit methods AN - 52057293; 2002-076641 AB - Using a time series of Radarsat SAR and Landsat TM imagery, we developed automated classification models for coastal land-cover in Northampton County, VA. The database consisted of three pairs of images from each sensor taken within one week of each other. We compared the results of models based on data from one set with the results based on data from all three sets for Radarsat only, Landsat only and both sensors combined. For Radarsat only, there is an increase on the order of 23-30% in the overall classification score for the three-date set compared to the one-date set. This is consistent with previous results based on different classification methods. We found a smaller increase, on the order of 1-5%, for the Landsat only. For combined sensor cases, three-date inputs did not improve results when compared with single-date inputs. For the feature extraction stage, we compared a Projection Pursuit method with Principal Component Analysis. In the final classifier stage, we compared a vector quantization algorithm, LVQ, and the backward propagation of error model with a cross-entropy cost function. The differences given above for one date versus three-date results hold for all the methods studied. Best model agreement with a National Wetlands Inventory (NWI) map was found for three-date atmospherically corrected Landsat inputs, for which generalization performance was 80.5% of pixels correct, with 86.4% obtained on the cross-validation set used to find a stopping point for model optimization, and 87.9% for the training set. JF - International Geoscience and Remote Sensing Symposium AU - Bachmann, Charles M AU - Fusina, Robert A AU - Donato, Timothy F AU - Milne, Tony AU - Cechet, Bob Y1 - 2001 PY - 2001 DA - 2001 SP - 1868 EP - 1870 PB - Institute of Electrical and Electronics Engineers, New York, NY VL - 2001, Vol. IV KW - United States KW - shore features KW - land cover KW - Virginia KW - time series analysis KW - landform evolution KW - statistical analysis KW - sedimentation KW - radar methods KW - Northampton County Virginia KW - satellite methods KW - Landsat KW - wetlands KW - classification KW - geomorphology KW - RADARSAT KW - coastal sedimentation KW - remote sensing KW - Atlantic Coastal Plain KW - 23:Geomorphology KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52057293?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Geoscience+and+Remote+Sensing+Symposium&rft.atitle=Effects+of+time+series+imagery+on+automated+classification+of+coastal+wetland+environments+using+projection+pursuit+methods&rft.au=Bachmann%2C+Charles+M%3BFusina%2C+Robert+A%3BDonato%2C+Timothy+F%3BMilne%2C+Tony%3BCechet%2C+Bob&rft.aulast=Bachmann&rft.aufirst=Charles&rft.date=2001-01-01&rft.volume=2001%2C+Vol.+IV&rft.issue=&rft.spage=1868&rft.isbn=0780370317&rft.btitle=&rft.title=International+Geoscience+and+Remote+Sensing+Symposium&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - IEEE 2001 international geoscience and remote sensing symposium N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 11 N1 - PubXState - NY N1 - Document feature - illus. incl. 3 tables N1 - Last updated - 2012-06-07 N1 - CODEN - #03424 N1 - SubjectsTermNotLitGenreText - Atlantic Coastal Plain; classification; coastal sedimentation; geomorphology; land cover; landform evolution; Landsat; Northampton County Virginia; radar methods; RADARSAT; remote sensing; satellite methods; sedimentation; shore features; statistical analysis; time series analysis; United States; Virginia; wetlands ER - TY - JOUR T1 - Analytical technique for the interpretation of measured pore pressures in shallow marine sediments AN - 52055718; 2002-074297 AB - An analytical technique has been developed for the interpretation of measured pore pressures in shallow marine sediments subjected to ocean waves. This technique involves the estimation of changes in total vertical stress within the sediments using measured normal pressure distributions at the sediment/water interface and the theory of elasticity. Changes in vertical effective stresses are inferred as the difference between the estimated total stress and the measured pore water pressure changes in accordance with Terzaghi's effective stress equation. A Visual Basic 6.0 program has been written to estimate the total stress changes at any depth in the sediments from any measured bottom pressure time history. A graphical comparison of the estimated total stress and pore water pressures identifies zones where the pore pressure measurements imply an increase or a decrease in vertical effective stress. The value of this analytical technique in understanding the measured behavior is demonstrated using pore pressure measurements from piezometers deployed in the surf zone at East Beach, Galveston, Texas and in a carefully controlled wave field in a wave tank at the Coastal Oil-Spill Simulation (COSS) facility in Corpus Christi, Texas. The results demonstrate that the measurements from these particular piezometer probes differ from expected free-field behavior most likely due to dynamic motions of the probes. JF - The Proceedings of the ... International Offshore and Polar Engineering Conference AU - Andersen, Glen R AU - Valent, Philip J AU - Gonzales, S Peter A2 - Chung, Jin S. A2 - Matsui, Tamotsu A2 - Moshagen, Hermann Y1 - 2001 PY - 2001 DA - 2001 SP - 469 EP - 475 PB - International Society of Offshore and Polar Engineers, Golden, CO VL - 11, Vol. 2 SN - 1098-6189, 1098-6189 KW - United States KW - stress KW - shorelines KW - Texas KW - techniques KW - Gulf Coastal Plain KW - analysis KW - measurement KW - Galveston Texas KW - pressuremeters KW - marine sediments KW - Galveston County Texas KW - pore pressure KW - sediments KW - East Beach KW - 30:Engineering geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52055718?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=The+Proceedings+of+the+...+International+Offshore+and+Polar+Engineering+Conference&rft.atitle=Analytical+technique+for+the+interpretation+of+measured+pore+pressures+in+shallow+marine+sediments&rft.au=Andersen%2C+Glen+R%3BValent%2C+Philip+J%3BGonzales%2C+S+Peter&rft.aulast=Andersen&rft.aufirst=Glen&rft.date=2001-01-01&rft.volume=11%2C+Vol.+2&rft.issue=&rft.spage=469&rft.isbn=1880653532&rft.btitle=&rft.title=The+Proceedings+of+the+...+International+Offshore+and+Polar+Engineering+Conference&rft.issn=10986189&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Eleventh international offshore and polar engineering conference N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 11 N1 - PubXState - CO N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - analysis; East Beach; Galveston County Texas; Galveston Texas; Gulf Coastal Plain; marine sediments; measurement; pore pressure; pressuremeters; sediments; shorelines; stress; techniques; Texas; United States ER - TY - JOUR T1 - Variability in the evolution of the Chesapeake Bay outflow plume front as observed with a real aperture radar AN - 52007751; 2003-025941 AB - In this paper, time sequences of radar imagery are presented that illustrate the spatial and temporal evolution of the Chesapeake Bay outflow plume front. These images were collected in May 1997 and May 1999 during parts 2 and 5 of the Chesapeake Bay Outflow Plume Experiment (COPE2 and COPE5, respectively). The COPE5 data set features an image sequence that spans nearly ten hours during the early-flood to maximum-ebb portion of the semidiurnal tidal cycle. The frontal evolution shown in this continuous image sequence shows a striking resemblance to that implied by a "composite" sequence from COPE2, formed by combining data from two separate flights flown on two consecutive days, indicating a high degree of reproducibility in the frontal evolution. JF - International Geoscience and Remote Sensing Symposium AU - Sletten, Mark A AU - Twarog, Elizabeth AU - Zhang, Xuehu AU - McLaughlin, D J AU - Anonymous Y1 - 2001 PY - 2001 DA - 2001 SP - 281 EP - 283 PB - Institute of Electrical and Electronics Engineers, New York, NY VL - 2001, Vol. 1 KW - United States KW - cycles KW - Northwest Atlantic KW - plumes KW - imagery KW - Chesapeake Bay KW - sea water KW - monitoring KW - surface water KW - RAR KW - radar methods KW - variations KW - measurement KW - tides KW - spatial variations KW - North Atlantic KW - estuarine environment KW - Atlantic Ocean KW - Atlantic Coastal Plain KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/52007751?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Geoscience+and+Remote+Sensing+Symposium&rft.atitle=Variability+in+the+evolution+of+the+Chesapeake+Bay+outflow+plume+front+as+observed+with+a+real+aperture+radar&rft.au=Sletten%2C+Mark+A%3BTwarog%2C+Elizabeth%3BZhang%2C+Xuehu%3BMcLaughlin%2C+D+J%3BAnonymous&rft.aulast=Sletten&rft.aufirst=Mark&rft.date=2001-01-01&rft.volume=2001%2C+Vol.+1&rft.issue=&rft.spage=281&rft.isbn=&rft.btitle=&rft.title=International+Geoscience+and+Remote+Sensing+Symposium&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - IEEE 2001 international geoscience and remote sensing symposium N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 4 N1 - PubXState - NY N1 - Document feature - illus. incl. sketch maps N1 - Last updated - 2012-06-07 N1 - CODEN - #03424 N1 - SubjectsTermNotLitGenreText - Atlantic Coastal Plain; Atlantic Ocean; Chesapeake Bay; cycles; estuarine environment; imagery; measurement; monitoring; North Atlantic; Northwest Atlantic; plumes; radar methods; RAR; sea water; spatial variations; surface water; tides; United States; variations ER - TY - JOUR T1 - Harvesting energy from the marine sediment-water interface AN - 51965958; 2003-053807 JF - Environmental Science & Technology, ES & T AU - Reimers, Clare E AU - Tender, Leonard M AU - Fertig, Stephanie AU - Wei, Wang Y1 - 2001/01// PY - 2001 DA - January 2001 SP - 192 EP - 195 PB - American Chemical Society, Washington, DC VL - 35 IS - 1 SN - 0013-936X, 0013-936X KW - experimental studies KW - electrical properties KW - sediment-water interface KW - sea water KW - monitoring KW - physicochemical properties KW - oxidation KW - electrical field KW - laboratory studies KW - physical properties KW - dissolved materials KW - marine environment KW - sediments KW - new energy sources KW - ecology KW - pore water KW - energy KW - microorganisms KW - 29A:Economic geology, geology of energy sources KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51965958?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Environmental+Science+%26+Technology%2C+ES+%26+T&rft.atitle=Harvesting+energy+from+the+marine+sediment-water+interface&rft.au=Reimers%2C+Clare+E%3BTender%2C+Leonard+M%3BFertig%2C+Stephanie%3BWei%2C+Wang&rft.aulast=Reimers&rft.aufirst=Clare&rft.date=2001-01-01&rft.volume=35&rft.issue=1&rft.spage=192&rft.isbn=&rft.btitle=&rft.title=Environmental+Science+%26+Technology%2C+ES+%26+T&rft.issn=0013936X&rft_id=info:doi/ L2 - http://pubs.acs.org/journals/esthag/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 19 N1 - PubXState - DC N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - CODEN - ESTHAG N1 - SubjectsTermNotLitGenreText - dissolved materials; ecology; electrical field; electrical properties; energy; experimental studies; laboratory studies; marine environment; microorganisms; monitoring; new energy sources; oxidation; physical properties; physicochemical properties; pore water; sea water; sediment-water interface; sediments ER - TY - JOUR T1 - Texture, mineralogy, and petrophysical properties of geopressured shales, Gulf of Mexico AN - 51942113; 2003-066258 AB - Geopressured shale samples from wells located offshore Louisiana, Gulf of Mexico were examined by scanning electron microscopy (SEM), and compared with well-log analysis to study the characteristics of fabrics, fractures, and changes in porosity and permeability caused by high fluid pressures. Well logs from this study area including neutron-density, conductivity and sonic logs show features typical of a geopressured zone at a depth of 2200 m. The active smectite-to-illite transition zone indicated by changes in CEC and total K also corresponds to the top of the geopressured zone. Geopressured shales with increasing burial depth become more illitic, better oriented, and less porous; they show a significant decrease in permeability and a rise in the fluid pressure gradient. The shale compaction curve as a function of burial depth was used to determine the maximum sealing depth for hydrocarbon. In this study shales effectively seal above 2400-m depth with the maximum sealing depth of 1260 m. Shales undergo slow-drained compaction down to 2400 m while below 2400-m depth shales undergo drained compaction and fractures begin to develop. JF - Transactions - Gulf Coast Association of Geological Societies AU - Kim, Jin-wook AU - Berg, Robert R AU - Watkins, Joel AU - Tieh, Thomas T A2 - Roberts, Michael T. A2 - Barrett, Mary L. A2 - Czerniakowski, Lana Y1 - 2001 PY - 2001 DA - 2001 SP - 161 EP - 172 PB - Gulf Coast Association of Geological Societies, New Orleans, LA VL - 51 SN - 0533-6562, 0533-6562 KW - United States KW - petroleum exploration KW - offshore KW - shale KW - well-logging KW - petroleum KW - Gulf Coastal Plain KW - Gulf of Mexico KW - reservoir rocks KW - sedimentary rocks KW - acoustical logging KW - Louisiana KW - North Atlantic KW - clastic rocks KW - SEM data KW - Atlantic Ocean KW - 29A:Economic geology, geology of energy sources UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51942113?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Transactions+-+Gulf+Coast+Association+of+Geological+Societies&rft.atitle=Texture%2C+mineralogy%2C+and+petrophysical+properties+of+geopressured+shales%2C+Gulf+of+Mexico&rft.au=Kim%2C+Jin-wook%3BBerg%2C+Robert+R%3BWatkins%2C+Joel%3BTieh%2C+Thomas+T&rft.aulast=Kim&rft.aufirst=Jin-wook&rft.date=2001-01-01&rft.volume=51&rft.issue=&rft.spage=161&rft.isbn=&rft.btitle=&rft.title=Transactions+-+Gulf+Coast+Association+of+Geological+Societies&rft.issn=05336562&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - 51st annual convention of the Gulf Coast Association of Geological Societies, American Association of Petroleum Geologists regional meeting and the 48th annual convention of the Society of Economic Paleontologists and Mineralogists N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 34 N1 - PubXState - LA N1 - Document feature - illus. incl. 4 tables N1 - Last updated - 2012-06-07 N1 - CODEN - TGCGA9 N1 - SubjectsTermNotLitGenreText - acoustical logging; Atlantic Ocean; clastic rocks; Gulf Coastal Plain; Gulf of Mexico; Louisiana; North Atlantic; offshore; petroleum; petroleum exploration; reservoir rocks; sedimentary rocks; SEM data; shale; United States; well-logging ER - TY - JOUR T1 - Wave runup, extreme water levels and the erosion of properties backing beaches AN - 51811011; 2004-065057 AB - A model has been developed to evaluate the susceptibility of coastal properties to wave induced erosion. The model includes analyses of the probabilities of extreme water levels due to tides affected by various oceanographic and atmospheric processes, and the runup elevations of storm waves on beaches. The application is to the Oregon coast where measured tides often exceed predicted astronomical tides by tens of centimeters, especially during the occurrence of an El Nino. The measurements of wave runup on dissipative beaches typical of the Oregon coast depend primarily on the deep-water significant wave height, but when combined with other data sets show some dependence on the wave period and beach slope. Predicted extreme water elevations due to the combined processes are compared with measured elevations of the junctions between the beach face and the toe of foredunes or sea cliffs. The objective is to evaluate the frequency with which water can reach the property, providing an evaluation of the susceptibility to potential erosion. Application is made to a number of sites along the Oregon coast, revealing differences between the various littoral cells depending on the quantity of sand on the beach and its capacity to act as a buffer from wave attack. A more detailed application is made to the Newport Littoral Cell, demonstrating how this type of analysis can aid in making coastal management decisions. Although the application here is to the Oregon coast, the model can be used on other coastlines with evaluations of extreme tides and storm-wave runup specific to those locations. JF - Journal of Coastal Research AU - Ruggiero, Peter AU - Komar, Paul D AU - McDougal, William G AU - Marra, John J AU - Beach, Reggie A Y1 - 2001 PY - 2001 DA - 2001 SP - 407 EP - 419 PB - Coastal Education and Research Foundation (CERF), Fort Lauderdale, FL VL - 17 IS - 2 SN - 0749-0208, 0749-0208 KW - United States KW - Iribarren number KW - ocean circulation KW - erosion KW - video methods KW - landform evolution KW - elevation KW - statistical analysis KW - prediction KW - simulation KW - tides KW - models KW - Oregon KW - beaches KW - marine environment KW - El Nino KW - ocean waves KW - coastal environment KW - risk assessment KW - beach profiles KW - storms KW - littoral erosion KW - regression analysis KW - 23:Geomorphology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51811011?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Coastal+Research&rft.atitle=Wave+runup%2C+extreme+water+levels+and+the+erosion+of+properties+backing+beaches&rft.au=Ruggiero%2C+Peter%3BKomar%2C+Paul+D%3BMcDougal%2C+William+G%3BMarra%2C+John+J%3BBeach%2C+Reggie+A&rft.aulast=Ruggiero&rft.aufirst=Peter&rft.date=2001-01-01&rft.volume=17&rft.issue=2&rft.spage=407&rft.isbn=&rft.btitle=&rft.title=Journal+of+Coastal+Research&rft.issn=07490208&rft_id=info:doi/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2004-01-01 N1 - Number of references - 35 N1 - PubXState - FL N1 - Document feature - illus. incl. 3 tables N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - beach profiles; beaches; coastal environment; El Nino; elevation; erosion; Iribarren number; landform evolution; littoral erosion; marine environment; models; ocean circulation; ocean waves; Oregon; prediction; regression analysis; risk assessment; simulation; statistical analysis; storms; tides; United States; video methods ER - TY - JOUR T1 - Scientific visualization of sediment dynamics in the bottom boundary layer AN - 51801992; 2004-071684 AB - This paper discusses scientific visualization as a program development took and as a tool for understanding the sediment dynamics of the marine bottom boundary layer (MBBL). Understanding the MBBL is important for predicting the optical characteristics of the coastal ocean, which are dependent on an accurate prescription of the suspended sediment concentration (SSC). Traditional methods of analyzing the MBBL include profiles, cross-sections, map views along equal water depths, and time series, which must be examined manually by the scientist. More complex data visualization is available using products like X-Vision, which allow data probing in 2D, plotting isosurfaces, overlaying variables onto other variable projections, and interactive data analysis using traditional 1D and 2D plots. C thru Generation 2 (CG2) is representative of the next-generation of interactive immersive data visualization systems. CG2 smoothly transitions between the large scale necessary to understand the marine environment and the detailed view necessary to analyze the MBBL. CG2 also incorporates visual data probing as well as traditional methods like numerical tables. Communicating with non-scientists is further assisted by visualization techniques that utilize simulators like the Generic Lidar Model, which simulates the performance of laser-based imaging systems in the ocean using predicted SSC distributions. JF - Estuarine and Coastal Modeling. Proceedings of the ... International Conference AU - Keen, Timothy R AU - Vickery, Rhonda AU - Flynn, Peter AU - Stavn, Robert AU - McBride, Walton A2 - Spaulding, Malcolm L. Y1 - 2001 PY - 2001 DA - 2001 SP - 71 EP - 85 PB - ASCE American Society of Civil Engineers, New York, NY VL - 7 KW - United States KW - sediment-water interface KW - suspended materials KW - simulation KW - marine sedimentation KW - observations KW - California KW - visualization KW - size distribution KW - San Diego County California KW - dynamics KW - boundary layer KW - currents KW - concentration KW - numerical models KW - three-dimensional models KW - sediment transport KW - grain size KW - sedimentation KW - Oceanside California KW - ocean currents KW - marine environment KW - ocean waves KW - coastal environment KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51801992?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Estuarine+and+Coastal+Modeling.+Proceedings+of+the+...+International+Conference&rft.atitle=Scientific+visualization+of+sediment+dynamics+in+the+bottom+boundary+layer&rft.au=Keen%2C+Timothy+R%3BVickery%2C+Rhonda%3BFlynn%2C+Peter%3BStavn%2C+Robert%3BMcBride%2C+Walton&rft.aulast=Keen&rft.aufirst=Timothy&rft.date=2001-01-01&rft.volume=7&rft.issue=&rft.spage=71&rft.isbn=&rft.btitle=&rft.title=Estuarine+and+Coastal+Modeling.+Proceedings+of+the+...+International+Conference&rft.issn=&rft_id=info:doi/ LA - English DB - GeoRef N1 - Conference title - Seventh international conference on Estuarine and coastal modeling N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2004-01-01 N1 - Number of references - 20 N1 - PubXState - NY N1 - Document feature - illus. incl. sketch map N1 - Last updated - 2012-06-07 N1 - CODEN - #03869 N1 - SubjectsTermNotLitGenreText - boundary layer; California; coastal environment; concentration; currents; dynamics; grain size; marine environment; marine sedimentation; numerical models; observations; ocean currents; ocean waves; Oceanside California; San Diego County California; sediment transport; sediment-water interface; sedimentation; simulation; size distribution; suspended materials; three-dimensional models; United States; visualization ER - TY - JOUR T1 - The role of the Spitsbergen shear zone in determining morphology, segmentation and evolution of the Knipovich Ridge AN - 51523939; 2006-088928 JF - Marine Geophysical Researches AU - Crane, Kathleen AU - Doss, Hany AU - Vogt, Peter AU - Sundvor, Eirik AU - Cherkashov, Georgy AU - Poroshina, Irina AU - Joseph, Devorah Y1 - 2001 PY - 2001 DA - 2001 SP - 153 EP - 205 PB - Springer, Dordrecht VL - 22 IS - 3 SN - 0025-3235, 0025-3235 KW - Knipovich Ridge KW - Svalbard KW - mantle KW - segmentation KW - Spitsbergen KW - Norwegian Sea KW - rifting KW - gravity anomalies KW - Mohns Ridge KW - sea-floor spreading KW - Arctic Ocean KW - faults KW - shear zones KW - SeaMarc KW - rift zones KW - lithosphere KW - Arctic region KW - Jan Mayen Ridge KW - geophysical methods KW - magnetic anomalies KW - decollement KW - Spitsbergen shear zone KW - fracture zones KW - plate tectonics KW - reconstruction KW - bathymetry KW - Molloy Transform KW - 18:Solid-earth geophysics KW - 20:Applied geophysics UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/51523939?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Marine+Geophysical+Researches&rft.atitle=The+role+of+the+Spitsbergen+shear+zone+in+determining+morphology%2C+segmentation+and+evolution+of+the+Knipovich+Ridge&rft.au=Crane%2C+Kathleen%3BDoss%2C+Hany%3BVogt%2C+Peter%3BSundvor%2C+Eirik%3BCherkashov%2C+Georgy%3BPoroshina%2C+Irina%3BJoseph%2C+Devorah&rft.aulast=Crane&rft.aufirst=Kathleen&rft.date=2001-01-01&rft.volume=22&rft.issue=3&rft.spage=153&rft.isbn=&rft.btitle=&rft.title=Marine+Geophysical+Researches&rft.issn=00253235&rft_id=info:doi/ L2 - http://www.ingentaconnect.com/content/klu/mari LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2006-01-01 N1 - Number of references - 94 N1 - Document feature - illus. incl. geol. sketch maps, 3 tables, sects. N1 - Last updated - 2012-06-07 N1 - CODEN - MGYRA7 N1 - SubjectsTermNotLitGenreText - Arctic Ocean; Arctic region; bathymetry; decollement; faults; fracture zones; geophysical methods; gravity anomalies; Jan Mayen Ridge; Knipovich Ridge; lithosphere; magnetic anomalies; mantle; Mohns Ridge; Molloy Transform; Norwegian Sea; plate tectonics; reconstruction; rift zones; rifting; sea-floor spreading; SeaMarc; segmentation; shear zones; Spitsbergen; Spitsbergen shear zone; Svalbard ER - TY - JOUR T1 - Mineralogical biosignatures and the search for life on Mars AN - 50293417; 2003-081760 JF - Astrobiology AU - Banfield, Jillian F AU - Moreau, John W AU - Chan, Clara S AU - Welch, Susan A AU - Little, Brenda Y1 - 2001 PY - 2001 DA - 2001 SP - 447 EP - 465 PB - Mary Ann Liebert, Larchmont, NY VL - 1 IS - 4 SN - 1531-1074, 1531-1074 KW - cycles KW - biomineralization KW - oxidation KW - astrobiology KW - Mars KW - biologic evolution KW - concepts KW - TEM data KW - iron KW - exploration KW - terrestrial planets KW - planets KW - metals KW - sulfur KW - SEM data KW - microorganisms KW - 04:Extraterrestrial geology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50293417?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Astrobiology&rft.atitle=Mineralogical+biosignatures+and+the+search+for+life+on+Mars&rft.au=Banfield%2C+Jillian+F%3BMoreau%2C+John+W%3BChan%2C+Clara+S%3BWelch%2C+Susan+A%3BLittle%2C+Brenda&rft.aulast=Banfield&rft.aufirst=Jillian&rft.date=2001-01-01&rft.volume=1&rft.issue=4&rft.spage=447&rft.isbn=&rft.btitle=&rft.title=Astrobiology&rft.issn=15311074&rft_id=info:doi/ L2 - http://www.liebertpub.com/publication.aspx?pub_id=99 LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2003-01-01 N1 - Number of references - 101 N1 - PubXState - NY N1 - Document feature - illus. N1 - Last updated - 2012-06-07 N1 - SubjectsTermNotLitGenreText - astrobiology; biologic evolution; biomineralization; concepts; cycles; exploration; iron; Mars; metals; microorganisms; oxidation; planets; SEM data; sulfur; TEM data; terrestrial planets ER - TY - JOUR T1 - Mud volcanoes revealed and sampled on the western Moroccan continental margin AN - 50156346; 2002-029043 AB - We surveyed and sampled two active and 3 inactive mud volcanoes on the Atlantic continental margin of Morocco. The active mud volcanoes (named Yuma and Ginsburg) are each about 4 km in diameter, rise between 150-250 meters above the seafloor and are the first active methane-related mud volcanoes to be identified in this region. The inactive volcanoes range in diameter from 1 - 3 km, with relief between 50 and 80 meters. Gravity cores from the crest of the active mud volcanoes yielded methane hydrates and mud breccia deposits. Chemosynthetic communities of Pogonophora worms and the bivalve Solemya were found on the surface of the active mud volcanoes. Sediment cores from the inactive volcanoes contained hemipelagic sediments, rich in foraminifera and ahermatypic coral debris, overlying mud breccia Copyright 2001 by the American Geophysical Union. JF - Geophysical Research Letters AU - Gardner, Joan M Y1 - 2001/01// PY - 2001 DA - January 2001 SP - 339 EP - 342 PB - American Geophysical Union, Washington, DC VL - 28 IS - 2 SN - 0094-8276, 0094-8276 KW - diapirs KW - continental margin KW - Morocco KW - North Africa KW - Vermes KW - Solemya KW - Pogonophora KW - Seabeam KW - Bivalvia KW - side-scanning methods KW - Invertebrata KW - Africa KW - Mollusca KW - Gulf of Cadiz KW - bathymetry KW - ocean floors KW - North Atlantic KW - chemosynthesis KW - Atlantic Ocean KW - mud volcanoes KW - 07:Oceanography UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/50156346?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ageorefmodule&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Geophysical+Research+Letters&rft.atitle=Mud+volcanoes+revealed+and+sampled+on+the+western+Moroccan+continental+margin&rft.au=Gardner%2C+Joan+M&rft.aulast=Gardner&rft.aufirst=Joan&rft.date=2001-01-01&rft.volume=28&rft.issue=2&rft.spage=339&rft.isbn=&rft.btitle=&rft.title=Geophysical+Research+Letters&rft.issn=00948276&rft_id=info:doi/10.1029%2F2000GL012141 L2 - http://www.agu.org/journals/gl/ LA - English DB - GeoRef N1 - Copyright - GeoRef, Copyright 2012, American Geosciences Institute. N1 - Date revised - 2002-01-01 N1 - Number of references - 16 N1 - PubXState - DC N1 - Document feature - illus. incl. geol. sketch map, sect. N1 - Last updated - 2012-06-07 N1 - CODEN - GPRLAJ N1 - SubjectsTermNotLitGenreText - Africa; Atlantic Ocean; bathymetry; Bivalvia; chemosynthesis; continental margin; diapirs; Gulf of Cadiz; Invertebrata; Mollusca; Morocco; mud volcanoes; North Africa; North Atlantic; ocean floors; Pogonophora; Seabeam; side-scanning methods; Solemya; Vermes DO - http://dx.doi.org/10.1029/2000GL012141 ER - TY - JOUR T1 - East meets west: human rights and democracy in East Asia AN - 36909623; 3561301 JF - Millennium AU - Bell, Daniel AU - Wrage, Stephen AU - Wrage, Stephen AD - United States Naval Academy Y1 - 2001/01// PY - 2001 DA - Jan 2001 SP - 143 EP - 144 PB - Princeton University Press VL - 30 IS - 1 SN - 0305-8298, 0305-8298 KW - Political Science KW - Human rights KW - East Asia KW - Communitarianism KW - East-West relations KW - Democracy KW - Cultural values UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/36909623?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aibss&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=unknown&rft.jtitle=Millennium&rft.atitle=East+meets+west%3A+human+rights+and+democracy+in+East+Asia&rft.au=Bell%2C+Daniel%3BWrage%2C+Stephen&rft.aulast=Bell&rft.aufirst=Daniel&rft.date=2001-01-01&rft.volume=30&rft.issue=1&rft.spage=143&rft.isbn=&rft.btitle=&rft.title=Millennium&rft.issn=03058298&rft_id=info:doi/10.1177%2F03058298010300010203 LA - English DB - International Bibliography of the Social Sciences (IBSS) N1 - Date revised - 2013-06-12 N1 - Last updated - 2013-09-16 N1 - SubjectsTermNotLitGenreText - 6103 11032 9705; 3390 9705; 3840 6784; 3196 13245 8281 6085; 2602 2491 5676; 116 30 DO - http://dx.doi.org/10.1177/03058298010300010203 ER - TY - JOUR T1 - Effects of Oxygenation on Hydrocarbon Biodegradation in a Hypoxic Environment AN - 19429355; 5212975 AB - In 1984, an underground storage tank leaked approximately 41,000 L of gasoline into the ground water at the Naval Construction Battalion Command in Port Hueneme, CA (USA). Benzene, toluene, ethylbenzene, and xylenes (BTEX) contamination stimulated remedial action. In 1995, a ground water circulation well (GCW) and network of surrounding monitoring wells were installed. After year of operation, dissolved oxygen and nitrate concentrations remained low in all monitoring wells. Benzene utilization (the sum of respiration, uptake, and conversion to polar compounds) ranged from 0.03 to 4.6 mu g L super(-1) h super(-1), and toluene utilization ranged from 0.01 to 5.2 mu g L super(-1) h super(-1). Heterotrophic bacterial productivity (total carbon assimilation) increased dramatically in the GCW, although benzene and toluene utilization decreased markedly relative to surrounding wells. Benzene and toluene uptake accounted for a significant proportion (mean = 22%) of the heterotrophic bacterial productivity except within the GCW, indicating other fuel contaminant or indigenous organic carbon and not BTEX compounds served as primary carbon source. The GCW effectively air-stripped BTEX compounds, but failed to stimulate benzene and toluene biodegradation and thus would not be effective for stimulating BTEX bioremediation under current deployment parameters. Air stripping was three orders of magnitude more effective than biodegradation for removing benzene and toluene in the GCW. JF - Bioremediation Journal AU - Boyd, T J AU - Montgomery, M T AU - Spargo, B J AU - Smith, D C AU - Coffin, R B AU - Kelley, CA AU - Mueller, J G AD - Naval Research Laboratory, Code 6115, 4555 Overlook Avenue, Washington, DC 20375, USA, tboyd@ccf.nrl.navy.mil Y1 - 2001 PY - 2001 DA - 2001 SP - 145 EP - 157 VL - 5 IS - 2 SN - 1088-9868, 1088-9868 KW - ethyl benzene KW - Microbiology Abstracts B: Bacteriology; Biotechnology and Bioengineering Abstracts; Pollution Abstracts; Microbiology Abstracts A: Industrial & Applied Microbiology KW - Nitrate KW - Bioremediation KW - Biodegradation KW - Contamination KW - Gasoline KW - Fuels KW - Toluene KW - Respiration KW - Carbon sources KW - Dissolved oxygen KW - Benzene KW - Xylene KW - Ground water KW - Hydrocarbons KW - Oxygenation KW - benzene KW - Underground storage tanks KW - Hypoxia KW - Groundwater pollution KW - Heterotrophic bacteria KW - Ethylbenzene KW - Contaminants KW - W 30950:Waste Treatment & Pollution Clean-up KW - A 01063:Utilization KW - P 2000:FRESHWATER POLLUTION KW - J 02320:Cell Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/19429355?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Amicrobiologyb&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Bioremediation+Journal&rft.atitle=Effects+of+Oxygenation+on+Hydrocarbon+Biodegradation+in+a+Hypoxic+Environment&rft.au=Boyd%2C+T+J%3BMontgomery%2C+M+T%3BSpargo%2C+B+J%3BSmith%2C+D+C%3BCoffin%2C+R+B%3BKelley%2C+CA%3BMueller%2C+J+G&rft.aulast=Boyd&rft.aufirst=T&rft.date=2001-01-01&rft.volume=5&rft.issue=2&rft.spage=145&rft.isbn=&rft.btitle=&rft.title=Bioremediation+Journal&rft.issn=10889868&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2001-12-01 N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Nitrate; Biodegradation; Bioremediation; Contamination; Hydrocarbons; Gasoline; Respiration; Toluene; Fuels; Oxygenation; Carbon sources; Benzene; Dissolved oxygen; Hypoxia; Ground water; Heterotrophic bacteria; Ethylbenzene; Contaminants; Underground storage tanks; Xylene; Groundwater pollution; benzene ER - TY - JOUR T1 - Using Ternary Diagrams to Characterize Biodegradation and Hydrophobic Sorption of Chlorinated Ethenes in Groundwater AN - 19424660; 5350836 AB - Ternary diagrams are a useful and inexpensive approach to evaluate whether biodegradation, retardation by hydrophobic sorption, or hydrodynamic dispersion causes concentrations of dissolved chlorinated solvents in groundwater to decrease with distance or time along a flow path from a continuous source. The results of a series of analytical, 1-dimensional simulations of chlorinated ethene transport and fate were coupled with case studies to show that the proportions of PCE-TCE-DCE or TCE-DCE-VC concentrations in groundwater will 1) plot at nearly the same location at the source if concentrations only decrease by mixing caused by hydrodynamic dispersion 2) under hydrophobic sorption initially trend with distance from the source position on a ternary diagram to the TCE-DCE or DCE-VC limb, respectively and then move along the limb to the least halogenated member and 3) trend in an arcuate pattern from the source position towards the least halogenated member if biodegradation occurs. JF - Journal of Environmental Hydrology AU - Erbe, M W AU - Siegel, DI AD - Environmental Resources Management, Inc., 2666 Riva Road, Suite 200, Annapolis, MD 21401, USA, matthew_erbe@erm.com Y1 - 2001 PY - 2001 DA - 2001 VL - 9 SN - 1058-3912, 1058-3912 KW - dichloroethene KW - dispersion KW - ethene KW - perchloroethene KW - tetrachloroethene KW - Microbiology Abstracts A: Industrial & Applied Microbiology; Biotechnology and Bioengineering Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Pollution Abstracts; Water Resources Abstracts KW - Biodegradation KW - Hydrodynamics KW - Path of Pollutants KW - Pollution dispersion KW - Groundwater Pollution KW - Hydrophobicity KW - Spatial Distribution KW - Mixing KW - Mathematical Studies KW - Ground water KW - Hydrology KW - Sorption KW - Fate of Pollutants KW - Solvents KW - Simulation KW - Graphical Analysis KW - Limbs KW - Groundwater pollution KW - Groundwater KW - Dispersion KW - Q5 08503:Characteristics, behavior and fate KW - W 30950:Waste Treatment & Pollution Clean-up KW - A 01450:Environmental Pollution & Waste Treatment KW - P 2000:FRESHWATER POLLUTION KW - SW 3020:Sources and fate of pollution UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/19424660?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Environmental+Hydrology&rft.atitle=Using+Ternary+Diagrams+to+Characterize+Biodegradation+and+Hydrophobic+Sorption+of+Chlorinated+Ethenes+in+Groundwater&rft.au=Erbe%2C+M+W%3BSiegel%2C+DI&rft.aulast=Erbe&rft.aufirst=M&rft.date=2001-01-01&rft.volume=9&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=Journal+of+Environmental+Hydrology&rft.issn=10583912&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-07-01 N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Sorption; Biodegradation; Hydrology; Groundwater pollution; Dispersion; Limbs; Hydrodynamics; ethene; Solvents; Ground water; Hydrophobicity; Pollution dispersion; Groundwater; Mathematical Studies; Path of Pollutants; Fate of Pollutants; Simulation; Groundwater Pollution; Graphical Analysis; Spatial Distribution; Mixing ER - TY - JOUR T1 - Haiti: Absence of dengue hemorrhagic fever despite hyperendemic dengue virus transmission AN - 18252811; 5309852 AB - In 1994-1996, 185 strains of dengue (DEN) virus types 1, 2, and 4 were recovered from febrile United States and other United Nations military personnel in Haiti. We wondered whether risk factors for dengue hemorrhagic fever (DHF) existed and, if so, were DHF cases occurring among Haitian children. Dengue transmission rates were studied in 210 school children (6-13 years old) resident in Carrefour Borough, Port-au-Prince, Haiti. When sera were tested for plaque-reduction neutralizing antibodies to DEN 1-4 viruses, nearly 85% had antibodies to two or more DEN serotypes. The annual transmission rate was estimated at 30%, a rate observed in countries endemic for DHF. Haitian DEN 2 isolates were genotype I, which are repeatedly associated with DHF cases in Southeast Asia and American regions. Despite positive virologic pre-conditions, DHF cases were not recorded by experienced Port-au-Prince pediatricians. These observations, which are reminiscent of those in Africa, provide further evidence of a dengue resistance gene in black populations. JF - American Journal of Tropical Medicine and Hygiene AU - Halstead, S B AU - Streit, T G AU - Lafontant, J G AU - Putvatana, R AU - Russell, K AU - Sun, W AU - Kanesa-Thasan, N AU - Hayes, C G AU - Watts, D M AD - Medical Science and Technology Division, Office of Naval Research, Arlington, Virginia, USA Y1 - 2001 PY - 2001 DA - 2001 SP - 180 EP - 183 VL - 65 IS - 3 SN - 0002-9637, 0002-9637 KW - disease resistance KW - Health & Safety Science Abstracts; Virology & AIDS Abstracts KW - Risk assessment KW - Dengue virus 2 KW - Dengue virus 1 KW - Dengue virus 4 KW - Dengue virus 3 KW - Disease resistance KW - Children KW - Haiti KW - Antibodies KW - Dengue hemorrhagic fever KW - Serum KW - Risk factors KW - V 22123:Epidemiology KW - H 11000:Diseases/Injuries/Trauma UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18252811?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=American+Journal+of+Tropical+Medicine+and+Hygiene&rft.atitle=Haiti%3A+Absence+of+dengue+hemorrhagic+fever+despite+hyperendemic+dengue+virus+transmission&rft.au=Halstead%2C+S+B%3BStreit%2C+T+G%3BLafontant%2C+J+G%3BPutvatana%2C+R%3BRussell%2C+K%3BSun%2C+W%3BKanesa-Thasan%2C+N%3BHayes%2C+C+G%3BWatts%2C+D+M&rft.aulast=Halstead&rft.aufirst=S&rft.date=2001-01-01&rft.volume=65&rft.issue=3&rft.spage=180&rft.isbn=&rft.btitle=&rft.title=American+Journal+of+Tropical+Medicine+and+Hygiene&rft.issn=00029637&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Dengue virus 1; Dengue virus 2; Dengue virus 3; Dengue virus 4; Haiti; Children; Risk assessment; Dengue hemorrhagic fever; Risk factors; Serum; Antibodies; Disease resistance ER - TY - JOUR T1 - An actuarial method for estimating the long-term, incidence-based costs of Navy civilian occupational injuries and illnesses AN - 18246764; 5305361 AB - Problem: Federal agencies primarily depend on summary figures presented in their annual workers' compensation bill to assess current safety and cost containment efforts at their facilities. These figures represent payments for a mix of active cases originating in different prior accident years and can confound this assessment. Method: An incidence-based approach can be used to analyze data in a manner reflecting contemporary rather than historical losses. We describe such an approach -- an actuarial method developed for the U.S. Navy to estimate the long-term costs associated with civilian workforce injuries and illnesses sustained at Navy facilities. To project costs, we reorganized case records by accident year to provide payment histories, then applied a series of actuarial models similar to those used in the insurance industry to project future payments. Discussion: A review of incidence-based methods and the "bottom-up" analytical approach employed for this project is presented. We outline the procedures used to build the database, establish accident year cohorts, classify cases, and develop the projection factors necessary to project long-term costs. Impact on Government and Industry: While an incidence-based approach can be considerably more labor intensive than its prevalence-based counterpart, important benefits accrue from having accurate cost information available. Substantial savings are possible if serious cases can be prevented or identified early enough to permit effective use of intervention strategies such as return-to-work or light-duty assignments. With this approach, organizations can isolate current from historical losses to support fiscal responsibility and accountability, and a full spectrum of cost containment strategies. JF - Journal of Safety Research AU - Freeman, K AU - LaFleur, B J AU - Booth, J AU - Doyle, E J AU - Pugh, WM AD - Naval Health Research Center, P.O. Box 85122, San Diego, CA 92186-5122, USA, freeman@nhrc.navy.mil Y1 - 2001 PY - 2001 DA - 2001 SP - 289 EP - 297 VL - 32 IS - 3 SN - 0022-4375, 0022-4375 KW - workers' compensation KW - Health & Safety Science Abstracts KW - Injuries KW - Economics KW - Occupational safety KW - Military KW - Occupational health KW - H 1000:Occupational Safety and Health UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18246764?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Safety+Research&rft.atitle=An+actuarial+method+for+estimating+the+long-term%2C+incidence-based+costs+of+Navy+civilian+occupational+injuries+and+illnesses&rft.au=Freeman%2C+K%3BLaFleur%2C+B+J%3BBooth%2C+J%3BDoyle%2C+E+J%3BPugh%2C+WM&rft.aulast=Freeman&rft.aufirst=K&rft.date=2001-01-01&rft.volume=32&rft.issue=3&rft.spage=289&rft.isbn=&rft.btitle=&rft.title=Journal+of+Safety+Research&rft.issn=00224375&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-14 N1 - SubjectsTermNotLitGenreText - Injuries; Occupational safety; Occupational health; Economics; Military ER - TY - JOUR T1 - Why federal agencies should estimate their long-term occupational injury and illness costs AN - 18244546; 5305360 AB - Problem: The U.S. government's annual workers' compensation tab for work-related injuries and illnesses incurred by its civilian labor force has been substantial, totaling US$2 billion in 2000. To control these costs, federal agencies rely primarily on annual or prevalence-based cost accounting to evaluate the effectiveness of injury prevention efforts. Since most of the annual bill is for the older, persistent and costlier cases, this approach may obscure recent safety trends and can lead to faulty assumptions. Solution: Researchers analyzed Department of the Navy workers' compensation costs using an incidence-based approach. This method considers only new injuries and illnesses occurring in a given year and projects their likely course, duration, and long-term associated costs, providing the truest measure of the costs of that year's operation. Discussion: We trace the history of workers' compensation cost estimation in the federal government, discuss the drawbacks of using annual instead of projected long-term costs to evaluate work site prevention and control efforts, present health economics and insurance industry alternatives, and make a case for adopting an incidence approach. Impact on Government and Industry: The incidence approach promotes fiscal accountability and cost containment in both public and private sectors, allowing managers to accurately evaluate the impact of prevention and return-to-work programs. By identifying the actual costs of new mishaps, this technique allows organiations to hold managers accountable for the costs incurred specifically during their tenure and is the most suitable technique for assessing performance. JF - Journal of Safety Research AU - Freeman, K AU - LaFleur, B J AU - Booth, J AU - Doyle, E J AU - Pugh, WM AD - Naval Health Research Center, P.O. Box 85122, San Diego, CA 92186-5122, USA, freeman@nhrc.navy.mil Y1 - 2001 PY - 2001 DA - 2001 SP - 277 EP - 287 VL - 32 IS - 3 SN - 0022-4375, 0022-4375 KW - federal agencies KW - workers' compensation KW - Health & Safety Science Abstracts KW - Injuries KW - Occupational safety KW - Accidents KW - USA KW - Economics KW - Occupational health KW - Government agencies KW - H 1000:Occupational Safety and Health UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18244546?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Ahealthsafetyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Safety+Research&rft.atitle=Why+federal+agencies+should+estimate+their+long-term+occupational+injury+and+illness+costs&rft.au=Freeman%2C+K%3BLaFleur%2C+B+J%3BBooth%2C+J%3BDoyle%2C+E+J%3BPugh%2C+WM&rft.aulast=Freeman&rft.aufirst=K&rft.date=2001-01-01&rft.volume=32&rft.issue=3&rft.spage=277&rft.isbn=&rft.btitle=&rft.title=Journal+of+Safety+Research&rft.issn=00224375&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-14 N1 - SubjectsTermNotLitGenreText - USA; Government agencies; Economics; Occupational health; Occupational safety; Injuries; Accidents ER - TY - JOUR T1 - Absorption, Scattering, and Remote-Sensing Reflectance Relationships in Coastal Waters: Testing a New Inversion Algorithm AN - 18082577; 5155459 AB - In-water absorption and scattering coefficients, and above-water remote-sensing reflectance are tightly linked and, in coastal waters, exhibit unique spectral characteristics at near-infrared wavelengths. The surface-reflectance is uncoupled from the total, measured reflectance, the corrected remote sensing reflectance is calculated by difference, then the absorption and scattering coefficients are estimated using a new inversion algorithm. The surface correction and inversion algorithms are based on a reflectance difference at 715-735 nm. At these wavelengths, total absorption is due primarily to pure water absorption, and the reflected sky/cloud light and backscattering spectra are nearly flat. Required algorithm parameters, and ultimately the corrected remote sensing reflectance spectra and spectral absorption and scattering estimates, can be refined if in situ measurements of absorption at 412 nm and spectral scattering shape are available. The coupled surface correction/inversion algorithms were tested using data from 14 experiments at five U.S. coastal locations collected over a three-year period and representing a variety of absorption and scattering regimes. The average errors between measured and modeled absorption and scattering coefficients over the 400-700 nm wavelength range were 14.6% and 3.0%, respectively (without regard to sign). JF - Journal of Coastal Research AU - Gould, RW Jr AU - Arnone, R A AU - Sydor, M AD - Naval Research Laboratory, Remote Sensing Applications Branch, Code 7343, Stennis Space Center, MS 39529, USA Y1 - 2001///0, PY - 2001 DA - 0, 2001 SP - 328 EP - 341 VL - 17 IS - 2 SN - 0749-0208, 0749-0208 KW - USA KW - ASFA 2: Ocean Technology Policy & Non-Living Resources; Water Resources Abstracts; Oceanic Abstracts KW - Remote Sensing KW - Marine KW - Reflectance KW - Surface water KW - Coastal Waters KW - Optical properties KW - Light scattering KW - Algorithms KW - Remote sensing KW - Coastal waters KW - Wavelengths KW - Light absorption KW - Analytical techniques KW - Absorption KW - Optical Properties KW - Wavelength KW - Light reflection KW - O 2090:Instruments/Methods KW - SW 5040:Data acquisition KW - Q2 09222:Methods and instruments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18082577?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Coastal+Research&rft.atitle=Absorption%2C+Scattering%2C+and+Remote-Sensing+Reflectance+Relationships+in+Coastal+Waters%3A+Testing+a+New+Inversion+Algorithm&rft.au=Gould%2C+RW+Jr%3BArnone%2C+R+A%3BSydor%2C+M&rft.aulast=Gould&rft.aufirst=RW&rft.date=2001-01-01&rft.volume=17&rft.issue=2&rft.spage=328&rft.isbn=&rft.btitle=&rft.title=Journal+of+Coastal+Research&rft.issn=07490208&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Light absorption; Surface water; Optical properties; Analytical techniques; Remote sensing; Algorithms; Light scattering; Wavelength; Coastal waters; Light reflection; Remote Sensing; Reflectance; Coastal Waters; Absorption; Optical Properties; Wavelengths; Marine ER - TY - JOUR T1 - Predicting the Depth, Across-Channel Location, and Speed Variability of Tidal Current Core Maxima at the Mouth of the Chesapeake Bay AN - 18081391; 5155469 AB - Reasonable prediction of the depth, across-channel location, and speed variability of tidal current core maxima at the mouth of the Chesapeake Bay can be determined to first order without an extensive deployment of current meters. Fourteen tidal current data sets were acquired with a shipboard Acoustic Doppler Current Profiler (ADCP) on track lines across the Bay mouth. Data sets were representative of fortnightly tidal range variation (spring, neap, and transitional), as well as semi-diurnal tidal current cycle phases (ebb, flood, and slack) for the months of June and September in four different years. Data indicated tidal current maxima were contained within a narrow jet-like core with a horizontal scale of O(1-2 km) and vertical scale of O(10 m). The depth, across-channel location, and speed of the maxima varied with the semi-diurnal tidal current cycle phase, and to a much lesser extent, with the fortnightly variation of tidal range. This temporal variability is modeled by least squares using a sinusoidal function, related to the dominant tidal current harmonic constituent, and a third-degree polynomial curve fit. Prediction algorithms from both models result in correlation coefficients for depth (0.95), across-channel location (0.97), and speed (0.93). National Oceanic and Atmospheric Administration (NOAA) tidal current tables had a speed correlation coefficient of only 0.79 when matched to observations. Comparison correlation coefficients for depth and across-channel location from NOAA tidal current tables could not be determined since the tables do not provide this information. This method provides a first-order, empirical means for predicting the depth, across-channel location, and speed variability of tidal current core maxima under conditions of similar atmospheric forcing and freshwater input without long-term deployment of current meters at multiple depths and locations. The method is not site-specific. Therefore, it may be applied at other locations and could be especially beneficial to estuaries where there are no tidal current meters or published tidal current information. JF - Journal of Coastal Research AU - Whitford, D J AD - Department of Oceanography, 572M Holloway Road, U.S. Naval Academy, Annapolis, MD 21402 USA Y1 - 2001///0, PY - 2001 DA - 0, 2001 SP - 420 EP - 430 VL - 17 IS - 2 SN - 0749-0208, 0749-0208 KW - USA, Chesapeake Bay KW - Water Resources Abstracts; Oceanic Abstracts; ASFA 2: Ocean Technology Policy & Non-Living Resources KW - Water depth KW - Prediction KW - Estuarine dynamics KW - Variability KW - Hydrodynamics KW - Estuaries KW - On-site Data Collections KW - Brackish KW - ANW, USA, Chesapeake Bay KW - Model Studies KW - Tidal currents KW - Tidal Currents KW - Data Acquisition KW - Current velocity KW - Current measurement KW - Data Interpretation KW - Bay dynamics KW - Temporal Distribution KW - O 6060:Coastal Zone Resources and Management KW - Q2 09170:Nearshore dynamics KW - SW 0890:Estuaries UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18081391?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Awaterresources&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Journal+of+Coastal+Research&rft.atitle=Predicting+the+Depth%2C+Across-Channel+Location%2C+and+Speed+Variability+of+Tidal+Current+Core+Maxima+at+the+Mouth+of+the+Chesapeake+Bay&rft.au=Whitford%2C+D+J&rft.aulast=Whitford&rft.aufirst=D&rft.date=2001-01-01&rft.volume=17&rft.issue=2&rft.spage=420&rft.isbn=&rft.btitle=&rft.title=Journal+of+Coastal+Research&rft.issn=07490208&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2016-06-22 N1 - SubjectsTermNotLitGenreText - Prediction; Water depth; Estuarine dynamics; Current velocity; Current measurement; Bay dynamics; Tidal currents; Variability; Hydrodynamics; Data Acquisition; Tidal Currents; On-site Data Collections; Estuaries; Data Interpretation; Temporal Distribution; Model Studies; ANW, USA, Chesapeake Bay; Brackish ER - TY - JOUR T1 - Environmental impact and design of an OTEC plant AN - 18079606; 5160160 AB - This paper presents a critical examination of the environmental impact and design optimization of a potential OTEC (Ocean Thermal Energy Conversion) power plant on the island of Diego Garcia in the Indian Ocean. Specific power of a finite-time thermodynamic heat engine is chosen to be the objective function in the design of the OTEC. ICAI (Intelligent Computer Aided Instruction) computer software, CyclePad, is used in the analysis process. Through manipulation of the boiler pressure and condenser pressure, the specific power of the OTEC plant is optimized. JF - International Journal of Global Energy Issues AU - Wu, C AD - Department of Mechanical Engineering, US Naval Academy, Annapolis, MD 21402, USA, wu@arctic.nadn.navy.mil Y1 - 2001 PY - 2001 DA - 2001 SP - 186 EP - 194 VL - 15 IS - 3-4 SN - 0954-7118, 0954-7118 KW - ocean thermal energy conversion KW - Pollution Abstracts KW - Environmental impact KW - Computer applications KW - Design KW - P 9000:ENVIRONMENTAL ACTION UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/18079606?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Apollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Journal+of+Global+Energy+Issues&rft.atitle=Environmental+impact+and+design+of+an+OTEC+plant&rft.au=Wu%2C+C&rft.aulast=Wu&rft.aufirst=C&rft.date=2001-01-01&rft.volume=15&rft.issue=3-4&rft.spage=186&rft.isbn=&rft.btitle=&rft.title=International+Journal+of+Global+Energy+Issues&rft.issn=09547118&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Design; Environmental impact; Computer applications ER - TY - JOUR T1 - Dispersion resulting from aggregating hydrodynamic properties in water quality modeling AN - 17773701; 4823312 AB - Long-term water quality modeling often requires the use of different modeling modules, including hydrodynamics and water quality, to simulate processes that are dominant in different spatial and temporal scales. Averaging procedures, often used to aggregate fine-grid hydrodynamic model results as input to water quality modeling, produce a cross-correlation term, which serves as a function similar to dispersion that cannot be defined a priori. The present study shows that under the assumption of smoothly varying flow field, the sub-grid transport processes (the cross-correlation term) can be expressed analytically as a source/sink term which takes the form of a Lagrangian time-convolution integral, not in a Fickian form as suggested in many previous studies. This Lagrangian time-convolution integral resembles the dispersion term obtained from an analytical study by G.I. Taylor in which the memory of velocity field is used to define the dispersion coefficient. Information needed in the dispersion integral include memories of fine-grid velocity field and mean concentrations. While Fickian dispersion accounts for the dispersion processes only at the present time, the Lagrangian time-convolution correctly accounts for the memory of detailed dispersion effects introduced by the averaged transport processes. The theoretical results for the Lagrangian dispersion equation are tested in two analytical experiments. Results show that the mean concentration profiles obtained from direct fine-grid 2-D simulations are recoverable from the mean transport equation for the coarse grid only when the Lagrangian time-convolution term is included. JF - International Journal of Engineering Science AU - Wang, P F AD - Marine Environmental Quality Branch, SPAWAR Systems Center, D362, 53475 Strothe Road, San Diego, CA 92152-6335, USA, pfwang@spawar.navy.mil Y1 - 2001/01// PY - 2001 DA - Jan 2001 SP - 95 EP - 112 VL - 39 IS - 1 SN - 0020-7225, 0020-7225 KW - mathematical models KW - Water Resources Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality KW - Hydrodynamics KW - Pollution dispersion KW - Freshwater KW - Water quality KW - Q5 08502:Methods and instruments UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17773701?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=International+Journal+of+Engineering+Science&rft.atitle=Dispersion+resulting+from+aggregating+hydrodynamic+properties+in+water+quality+modeling&rft.au=Wang%2C+P+F&rft.aulast=Wang&rft.aufirst=P&rft.date=2001-01-01&rft.volume=39&rft.issue=1&rft.spage=95&rft.isbn=&rft.btitle=&rft.title=International+Journal+of+Engineering+Science&rft.issn=00207225&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Last updated - 2014-05-06 N1 - SubjectsTermNotLitGenreText - Hydrodynamics; Pollution dispersion; Water quality; Freshwater ER - TY - JOUR T1 - What does beta -bungarotoxin do at the neuromuscular junction? AN - 17683683; 4767911 AB - beta -Bungarotoxin from the Taiwan banded krait, Bungarus multicinctus is a basic protein (pI = 9.5), with a molecular weight of 21,800 consisting of two different polypeptide subunits. A phospholipase A sub(2) subunit named the A-chain and a non-phospholipase A sub(2) subunit named the B-chain, which is homologous to Kunitz protease inhibitors. The A-chain and the B-chain are covalently linked by one disulphide bridge. On mouse hemi-diaphragm nerve-muscle preparations, partially paralysed by lowering the external Ca super(2+) concentration, beta -bungarotoxin classically produces triphasic changes in the contraction responses to indirect nerve stimulation. The initial transient inhibition of twitches (phase 1) is followed by a prolonged facilitatory phase (phase 2) and finally a blocking phase (phase 3). These changes in twitch tension are mimicked, to some extent, by similar changes to end plate potential amplitude and miniature end plate potential frequency. The first and second phases are phospholipase-independent and are thought to be due to the B-chain (a dendrotoxin mimetic) binding to or near to voltage-dependent potassium channels. The last phase (phase 3) is phospholipase dependent and is probably due to phospholipase A sub(2)-mediated destruction of membrane phospholipids in motor nerve terminals. JF - Toxicon AU - Rowan, E G AD - Department of Physiology and Pharmacology, University of Strathclyde, Strathclyde Institute for Biomedical Sciences, 27 Taylor Street, Glasgow G4 ONR, UK, e.g.rowan@strath.ac.uk Y1 - 2001/01// PY - 2001 DA - Jan 2001 SP - 107 EP - 118 VL - 39 IS - 1 SN - 0041-0101, 0041-0101 KW - CSA Neurosciences Abstracts; Toxicology Abstracts KW - Phospholipase A2 KW - ^b-Bungarotoxin KW - Contractility KW - Nerve endings KW - Bungarus multicinctus KW - Potassium channels (voltage-gated) KW - Neuromuscular junctions KW - b-Bungarotoxin KW - Neurotoxins KW - N3 11011:Motor systems and movement disorders KW - X 24173:Animals UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17683683?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Toxicon&rft.atitle=What+does+beta+-bungarotoxin+do+at+the+neuromuscular+junction%3F&rft.au=Rowan%2C+E+G&rft.aulast=Rowan&rft.aufirst=E&rft.date=2001-01-01&rft.volume=39&rft.issue=1&rft.spage=107&rft.isbn=&rft.btitle=&rft.title=Toxicon&rft.issn=00410101&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - SuppNotes - Special issue: Highlights in toxinology. N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Bungarus multicinctus; Neuromuscular junctions; Phospholipase A2; Nerve endings; b-Bungarotoxin; Contractility; Potassium channels (voltage-gated); Neurotoxins; ^b-Bungarotoxin ER - TY - JOUR T1 - Twenty years of dendrotoxins AN - 17683623; 4767904 AB - Dendrotoxins are small proteins that were isolated 20 years ago from mamba (Dendroaspis) snake venoms. Subsequently, a family of related proteins was found in mamba venoms and shown to be homologous to Kunitz-type serine protease inhibitors, such as aprotinin. The dendrotoxins contain 57-60 amino acid residues cross-linked by three disulphide bridges. The dendrotoxins have little or no anti-protease activity, but they were demonstrated to block particular subtypes of voltage-dependent potassium channels in neurons. Studies with cloned K super(+) channels indicate that alpha -dendrotoxin from green mamba Dendroaspis angusticeps blocks Kv1.1, Kv1.2 and Kv1.6 channels in the nanomolar range, whereas toxin K from the black mamba Dendroaspis polylepis preferentially blocks Kv1.l channels. Structural analogues of dendrotoxins have helped to define the molecular recognition properties of different types of K super(+) channels, and radiolabelled dendrotoxins have also been useful in helping to discover toxins from other sources that bind to K super(+) channels. Because dendrotoxins are useful markers of subtypes of K super(+) channels in vivo, dendrotoxins have become widely used as probes for studying the function of K super(+) channels in physiology and pathophysiology. JF - Toxicon AU - Harvey, AL AD - Department of Physiology and Pharmacology, and Strathclyde Institute for Drug Research, University of Strathclyde, Glasgow G4 ONR, UK Y1 - 2001/01// PY - 2001 DA - Jan 2001 SP - 15 EP - 26 VL - 39 IS - 1 SN - 0041-0101, 0041-0101 KW - dendrotoxin KW - Toxicology Abstracts KW - Dendroaspis angusticeps KW - Venom KW - Potassium channels KW - X 24173:Animals UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/17683623?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Atoxicologyabstracts&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=Toxicon&rft.atitle=Twenty+years+of+dendrotoxins&rft.au=Harvey%2C+AL&rft.aulast=Harvey&rft.aufirst=AL&rft.date=2001-01-01&rft.volume=39&rft.issue=1&rft.spage=15&rft.isbn=&rft.btitle=&rft.title=Toxicon&rft.issn=00410101&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2006-11-01 N1 - SuppNotes - Special issue: Highlights in toxinology. N1 - Last updated - 2011-12-13 N1 - SubjectsTermNotLitGenreText - Dendroaspis angusticeps; Potassium channels; Venom ER - TY - JOUR T1 - Assessment of best management practices for improvement of dissolved oxygen in Chesapeake Bay estuary AN - 16138053; 5293222 AB - Two management scenarios, the base case and the full voluntary program implementation scenarios, are simulated with the three-dimensional Chesapeake Bay estuary model package to study the improvement of dissolved oxygen (DO) over the bay in response to the reduction of nutrient loads. The base case scenario is based on the 1985 nutrient management practices and the associated loads from the watershed and airshed to the bay. The full voluntary program implementation scenario is based on an expanded non-point source and point source program applying current technologies in nutrient and sediment management. The implementation of best management practices is assumed to be by voluntary participation, encouraged by a maximum 75% cost share by the states. The ten-year average (1985-1994) total nitrogen and total phosphorus loads to the bay are reduced 40% and 47%, respectively, from the base case to the full voluntary program implementation scenario. The average annual anoxia and hypoxia volume day is reduced 62% and 42%, respectively, in the whole bay. Daily development of bottom DO in the estuary is observed from an MPEG movie. Graphics of daily DO concentration and depth profile show a significant improvement in DO under improved nutrient control. JF - Water Science & Technology AU - Wang, P AU - Batiuk, R AU - Linker, L AU - Shenk, G AD - Center for Environmental Science, University of Maryland, CBPO, 410 Severn Avenue, Suite 109, Annapolis, MD 21403, USA A2 - Yamada, K Y1 - 2001/01// PY - 2001 DA - Jan 2001 SP - 173 EP - 180 PB - Elsevier Science Ltd., Pergamon, P.O. Box 800 Kidlington Oxford OX5 1DX UK VL - 44 IS - 7 SN - 0273-1223, 0273-1223 KW - Best Management Practices KW - Models KW - USA, Chesapeake Bay KW - Sustainability Science Abstracts; Pollution Abstracts; Oceanic Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Aqualine Abstracts; Water Resources Abstracts KW - Eutrophication KW - Nutrient loading KW - Modelling (Water quality) KW - Nutrients KW - Dissolved oxygen KW - Restoration KW - Water Pollution Control KW - Regional planning KW - Bays KW - Estuaries KW - Physicochemical properties KW - Nonpoint Pollution Sources KW - Dissolved Oxygen KW - Water Quality KW - Brackish KW - Pollution Load KW - ANW, USA, Chesapeake Bay KW - Estuarine chemistry KW - Model Studies KW - Planning control KW - Nutrients (mineral) KW - Oxygen (Dissolved) KW - Water quality (Natural waters) KW - Pollution control KW - M3 1010:Issues in Sustainable Development KW - P 1000:MARINE POLLUTION KW - SW 3070:Water quality control KW - O 4080:Pollution - Control and Prevention KW - Q5 08505:Prevention and control KW - AQ 00002:Water Quality UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/16138053?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aaqualine&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=Water+Science+%26+Technology&rft.atitle=Assessment+of+best+management+practices+for+improvement+of+dissolved+oxygen+in+Chesapeake+Bay+estuary&rft.au=Wang%2C+P%3BBatiuk%2C+R%3BLinker%2C+L%3BShenk%2C+G&rft.aulast=Wang&rft.aufirst=P&rft.date=2001-01-01&rft.volume=44&rft.issue=7&rft.spage=173&rft.isbn=&rft.btitle=&rft.title=Water+Science+%26+Technology&rft.issn=02731223&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-07-01 N1 - Last updated - 2015-03-24 N1 - SubjectsTermNotLitGenreText - Eutrophication; Physicochemical properties; Estuaries; Regional planning; Nutrients (mineral); Dissolved oxygen; Estuarine chemistry; Pollution control; Restoration; Bays; Nutrient loading; Planning control; Nutrients; Modelling (Water quality); Oxygen (Dissolved); Water quality (Natural waters); Water Pollution Control; Water Quality; Dissolved Oxygen; Nonpoint Pollution Sources; Pollution Load; Best Management Practices; Model Studies; ANW, USA, Chesapeake Bay; Brackish ER - TY - JOUR T1 - Rain Garden Landscape Design for Water Quality AN - 16136384; 5285329 AB - Rain Gardens are landscaped areas designed to capture stormwater runoff, remove pollutants, and restore groundwater. They capitalize on the natural biochemical activity in mulch and soil to remove toxins from polluted water. Rain Gardens prevent non-point source pollution from entering streams. JF - LakeLine AU - Billow, L AD - Automated Precision Technology, Virginia Beach, VA, USA, Billowl@pwcnorva.navy.mil Y1 - 2001 PY - 2001 DA - 2001 SP - 46 EP - 47 VL - 21 IS - 3 SN - 0743-7978, 0743-7978 KW - Landscaping KW - Mulch KW - Nonpoint pollution KW - Rain Gardens KW - Soils KW - Pollution Abstracts; ASFA 3: Aquatic Pollution & Environmental Quality; Water Resources Abstracts KW - Bioremediation KW - Storm Runoff KW - Biochemistry KW - Freshwater KW - Streams KW - Storm Water KW - Water Pollution Control KW - Stormwater runoff KW - Water Pollution Prevention KW - Water Quality Control KW - Plant populations KW - Freshwater pollution KW - Landscape KW - Nonpoint Pollution Sources KW - Water Quality KW - Toxins KW - Land use KW - Design KW - Water quality control KW - Groundwater pollution KW - Groundwater Recharge KW - Pollution control KW - P 2000:FRESHWATER POLLUTION KW - SW 3070:Water quality control KW - Q5 08505:Prevention and control UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/16136384?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Aasfaaquaticpollution&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=article&rft.jtitle=LakeLine&rft.atitle=Rain+Garden+Landscape+Design+for+Water+Quality&rft.au=Billow%2C+L&rft.aulast=Billow&rft.aufirst=L&rft.date=2001-01-01&rft.volume=21&rft.issue=3&rft.spage=46&rft.isbn=&rft.btitle=&rft.title=LakeLine&rft.issn=07437978&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - Date revised - 2002-04-01 N1 - Last updated - 2014-05-07 N1 - SubjectsTermNotLitGenreText - Water quality control; Bioremediation; Stormwater runoff; Biochemistry; Groundwater pollution; Plant populations; Land use; Freshwater pollution; Pollution control; Landscape; Nonpoint pollution; Streams; Toxins; Design; Water Pollution Control; Storm Water; Storm Runoff; Water Pollution Prevention; Water Quality; Nonpoint Pollution Sources; Landscaping; Water Quality Control; Groundwater Recharge; Freshwater ER - TY - CPAPER T1 - When regulations go too far: The taking of private property by environmental regulations AN - 42268549; 3176085 AU - Plott, D M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42268549?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=When+regulations+go+too+far%3A+The+taking+of+private+property+by+environmental+regulations&rft.au=Plott%2C+D+M&rft.aulast=Plott&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: National Association of Environmental Professionals, 5165 MacArthur Boulevard, NW, Washington, DC 20016, Full papers available. Price $95. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Empirical evidence earth expanding exponentially AN - 42222352; 3144390 AU - Myers, L S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42222352?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Empirical+evidence+earth+expanding+exponentially&rft.au=Myers%2C+L+S&rft.aulast=Myers&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Association for the Advancement of Science, Customer Service, 1333 H St., NW, Washington, DC 20005. Phone: (202)326-6450, Abstracts available. Price $25. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Estuarine ambient toxicity assessment AN - 42214699; 3140260 AU - Hartwell, SI AU - Dawson, CE AU - Jordahl, D M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 7500:Pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42214699?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Estuarine+ambient+toxicity+assessment&rft.au=Hartwell%2C+SI%3BDawson%2C+CE%3BJordahl%2C+D+M&rft.aulast=Hartwell&rft.aufirst=SI&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Society of Environmental Toxicology and Chemistry, 1010 North 12th Ave., Pensacola, FL 32501-3307, USA, Abstracts available. Price $30 (includes shipping). Poster Paper No. TB27 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Stable transformation of Gladiolus plants AN - 42214433; 3150798 AU - Kamo, K AU - Blowers, A AU - Smith, F AU - Van Eck, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42214433?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Stable+transformation+of+Gladiolus+plants&rft.au=Kamo%2C+K%3BBlowers%2C+A%3BSmith%2C+F%3BVan+Eck%2C+J&rft.aulast=Kamo&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Society for Horticultural Science, 113 S. West Street, Suite 400, Alexandria, VA 22314-2824, Abstracts available. ISSN 0018-5345. Paper No. 662 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Computerized screening for appropriate dosing of renally eliminated medications AN - 42204839; 3141436 AU - Skinner, R C AU - Caldwell, J AU - Vitale, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:Mathematics and Computer Science KW - U 3500:Clinical Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42204839?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Computerized+screening+for+appropriate+dosing+of+renally+eliminated+medications&rft.au=Skinner%2C+R+C%3BCaldwell%2C+J%3BVitale%2C+P&rft.aulast=Skinner&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Medical Informatics Association, 4915 St. Elmo Ave., Suite 302, Bethesda, MD 20814, USA. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Contaminant investigations at military facilities and wildlife refuges on the tidal Potomac River AN - 42203517; 3140002 AU - Foley, R E AU - Pinkney, A E AU - McGowan, P C AU - Murphy AU - Sutherland, D W AU - Knight, P T AU - Harshbarger, J C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 7500:Pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42203517?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Contaminant+investigations+at+military+facilities+and+wildlife+refuges+on+the+tidal+Potomac+River&rft.au=Foley%2C+R+E%3BPinkney%2C+A+E%3BMcGowan%2C+P+C%3BMurphy%3BSutherland%2C+D+W%3BKnight%2C+P+T%3BHarshbarger%2C+J+C&rft.aulast=Foley&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Society of Environmental Toxicology and Chemistry, 1010 North 12th Ave., Pensacola, FL 32501-3307, USA, Abstracts available. Price $30 (includes shipping). Paper No. 533 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Defining the extent of Chesapeake Bay toxics problems: Findings from the basinwide strategy reevaluation AN - 42200481; 3140355 AU - Batiuk, R A Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 7500:Pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42200481?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Defining+the+extent+of+Chesapeake+Bay+toxics+problems%3A+Findings+from+the+basinwide+strategy+reevaluation&rft.au=Batiuk%2C+R+A&rft.aulast=Batiuk&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Society of Environmental Toxicology and Chemistry, 1010 North 12th Ave., Pensacola, FL 32501-3307, USA, Abstracts available. Price $30 (includes shipping). Poster Paper No. TF14 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Role of power plant atmospheric emissions in the deposition of nitrogen to the Chesapeake Bay AN - 42199770; 3139942 AU - Miller, P E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 7500:Pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42199770?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Role+of+power+plant+atmospheric+emissions+in+the+deposition+of+nitrogen+to+the+Chesapeake+Bay&rft.au=Miller%2C+P+E&rft.aulast=Miller&rft.aufirst=P&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Society of Environmental Toxicology and Chemistry, 1010 North 12th Ave., Pensacola, FL 32501-3307, USA, Abstracts available. Price $30 (includes shipping). Paper No. 472 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Toxicity of leachates from scrap tires under variable time and salinity regimes AN - 42199554; 3139637 AU - Hartwell, Ian, S AU - Jordahl, D M AU - Dawson, CE AU - Ives, A S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science KW - U 7500:Pharmacology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42199554?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Toxicity+of+leachates+from+scrap+tires+under+variable+time+and+salinity+regimes&rft.au=Hartwell%2C+Ian%2C+S%3BJordahl%2C+D+M%3BDawson%2C+CE%3BIves%2C+A+S&rft.aulast=Hartwell&rft.aufirst=Ian&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Society of Environmental Toxicology and Chemistry, 1010 North 12th Ave., Pensacola, FL 32501-3307, USA, Abstracts available. Price $30 (includes shipping). Paper No. 167 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Intrafamilial transmission and risk factors for cholera in a peri-urban district of Lima, Peru AN - 42187797; 3123639 AU - Castellares, G AU - Cabezas, C AU - Gotuzzo, E AU - Begue, R AU - Sanchez, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42187797?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Intrafamilial+transmission+and+risk+factors+for+cholera+in+a+peri-urban+district+of+Lima%2C+Peru&rft.au=Castellares%2C+G%3BCabezas%2C+C%3BGotuzzo%2C+E%3BBegue%2C+R%3BSanchez%2C+J&rft.aulast=Castellares&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Books International, PO Box 605, Herndon, VA 22070, Abstracts available. Price $25. Poster Paper No. J224 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Ground water impacts on the Chesapeake Bay AN - 42008070; 3082100 AU - Shuyler, L R AU - Linker, L C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/42008070?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Ground+water+impacts+on+the+Chesapeake+Bay&rft.au=Shuyler%2C+L+R%3BLinker%2C+L+C&rft.aulast=Shuyler&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Water Resources Association, 5410 Grosvenor Lane, Suite 220, Bethesda, MD 20814-2192, USA N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Calculation of time domain signals in a waveguide with applications AN - 41982898; 3044939 AU - Werby, M F AU - White, E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41982898?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Calculation+of+time+domain+signals+in+a+waveguide+with+applications&rft.au=Werby%2C+M+F%3BWhite%2C+E&rft.aulast=Werby&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIP, Member and Subscriber Services Division500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Telephone: (516) 576-2360; Fax: (516) 349-7669, Compact Disks; Abstracts, Journal of the Acoustical Society of America, Volume 94, Number 3, Part 2, September 1993, ISSN: 0001-4966 Paper No. 5aUW15 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Composite cylinder cross section tailoring for radiated noise reduction AN - 41981394; 3044717 AU - Ratcliffe, C P AU - Crane, R M AU - Santiago, AL Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41981394?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Composite+cylinder+cross+section+tailoring+for+radiated+noise+reduction&rft.au=Ratcliffe%2C+C+P%3BCrane%2C+R+M%3BSantiago%2C+AL&rft.aulast=Ratcliffe&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIP, Member and Subscriber Services Division500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Telephone: (516) 576-2360; Fax: (516) 349-7669, Compact Disks; Abstracts, Journal of the Acoustical Society of America, Volume 94, Number 3, Part 2, September 1993, ISSN: 0001-4966 Paper No. 4aSA6 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Application of neural networks to the classification of multispectral imagery AN - 41962094; 3068186 AU - Terrie, GE Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41962094?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Application+of+neural+networks+to+the+classification+of+multispectral+imagery&rft.au=Terrie%2C+GE&rft.aulast=Terrie&rft.aufirst=GE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ERIM/Marine Environment ConferenceP.O. Box 134001, Ann Arbor, MI 48113-4001; ph: (313) 994-1200 ext. 3453; fax: (313) 994-5123, Proceedings 2 Volumes. Price $135 per set. ISSN 1066-3711 Paper No. 9-6 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Potential contribution of HYDICE to multi-use coastal GIS AN - 41960984; 3068192 AU - Rickard, L J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41960984?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Potential+contribution+of+HYDICE+to+multi-use+coastal+GIS&rft.au=Rickard%2C+L+J&rft.aulast=Rickard&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ERIM/Marine Environment ConferenceP.O. Box 134001, Ann Arbor, MI 48113-4001; ph: (313) 994-1200 ext. 3453; fax: (313) 994-5123, Proceedings 2 Volumes. Price $135 per set. ISSN 1066-3711 Paper No. 10-5 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - A fast one-way normal mode propagation method AN - 41958647; 3044931 AU - White, E AU - Werby, M F Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41958647?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=A+fast+one-way+normal+mode+propagation+method&rft.au=White%2C+E%3BWerby%2C+M+F&rft.aulast=White&rft.aufirst=E&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIP, Member and Subscriber Services Division500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Telephone: (516) 576-2360; Fax: (516) 349-7669, Compact Disks; Abstracts, Journal of the Acoustical Society of America, Volume 94, Number 3, Part 2, September 1993, ISSN: 0001-4966 Paper No. 5aUW7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - X-ray emission from an ultra short pulse laser heated aluminum plasma AN - 41958073; 3068350 AU - Clark, R AU - Davis, J AU - Giuliani, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41958073?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=X-ray+emission+from+an+ultra+short+pulse+laser+heated+aluminum+plasma&rft.au=Clark%2C+R%3BDavis%2C+J%3BGiuliani%2C+J&rft.aulast=Clark&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: SOQUEBox 245 McClean, VA 22101, Proceedings $145 plus shipping Paper No. TK.6 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Towards an X-ray laser using ultra soft pulse laser plasma interactions AN - 41949310; 3068235 AU - Davis, J AU - Clark, R AU - Giuliani, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41949310?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Towards+an+X-ray+laser+using+ultra+soft+pulse+laser+plasma+interactions&rft.au=Davis%2C+J%3BClark%2C+R%3BGiuliani%2C+J&rft.aulast=Davis&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: SOQUEBox 245 McClean, VA 22101, Proceedings $145 plus shipping Paper No. MD.5 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Critical issues for reporting under the pollution prevention section of form R AN - 41946905; 3054760 AU - Sarmiento, M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:CHEMISTRY AND CHEMICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41946905?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Critical+issues+for+reporting+under+the+pollution+prevention+section+of+form+R&rft.au=Sarmiento%2C+M&rft.aulast=Sarmiento&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIChE345 East 47th Street, New York, NY 10017, USA; Telephone: (212) 705-7344; Fax: (212) 752-3294 or (212) 752-3297, Proceedings Paper No. 8a N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Impulse response of rough two-dimensional surfaces AN - 41935653; 3044404 AU - Keiffer, R S AU - Novarini, J C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41935653?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Impulse+response+of+rough+two-dimensional+surfaces&rft.au=Keiffer%2C+R+S%3BNovarini%2C+J+C&rft.aulast=Keiffer&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIP, Member and Subscriber Services Division500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Telephone: (516) 576-2360; Fax: (516) 349-7669, Compact Disks; Abstracts, Journal of the Acoustical Society of America, Volume 94, Number 3, Part 2, September 1993, ISSN: 0001-4966 Paper No. 1pUW12 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Optimizing remedial action implementation at the C&R Battery Company superfund site AN - 41932841; 3055084 AU - Claypool, JE AU - Moore, J W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:CHEMISTRY AND CHEMICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41932841?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Optimizing+remedial+action+implementation+at+the+C%26amp%3BR+Battery+Company+superfund+site&rft.au=Claypool%2C+JE%3BMoore%2C+J+W&rft.aulast=Claypool&rft.aufirst=JE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIChE345 East 47th Street, New York, NY 10017, USA; Telephone: (212) 705-7344; Fax: (212) 752-3294 or (212) 752-3297, Proceedings Paper No. 57h N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Conditions required for gain on the Lyman alpha line of helium AN - 41926320; 3068252 AU - Apruzese, J P AU - Pulsifer, P E AU - Davis, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41926320?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Conditions+required+for+gain+on+the+Lyman+alpha+line+of+helium&rft.au=Apruzese%2C+J+P%3BPulsifer%2C+P+E%3BDavis%2C+J&rft.aulast=Apruzese&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: SOQUEBox 245 McClean, VA 22101, Proceedings $145 plus shipping Paper No. MD.7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Analysis of the acoustic field via spectral decomposition AN - 41919286; 3044935 AU - Norton, G V Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41919286?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Analysis+of+the+acoustic+field+via+spectral+decomposition&rft.au=Norton%2C+G+V&rft.aulast=Norton&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIP, Member and Subscriber Services Division500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Telephone: (516) 576-2360; Fax: (516) 349-7669, Compact Disks; Abstracts, Journal of the Acoustical Society of America, Volume 94, Number 3, Part 2, September 1993, ISSN: 0001-4966 Paper No. 5aUW11 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Limiting stability criterion for steady-state shear-bands in thermo-plasticity AN - 41915403; 3056859 AU - Malek-Madani, R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41915403?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Limiting+stability+criterion+for+steady-state+shear-bands+in+thermo-plasticity&rft.au=Malek-Madani%2C+R&rft.aulast=Malek-Madani&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Dr. Akhtar S. Khan, UMBC, Abstracts N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Ecology of the "Great Pennsylvania - Maryland (Serpentine) Barrens" AN - 41913924; 3045579 AU - Tyndall, W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2000:BIOLOGY GENERAL KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41913924?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Ecology+of+the+%22Great+Pennsylvania+-+Maryland+%28Serpentine%29+Barrens%22&rft.au=Tyndall%2C+W&rft.aulast=Tyndall&rft.aufirst=W&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIBS730 11th Street, NW, Washington, DC 20001-4521, USA; Telephone: (202) 628-1500; Fax: (202) 628-1509; Internet: AIBSWUVM.EDU, Abstracts N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Solidification/stabilization of lead-contaminated soils at the C&R battery company superfund site AN - 41909981; 3055054 AU - Moore, J W AU - Claypool, JE AU - Stanforth, R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:CHEMISTRY AND CHEMICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41909981?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Solidification%2Fstabilization+of+lead-contaminated+soils+at+the+C%26amp%3BR+battery+company+superfund+site&rft.au=Moore%2C+J+W%3BClaypool%2C+JE%3BStanforth%2C+R&rft.aulast=Moore&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIChE345 East 47th Street, New York, NY 10017, USA; Telephone: (212) 705-7344; Fax: (212) 752-3294 or (212) 752-3297, Proceedings Paper No. 53c N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Determination of turbulent velocity correlations by the nonlinear scattering of crossed ultrasonic beams AN - 41907964; 3044874 AU - Korman AU - Parker, JE III Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41907964?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Determination+of+turbulent+velocity+correlations+by+the+nonlinear+scattering+of+crossed+ultrasonic+beams&rft.au=Korman%3BParker%2C+JE+III&rft.aulast=Korman&rft.aufirst=&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AIP, Member and Subscriber Services Division500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Telephone: (516) 576-2360; Fax: (516) 349-7669, Compact Disks; Abstracts, Journal of the Acoustical Society of America, Volume 94, Number 3, Part 2, September 1993, ISSN: 0001-4966 Paper No. 5aPA7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Peak rejection criterion based on counting error for low level gamma spectroscopy measurements AN - 41899712; 3001905 AU - Moon, J W AU - Bland, J S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3500:CLINICAL MEDICINE KW - U 4500:EXPERIMENTAL MEDICINE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41899712?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Peak+rejection+criterion+based+on+counting+error+for+low+level+gamma+spectroscopy+measurements&rft.au=Moon%2C+J+W%3BBland%2C+J+S&rft.aulast=Moon&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Williams & Wilkins428 E. Preston St., Baltimore, MD 21202, USA, Abstracts, Health Physics - The Radiation Protection Journal, June 1993 Volume 64 Number 6 Supplement 1, ISSN: 0017-9078 Paper No. TAM-F1 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Cost effectiveness of nonpoint source control AN - 41894530; 2968484 AU - Shuyler, L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE KW - U 3000:CIVIL AND MECHANICAL ENGINEERING KW - U 2000:BIOLOGY GENERAL KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41894530?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Cost+effectiveness+of+nonpoint+source+control&rft.au=Shuyler%2C+L&rft.aulast=Shuyler&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Coastal Zone 93, PO Box 4148, Foster City, CA 94404, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Scattering from submerged elastic shells and the characterization of resonances at coincidence frequency: A consensus view AN - 41888854; 2927133 AU - Werby, M F AU - Hackman, R H AU - Ueberall, H AU - Sammelmann, G S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41888854?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Scattering+from+submerged+elastic+shells+and+the+characterization+of+resonances+at+coincidence+frequency%3A+A+consensus+view&rft.au=Werby%2C+M+F%3BHackman%2C+R+H%3BUeberall%2C+H%3BSammelmann%2C+G+S&rft.aulast=Werby&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, Member and Subscriber Services Div., 500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Phone: 516/576-2360; Fax: 516/349-7669, Abstracts, The Journal of the Acoustical Society of America, Volume 93, Number 4, Part 2, April 1993, ISSN: 0001-4966 Paper No. 5aSA3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Environmental operations and compliance with the new firefighter trainer at Naval Station Treasure Island, CA AN - 41872376; 2965161 AU - Kannapel, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE KW - U 3000:CIVIL AND MECHANICAL ENGINEERING KW - U 2500:CHEMISTRY AND CHEMICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41872376?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Environmental+operations+and+compliance+with+the+new+firefighter+trainer+at+Naval+Station+Treasure+Island%2C+CA&rft.au=Kannapel%2C+P&rft.aulast=Kannapel&rft.aufirst=P&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: A&WMA, PO Box 2861, Pittsburgh, PA 15230, USA; Telephone: (412) 232-3444; Fax: (412) 232-3450, Proceedings Paper No. 93-WA-83A.04 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Preventing damage to seagrass beds from boating activities in Key Largo, Florida AN - 41860537; 2966923 AU - Hunt, B Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE KW - U 3000:CIVIL AND MECHANICAL ENGINEERING KW - U 2000:BIOLOGY GENERAL KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41860537?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Preventing+damage+to+seagrass+beds+from+boating+activities+in+Key+Largo%2C+Florida&rft.au=Hunt%2C+B&rft.aulast=Hunt&rft.aufirst=B&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Coastal Zone 93, PO Box 4148, Foster City, CA 94404, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Environmental indicators for the Chesapeake Bay AN - 41859652; 2968491 AU - Mountford, K Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE KW - U 3000:CIVIL AND MECHANICAL ENGINEERING KW - U 2000:BIOLOGY GENERAL KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41859652?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Environmental+indicators+for+the+Chesapeake+Bay&rft.au=Mountford%2C+K&rft.aulast=Mountford&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Coastal Zone 93, PO Box 4148, Foster City, CA 94404, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Watershed model of the Chesapeake Bay AN - 41857221; 2968483 AU - Linker, L AU - Stigall, GE Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE KW - U 3000:CIVIL AND MECHANICAL ENGINEERING KW - U 2000:BIOLOGY GENERAL KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41857221?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Watershed+model+of+the+Chesapeake+Bay&rft.au=Linker%2C+L%3BStigall%2C+GE&rft.aulast=Linker&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Coastal Zone 93, PO Box 4148, Foster City, CA 94404, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Root locus equations for the vibrating diaphragm model of jet-pipe action AN - 41839117; 2926588 AU - Elder, SA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41839117?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Root+locus+equations+for+the+vibrating+diaphragm+model+of+jet-pipe+action&rft.au=Elder%2C+SA&rft.aulast=Elder&rft.aufirst=SA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, Member and Subscriber Services Div., 500 Sunnyvale Blvd., Woodbury, NY 11797-2999, USA; Phone: 516/576-2360; Fax: 516/349-7669, Abstracts, The Journal of the Acoustical Society of America, Volume 93, Number 4, Part 2, April 1993, ISSN: 0001-4966 Paper No. 4pMU7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - BRIEFING: Advanced distributed technology demonstrations in the joint arena AN - 41828858; 2894334 AU - Bloyer, S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:MATHEMATICS UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41828858?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=BRIEFING%3A+Advanced+distributed+technology+demonstrations+in+the+joint+arena&rft.au=Bloyer%2C+S&rft.aulast=Bloyer&rft.aufirst=S&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: 1993 Simulation MultiConference c/o SCS, P.O. Box 17900, San Diego, CA 92177; Telephone: (619) 277-3888; Fax: (619) 277-3930, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Signatures from pulse signals scattered from elongated elastic solids AN - 41797408; 2772930 AU - White, E AU - Werby, M F AU - Dean, CE Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41797408?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Signatures+from+pulse+signals+scattered+from+elongated+elastic+solids&rft.au=White%2C+E%3BWerby%2C+M+F%3BDean%2C+CE&rft.aulast=White&rft.aufirst=E&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 9PA4 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Weight, volume, and power consumption reduction in side look sonar systems for autonomous underwater vehicles AN - 41778665; 2772870 AU - Jaenke, P E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41778665?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Weight%2C+volume%2C+and+power+consumption+reduction+in+side+look+sonar+systems+for+autonomous+underwater+vehicles&rft.au=Jaenke%2C+P+E&rft.aulast=Jaenke&rft.aufirst=P&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: IEEE Service Center, 445 Hoes Lane, P.O. Box 1331, Piscataway, NJ 08855-1331, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Experimental investigation on the amplification of hydrodynamic noise generation by the insertion of bubbles in a turbulent flow AN - 41778458; 2771030 AU - Hughes, CE AU - Korman Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41778458?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Experimental+investigation+on+the+amplification+of+hydrodynamic+noise+generation+by+the+insertion+of+bubbles+in+a+turbulent+flow&rft.au=Hughes%2C+CE%3BKorman&rft.aulast=Hughes&rft.aufirst=CE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Poster Paper No. 4ED2 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Exploration of turbulence by nonlinear acoustic scattering AN - 41775496; 2771036 AU - Parker, JE III AU - Korman Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41775496?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Exploration+of+turbulence+by+nonlinear+acoustic+scattering&rft.au=Parker%2C+JE+III%3BKorman&rft.aulast=Parker&rft.aufirst=JE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Poster Paper No. 4ED3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Forensic photogrammetry AN - 41770896; 2802313 AU - Szoko, S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41770896?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Forensic+photogrammetry&rft.au=Szoko%2C+S&rft.aulast=Szoko&rft.aufirst=S&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Determination of the causes of a short circuit in a terminator block AN - 41770800; 2802026 AU - Hackett, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41770800?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Determination+of+the+causes+of+a+short+circuit+in+a+terminator+block&rft.au=Hackett%2C+P&rft.aulast=Hackett&rft.aufirst=P&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Long-life corrosion fatigue crack initiation in cast A356-T6 aluminum alloy AN - 41770765; 2802008 AU - Czyryca, E J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41770765?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Long-life+corrosion+fatigue+crack+initiation+in+cast+A356-T6+aluminum+alloy&rft.au=Czyryca%2C+E+J&rft.aulast=Czyryca&rft.aufirst=E&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Reduced order state-space controller for an intercooled, regenerated gas turbine engine AN - 41769822; 2798484 AU - Watts, J W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:MATHEMATICS UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41769822?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Reduced+order+state-space+controller+for+an+intercooled%2C+regenerated+gas+turbine+engine&rft.au=Watts%2C+J+W&rft.aulast=Watts&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: SCS, 4838 Ronson Ct., Suite L, San Diego, CA 92111-1810, USA; Telephone: (619) 277-3888; Fax: (619) 277-3930, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Model of jet-resonator action based on the air reed, or vibrating diaphragm, concept AN - 41769444; 2771697 AU - Elder, SA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41769444?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Model+of+jet-resonator+action+based+on+the+air+reed%2C+or+vibrating+diaphragm%2C+concept&rft.au=Elder%2C+SA&rft.aulast=Elder&rft.aufirst=SA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 6MU2 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Sensitivity of the deconvolution of ocean transients to environmental mismatch AN - 41768796; 2772581 AU - Broadhead, M K AU - Field, R L AU - Leclere, J H Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41768796?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Sensitivity+of+the+deconvolution+of+ocean+transients+to+environmental+mismatch&rft.au=Broadhead%2C+M+K%3BField%2C+R+L%3BLeclere%2C+J+H&rft.aulast=Broadhead&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 7UW3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Determination of the relative strengths of resonances excited for plane waves scattered from elastic spheroids AN - 41767686; 2772925 AU - Dean, CE AU - Werby, M F AU - White, E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41767686?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Determination+of+the+relative+strengths+of+resonances+excited+for+plane+waves+scattered+from+elastic+spheroids&rft.au=Dean%2C+CE%3BWerby%2C+M+F%3BWhite%2C+E&rft.aulast=Dean&rft.aufirst=CE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 9PA2 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Manifestation of certain classes of resonances as standing waves on elastic spheroidal objects AN - 41762486; 2772929 AU - Werby, M F AU - Dean, CE AU - White, E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41762486?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Manifestation+of+certain+classes+of+resonances+as+standing+waves+on+elastic+spheroidal+objects&rft.au=Werby%2C+M+F%3BDean%2C+CE%3BWhite%2C+E&rft.aulast=Werby&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 9PA3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Cooling of electronics in underwater vehicles using heat pipes AN - 41760969; 2772700 AU - Somers, G W AU - Mang, J M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41760969?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Cooling+of+electronics+in+underwater+vehicles+using+heat+pipes&rft.au=Somers%2C+G+W%3BMang%2C+J+M&rft.aulast=Somers&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: IEEE Service Center, 445 Hoes Lane, P.O. Box 1331, Piscataway, NJ 08855-1331, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Operator expansion error estimation by higher-order terms AN - 41758635; 2770534 AU - Dubberley, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41758635?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Operator+expansion+error+estimation+by+higher-order+terms&rft.au=Dubberley%2C+J&rft.aulast=Dubberley&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 2UW4 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Technology Transfer Act opportunities between government laboratories and industries and how it works AN - 41757486; 2825122 AU - Rein, R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41757486?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Technology+Transfer+Act+opportunities+between+government+laboratories+and+industries+and+how+it+works&rft.au=Rein%2C+R&rft.aulast=Rein&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: MTS '92 c/o J. Spargo & Associates, Inc., 4400 Fair Lakes Court, Fairfax, VA 22033, USA; Telephone: (703) 631-6200; Fax: (703) 818-9177, Proceedings, $150.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Current analysis for the condition assessment of shipboard motor driven machinery AN - 41755335; 2802341 AU - Tate, R C AU - Nemarich, C P AU - Porter Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41755335?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Current+analysis+for+the+condition+assessment+of+shipboard+motor+driven+machinery&rft.au=Tate%2C+R+C%3BNemarich%2C+C+P%3BPorter&rft.aulast=Tate&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Failure analysis AN - 41755331; 2801757 AU - Natishan, MAE Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41755331?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Failure+analysis&rft.au=Natishan%2C+MAE&rft.aulast=Natishan&rft.aufirst=MAE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Motor current analysis for the diagnosis of air compressor defects AN - 41755040; 2802342 AU - Tinston, M AU - Sarkady, A Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41755040?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Motor+current+analysis+for+the+diagnosis+of+air+compressor+defects&rft.au=Tinston%2C+M%3BSarkady%2C+A&rft.aulast=Tinston&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Fitness-for-purpose analysis of a main feedwater piping system AN - 41754958; 2802094 AU - Link, R E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41754958?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Fitness-for-purpose+analysis+of+a+main+feedwater+piping+system&rft.au=Link%2C+R+E&rft.aulast=Link&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Effect of anodizing on the fatigue behavior of 6061-T6 aluminum components AN - 41754929; 2801852 AU - Vassilaros, M G Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41754929?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Effect+of+anodizing+on+the+fatigue+behavior+of+6061-T6+aluminum+components&rft.au=Vassilaros%2C+M+G&rft.aulast=Vassilaros&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Phase I and II environmental property assessment for a multi-parcel property purchase AN - 41749605; 2797020 AU - Costanza, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41749605?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Phase+I+and+II+environmental+property+assessment+for+a+multi-parcel+property+purchase&rft.au=Costanza%2C+J&rft.aulast=Costanza&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Environmental Site Assessments, NGWA, P.O. Box 182039/Dep. 017, Columbus, OH 43218-2039, USA; Telephone: (614) 761-1711, Proceedings Paper No. B111 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Turbulent energy spectrum predictions by nonlinear acoustic scattering AN - 41735148; 2770373 AU - Parker, JE AU - Korman Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41735148?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Turbulent+energy+spectrum+predictions+by+nonlinear+acoustic+scattering&rft.au=Parker%2C+JE%3BKorman&rft.aulast=Parker&rft.aufirst=JE&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnyside Blvd., Woodbury, NY 11797, USA; Telephone: (516) 576-2360, Abstracts, Journal of the Acoustical Society of America, Vol. 91, No. 4, Pt. 2, April 1992, ISSN: 0001-4966 Paper No. 2PA7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - High resolution microscopy for fracture surface characterization AN - 41733583; 2802316 AU - Natishan, ME Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41733583?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=High+resolution+microscopy+for+fracture+surface+characterization&rft.au=Natishan%2C+ME&rft.aulast=Natishan&rft.aufirst=ME&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Cost performance analysis of on-line diagnostics AN - 41733047; 2802070 AU - Dundics, MJ AU - Moury, M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41733047?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Cost+performance+analysis+of+on-line+diagnostics&rft.au=Dundics%2C+MJ%3BMoury%2C+M&rft.aulast=Dundics&rft.aufirst=MJ&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Vibration Institute, 6262 S. Kingery Highway, Willowbrook, IL 60514, USA. Telephone: (708) 654-2254., Proceedings, book, Economic Implications of Mechanical Failure Prevention, $50.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Dynamic cable-body computations for an AUV with a towed secondary body AN - 41723360; 2772688 AU - Guala, J R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41723360?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Dynamic+cable-body+computations+for+an+AUV+with+a+towed+secondary+body&rft.au=Guala%2C+J+R&rft.aulast=Guala&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: IEEE Service Center, 445 Hoes Lane, P.O. Box 1331, Piscataway, NJ 08855-1331, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Automatic camera control for AUV's: A comparison of image assessment methods AN - 41719187; 2772792 AU - Chu, J AU - Lieberman, L AU - Downes, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41719187?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Automatic+camera+control+for+AUV%27s%3A+A+comparison+of+image+assessment+methods&rft.au=Chu%2C+J%3BLieberman%2C+L%3BDownes%2C+P&rft.aulast=Chu&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: IEEE Service Center, 445 Hoes Lane, P.O. Box 1331, Piscataway, NJ 08855-1331, USA, Proceedings N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Microwave joining of silicon carbide using several different approaches AN - 41719074; 2708509 AU - Ahmad, I AU - Silberglitt, R AU - Black, WM AU - Sa'adaldin, H S AU - Katz, J D Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41719074?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Microwave+joining+of+silicon+carbide+using+several+different+approaches&rft.au=Ahmad%2C+I%3BSilberglitt%2C+R%3BBlack%2C+WM%3BSa%27adaldin%2C+H+S%3BKatz%2C+J+D&rft.aulast=Ahmad&rft.aufirst=I&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: MRS, Publications Department, 9800 McKnight Road, Pittsburgh, PA 15237, USA. Telephone: (412) 367-3003. Fax: (412) 367-4373., Proceedings Paper No. L9.14 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Intensive counselling as a foundation for a combined patient and provider referral approach for partner notification AN - 41716059; 2662342 AU - Daniell, F D AU - Skelly, R AU - Friedman, S AU - Walcker, P AU - McLean, S AU - Johnson, L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3500:CLINICAL MEDICINE KW - U 2000:BIOLOGY GENERAL KW - U 4500:EXPERIMENTAL MEDICINE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41716059?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Intensive+counselling+as+a+foundation+for+a+combined+patient+and+provider+referral+approach+for+partner+notification&rft.au=Daniell%2C+F+D%3BSkelly%2C+R%3BFriedman%2C+S%3BWalcker%2C+P%3BMcLean%2C+S%3BJohnson%2C+L&rft.aulast=Daniell&rft.aufirst=F&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Attn.: Cecilia Avico, VIIth International Conference on AIDS, Istituto Superiore di Sanita, Laboratory of Virology, Viale Regina Elena, 299, 00161 Rome, Italy, Abstracts Poster Paper No. M.C.3327 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Future of naval geophysical oceanography AN - 41710741; 2639994 AU - Donat, W S AU - Boatman, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41710741?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Future+of+naval+geophysical+oceanography&rft.au=Donat%2C+W+S%3BBoatman%2C+J&rft.aulast=Donat&rft.aufirst=W&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: MTS '91, c/o J Spargo & Associates, Inc., 4400 Fair Lakes Court, Fairfax, VA 22033, USA. Telephone: (703) 631-6200. Fax: (703) 818-9177., Proceedings, $150.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - U.S. Navy ractical environmental support system AN - 41701911; 2639290 AU - Trumbower, G C AU - Harrison, E J AU - Miller, C R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41701911?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=U.S.+Navy+ractical+environmental+support+system&rft.au=Trumbower%2C+G+C%3BHarrison%2C+E+J%3BMiller%2C+C+R&rft.aulast=Trumbower&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: MTS '91, c/o J Spargo & Associates, Inc., 4400 Fair Lakes Court, Fairfax, VA 22033, USA. Telephone: (703) 631-6200. Fax: (703) 818-9177., Proceedings, $150.00 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Poled polymers for MCMs with integrated dielectric and optical layers AN - 41616680; 3467905 AU - Mechtel, D M AU - Charles, HK Jr AU - Shaun Francomarcaro, A Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:Mathematics and Computer Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41616680?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Poled+polymers+for+MCMs+with+integrated+dielectric+and+optical+layers&rft.au=Mechtel%2C+D+M%3BCharles%2C+HK+Jr%3BShaun+Francomarcaro%2C+A&rft.aulast=Mechtel&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Electronics Industry Alliance, 2500 Wilson Boulevard, Arlington, VA 22201-3834, USA, Proceedings available. Contact EIA for price. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - High temperature superconductivity space experiment (HTSSE):/Passive millimeter-wave devices AN - 41598764; 2427658 AU - Wolff, SA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41598764?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=High+temperature+superconductivity+space+experiment+%28HTSSE%29%3A%2FPassive+millimeter-wave+devices&rft.au=Wolff%2C+SA&rft.aulast=Wolff&rft.aufirst=SA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: MRS, 9800 McKnight Road, Pittsburgh, PA 15237, USA, Proceedings Paper No. A2.4 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Evaluation of benthic macroinvertebrate and fish indices of biotic integrity for Maryland streams AN - 41592518; 3466752 AU - Boward, D AU - Stribling, J B AU - Roth, N AU - Stranko, S AU - Kazyak, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41592518?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Evaluation+of+benthic+macroinvertebrate+and+fish+indices+of+biotic+integrity+for+Maryland+streams&rft.au=Boward%2C+D%3BStribling%2C+J+B%3BRoth%2C+N%3BStranko%2C+S%3BKazyak%2C+P&rft.aulast=Boward&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: North American Benthological Society, P.O. Box 1897, Lawrence, KS 66044-8897, USA; phone: 913-843-1221; fax: 913-843-1274; URL: www.benthos.org, Abstracts available. No charge. Poster Paper No. 366 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Characterization of complex systems from inverse radiative transfer measurements AN - 41586776; 3448122 AU - Burkhardt, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41586776?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Characterization+of+complex+systems+from+inverse+radiative+transfer+measurements&rft.au=Burkhardt%2C+J&rft.aulast=Burkhardt&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, 500 Sunnydale Boulevard, Woodbury, NY 11797, USA; URL: asa.aip.org, Abstracts available. Price $100. Paper No. 2aSAa3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Acoustic scattering from submerged finite-length cylinders with end caps and internal ribs: A comparison of methods AN - 41579474; 2366537 AU - Brill, D AU - Gaunaurd, G C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41579474?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Acoustic+scattering+from+submerged+finite-length+cylinders+with+end+caps+and+internal+ribs%3A+A+comparison+of+methods&rft.au=Brill%2C+D%3BGaunaurd%2C+G+C&rft.aulast=Brill&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASA, 500 Sunnyside Blvd., Woodbury, NY 11797, USA, Paper No. 4SA6 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Citizen monitoring component of the Maryland targeted watershed project AN - 41576845; 2481319 AU - Campbell, G AU - Ellett, K Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41576845?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Citizen+monitoring+component+of+the+Maryland+targeted+watershed+project&rft.au=Campbell%2C+G%3BEllett%2C+K&rft.aulast=Campbell&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Coastal Zone 91, P.O. Box 279, 21000 Butts Canyon Road, Middletown, CA 95461, USA. Telephone: (707) 987-0114. Fax: (707) 987-9351. Telex: 510-600-7055. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Demonstrations of undergraduate acoustic experiments AN - 41571251; 2365843 AU - Korman AU - Baker, L G Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41571251?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Demonstrations+of+undergraduate+acoustic+experiments&rft.au=Korman%3BBaker%2C+L+G&rft.aulast=Korman&rft.aufirst=&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASA, 500 Sunnyside Blvd., Woodbury, NY 11797, USA, Paper No. 3ED7 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Numerical simulations of the development of an extratropical cyclone with the NRL nested model AN - 41564191; 2399723 AU - Sashegyi, K D AU - Madala, R V AU - Chang, S W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41564191?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Numerical+simulations+of+the+development+of+an+extratropical+cyclone+with+the+NRL+nested+model&rft.au=Sashegyi%2C+K+D%3BMadala%2C+R+V%3BChang%2C+S+W&rft.aulast=Sashegyi&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AMS, 1755 Massachusetts Avenue, NW, Suite 700, Washington, DC 20036, USA, Paper No. 3.4 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - NEONS environmental database management system - recent developments AN - 41563705; 2399516 AU - Jurkevics, A AU - Titus, R AU - Tsui, T L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41563705?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=NEONS+environmental+database+management+system+-+recent+developments&rft.au=Jurkevics%2C+A%3BTitus%2C+R%3BTsui%2C+T+L&rft.aulast=Jurkevics&rft.aufirst=A&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AMS, 1755 Massachusetts Avenue, NW, Suite 700, Washington, DC 20036, USA, Paper No. 4.8 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - DVI: Digital video interactive - prospects for general and specialized information systems and applications AN - 41562228; 2399060 AU - McKinnie, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41562228?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=DVI%3A+Digital+video+interactive+-+prospects+for+general+and+specialized+information+systems+and+applications&rft.au=McKinnie%2C+C&rft.aulast=McKinnie&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AMS, 1755 Massachusetts Avenue, NW, Suite 700, Washington, DC 20036, USA, Paper No. 1.3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Experiments on the nonlinear scattering of crossed focused beams in the presence of turbulence AN - 41549771; 2363104 AU - Korman AU - Rife, S C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41549771?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Experiments+on+the+nonlinear+scattering+of+crossed+focused+beams+in+the+presence+of+turbulence&rft.au=Korman%3BRife%2C+S+C&rft.aulast=Korman&rft.aufirst=&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Elsevier Science Publishing Co., Inc., P.O. Box 882, Madison Square Station, New York, NY 10159, USA, Frontiers of Nonlinear Acoustics, ISBN: 1-85166-537-4, $135.00 Paper No. H4 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Contour smoothing of mixture fraction data using luminescence images and temperature data AN - 41539857; 3447163 AU - Myre, D D AU - Skaggs, R R AU - Miller, J H Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:Chemistry and Chemical Engineering UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41539857?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Contour+smoothing+of+mixture+fraction+data+using+luminescence+images+and+temperature+data&rft.au=Myre%2C+D+D%3BSkaggs%2C+R+R%3BMiller%2C+J+H&rft.aulast=Myre&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Combustion Institute, 5001 Baum Boulevard, Suite 635, Pittsburgh, PA 15213-1851, USA, Abstracts available. Price $50. Poster Paper No. 133 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Intelligent controlled for the spray forming process AN - 41537343; 2375380 AU - Matteson, MA AU - Moran, A AU - Madden, C AU - Kelley, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41537343?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Intelligent+controlled+for+the+spray+forming+process&rft.au=Matteson%2C+MA%3BMoran%2C+A%3BMadden%2C+C%3BKelley%2C+P&rft.aulast=Matteson&rft.aufirst=MA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: TMS, 420 Commonwealth Drive, Warrendale, PA 15086, USA; Phone: (412) 776-3770; Fax: (412) 776-3770; Telex: 910 380 9397 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Video tutorial on modal analysis AN - 41533376; 2365842 AU - Elder, SA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41533376?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Video+tutorial+on+modal+analysis&rft.au=Elder%2C+SA&rft.aulast=Elder&rft.aufirst=SA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASA, 500 Sunnyside Blvd., Woodbury, NY 11797, USA, Paper No. 3ED6 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Oxides of nitrogen emissions from burning wood AN - 41532155; 3427074 AU - Tuttle, K L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41532155?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Oxides+of+nitrogen+emissions+from+burning+wood&rft.au=Tuttle%2C+K+L&rft.aulast=Tuttle&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Widener University, One University Place, Chester, PA 19013-5792, USA, Full papers available. Price $125 (+ $20 if shipped outside North America). N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Large-scale satellite-observed SSTS during the 1980s as compared with conventional SSTS AN - 41531415; 2373842 AU - Strong, A E Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41531415?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Large-scale+satellite-observed+SSTS+during+the+1980s+as+compared+with+conventional+SSTS&rft.au=Strong%2C+A+E&rft.aulast=Strong&rft.aufirst=A&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AMS, 1755 Massachusetts Avenue, NW, Suite 700, Washington, DC 20036, USA, Paper No. J1.11 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Role of the federal government in stock enhancement AN - 41511166; 2324034 AU - Wooley, C M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41511166?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Role+of+the+federal+government+in+stock+enhancement&rft.au=Wooley%2C+C+M&rft.aulast=Wooley&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Fisheries Society, 5410 Grosvenor Lane, Bethesda, MD 20814, USA. Telephone: (301) 897-8616., Paper No. 22.17 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Survey items measuring extremist and hate group activity in the military AN - 41485452; 3403316 AU - Culbertson, AL AU - Rosenfeld, P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3500:Clinical Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41485452?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Survey+items+measuring+extremist+and+hate+group+activity+in+the+military&rft.au=Culbertson%2C+AL%3BRosenfeld%2C+P&rft.aulast=Culbertson&rft.aufirst=AL&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Psychological Association, 750 First St., N.E., Washington, DC 20002-4242, USA; phone: (202) 336-5500; email: convention.office@apa.org; URL: http://www.apa.org, Contact APA for availability. Final Program $5. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Case study in licensing board miscarriage of justice AN - 41483063; 3404152 AU - Jones, AB Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3500:Clinical Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41483063?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Case+study+in+licensing+board+miscarriage+of+justice&rft.au=Jones%2C+AB&rft.aulast=Jones&rft.aufirst=AB&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Psychological Association, 750 First St., N.E., Washington, DC 20002-4242, USA; phone: (202) 336-5500; email: convention.office@apa.org; URL: http://www.apa.org, Contact APA for availability. Final Program $5. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Intelligent computer aided design of geothermal plants AN - 41478292; 3410653 AU - Wu, Chih Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41478292?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Intelligent+computer+aided+design+of+geothermal+plants&rft.au=Wu%2C+Chih&rft.aulast=Wu&rft.aufirst=Chih&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: World Renewable Energy, 147, Hilmanton, Lower Earley, Reading RG6 4HN, UK; phone: 44-11 89 61 13 64; fax: 44-11 89 61 13 65; email: asayigh@netcomuk.co.uk, Abstracts available. Contact WREN for price. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Gender-integrated basic training AN - 41477524; 3402401 AU - Whitehead, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3500:Clinical Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41477524?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Gender-integrated+basic+training&rft.au=Whitehead%2C+C&rft.aulast=Whitehead&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Psychological Association, 750 First St., N.E., Washington, DC 20002-4242, USA; phone: (202) 336-5500; email: convention.office@apa.org; URL: http://www.apa.org, Contact APA for availability. Final Program $5. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Demographics of local conservation districts: Who are our clients? AN - 41470612; 3389406 AU - Long, J AU - Buland, D AU - Graves, E AU - Kendall, C AU - Knight, L AU - Shockley, M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5700:Marine Science KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41470612?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Demographics+of+local+conservation+districts%3A+Who+are+our+clients%3F&rft.au=Long%2C+J%3BBuland%2C+D%3BGraves%2C+E%3BKendall%2C+C%3BKnight%2C+L%3BShockley%2C+M&rft.aulast=Long&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Soil and Water Conservation Society, 7515 NE Ankeny Road, Ankeny, IA 50021, USA; phone: (515) 289-2331; fax: (515) 289-1227; URL: http://www.swcs.org, Abstracts available. Contact SWCS for price. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Color of polarization in cuprate superconductors AN - 41458775; 2212273 AU - Hoff, HA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41458775?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Color+of+polarization+in+cuprate+superconductors&rft.au=Hoff%2C+HA&rft.aulast=Hoff&rft.aufirst=HA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AMSAHTS '90, c/o Carmen L. Warren, Westover Consultants Inc., 6303 Ivy Lane, Suite 416, Greenbelt, MD 20770, USA. Telephone: 301-220-0685. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - U.S. Navy superconductivity efforts AN - 41449197; 2212300 AU - Gubser, D D Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41449197?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=U.S.+Navy+superconductivity+efforts&rft.au=Gubser%2C+D+D&rft.aulast=Gubser&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AMSAHTS '90, c/o Carmen L. Warren, Westover Consultants Inc., 6303 Ivy Lane, Suite 416, Greenbelt, MD 20770, USA. Telephone: 301-220-0685. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Communication traps for engineers AN - 41448177; 2172014 AU - Shapiro, M F Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41448177?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Communication+traps+for+engineers&rft.au=Shapiro%2C+M+F&rft.aulast=Shapiro&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Hazardous Materials Control Research Institute, 9300 Columbia Boulevard, Silver Spring, MD 20910-1702. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Mapping barrier island plant community alliances using 30-m Landsat Thematic Mapper (TM) imagery and airborne videography: Limitations of the 30 meter data AN - 41434022; 3383736 AU - Rasberry, DA AU - Becker, P G AU - Gast, R A AU - Palmer, T A Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41434022?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Mapping+barrier+island+plant+community+alliances+using+30-m+Landsat+Thematic+Mapper+%28TM%29+imagery+and+airborne+videography%3A+Limitations+of+the+30+meter+data&rft.au=Rasberry%2C+DA%3BBecker%2C+P+G%3BGast%2C+R+A%3BPalmer%2C+T+A&rft.aulast=Rasberry&rft.aufirst=DA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Ecological Society of America, Ecology Center, Utah State University, Logan, UT 84322-5205, USA; phone: (801) 797-2555; email: fwagner@cc.usu.edu; URL: http://esa.sdsc.edu/98meet.htm, Abstracts available. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Residue Polynomial Systems AN - 41420693; 3374356 AU - Turner, PR Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:Mathematics and Computer Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41420693?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Residue+Polynomial+Systems&rft.au=Turner%2C+PR&rft.aulast=Turner&rft.aufirst=PR&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Laboratoire d'Informatique de Paris 6, 4, place Jussieu, F-75252 Paris Cedex 05, France; phone: +33 1 44 27 71 34; fax: +33 1 44 27 62 86, Full papers available. No charge N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - U.S. DoD program for global surveillance of emerging diseases AN - 41403567; 3365553 AU - McCarthy, M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 7000:Multidisciplinary UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41403567?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=U.S.+DoD+program+for+global+surveillance+of+emerging+diseases&rft.au=McCarthy%2C+M&rft.aulast=McCarthy&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Centers for Disease Control and Prevention, 1600 Clifton Road, NE, Atlanta, GA 30333, USA; phone: (404) 639-3311; URL: http://www.cdc.gov, Abstracts available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Disruption of gypsy moth mating and population suppression following ground application of racemic disparlure AN - 41388041; 2011549 AU - Kolodny-Hirsch, D M AU - Webb, R E AU - Olsen, R A AU - Venables, L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2000:BIOLOGY GENERAL UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41388041?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Disruption+of+gypsy+moth+mating+and+population+suppression+following+ground+application+of+racemic+disparlure&rft.au=Kolodny-Hirsch%2C+D+M%3BWebb%2C+R+E%3BOlsen%2C+R+A%3BVenables%2C+L&rft.aulast=Kolodny-Hirsch&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Conference proceedings will not be published N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - The concept of weight AN - 41381585; 2029152 AU - Mosca, E P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41381585?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=The+concept+of+weight&rft.au=Mosca%2C+E+P&rft.aulast=Mosca&rft.aufirst=E&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AAPT, 5112 Berwyn Road, College Park, MD 20740 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Aspects of gunfire: Part I--analysis AN - 41374267; 2088127 AU - Merritt, R G AU - Hertz Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:CHEMISTRY AND CHEMICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41374267?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Aspects+of+gunfire%3A+Part+I--analysis&rft.au=Merritt%2C+R+G%3BHertz&rft.aulast=Merritt&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: IES, 940 East Northwest Highway, Mount Prospect, IL 60056 (USA). Telephone: (312) 255-1561 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Numerical simulation of 3-d compressible MHD turbulence AN - 41371872; 2018609 AU - Dahlburg, RB Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41371872?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Numerical+simulation+of+3-d+compressible+MHD+turbulence&rft.au=Dahlburg%2C+RB&rft.aulast=Dahlburg&rft.aufirst=RB&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Radiated noise increase of a submerged turbulent jet flow due to bubble entrainment AN - 41371177; 2006658 AU - Korman AU - Pumphrey, H C AU - Crum, LA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41371177?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Radiated+noise+increase+of+a+submerged+turbulent+jet+flow+due+to+bubble+entrainment&rft.au=Korman%3BPumphrey%2C+H+C%3BCrum%2C+LA&rft.aulast=Korman&rft.aufirst=&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, Subscription Fulfillment Division, 335 East 45th Street, New York, NY 10017 (USA), Abstracts will be published in the Journal of Acoustical Society of America. Supplement 1. Vol. 84 Fall 1988. ISSN: 0163-0962 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Development of a small inland oil skimmer for the Navy AN - 41370875; 2040702 AU - Zimmerle, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE KW - U 2500:CHEMISTRY AND CHEMICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41370875?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Development+of+a+small+inland+oil+skimmer+for+the+Navy&rft.au=Zimmerle%2C+J&rft.aulast=Zimmerle&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: 1989 Oil Spill Conference, Suite 300, 655 15th Street, NW, Washington, DC 20005 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Nature of regulatory entomology in 2010 AN - 41367311; 3347675 AU - Gimpel, WF Jr Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science KW - U 2000:Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41367311?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Nature+of+regulatory+entomology+in+2010&rft.au=Gimpel%2C+WF+Jr&rft.aulast=Gimpel&rft.aufirst=WF&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Entomological Society of America, 9301 Annapolis Road, Lanham, MD 20706-3115, Contact individual authors directly, or search abstracts at http://www.sheridan.com/entsoc/abs N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - VLBI measurements of interstellar methanol masers AN - 41365917; 2018002 AU - Menten, K M AU - Reid, MJ AU - Moran, J M AU - Johnston, K J AU - Walmsley, C M AU - Wilson, T L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41365917?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=VLBI+measurements+of+interstellar+methanol+masers&rft.au=Menten%2C+K+M%3BReid%2C+MJ%3BMoran%2C+J+M%3BJohnston%2C+K+J%3BWalmsley%2C+C+M%3BWilson%2C+T+L&rft.aulast=Menten&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Optical properties of a near-UV solar imaging channelled spectrograph AN - 41365793; 2019230 AU - Korendyke, C M AU - Socker, D G Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41365793?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Optical+properties+of+a+near-UV+solar+imaging+channelled+spectrograph&rft.au=Korendyke%2C+C+M%3BSocker%2C+D+G&rft.aulast=Korendyke&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Magnetic field strength and brightness of fine structure elements in the solar T sub(min) region AN - 41361058; 2019203 AU - Cook, J W AU - Ewing, JA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41361058?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Magnetic+field+strength+and+brightness+of+fine+structure+elements+in+the+solar+T+sub%28min%29+region&rft.au=Cook%2C+J+W%3BEwing%2C+JA&rft.aulast=Cook&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - On the formation of coronal current sheets without null points AN - 41359151; 2020352 AU - Antiochos, S K AU - Karpen, J T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41359151?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=On+the+formation+of+coronal+current+sheets+without+null+points&rft.au=Antiochos%2C+S+K%3BKarpen%2C+J+T&rft.aulast=Antiochos&rft.aufirst=S&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Ultracompact cometary HII regions: Expansive HII regions undergoing a champagne flow? AN - 41358718; 2022541 AU - Gaume, R A AU - Claussen, MJ Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41358718?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Ultracompact+cometary+HII+regions%3A+Expansive+HII+regions+undergoing+a+champagne+flow%3F&rft.au=Gaume%2C+R+A%3BClaussen%2C+MJ&rft.aulast=Gaume&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - W30 revealed: Improved estimates of physical properties of the W30 thermal and nonthermal components from 90 cm VLA observations AN - 41358629; 2022378 AU - Kassim, N E AU - Weiler, K W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41358629?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=W30+revealed%3A+Improved+estimates+of+physical+properties+of+the+W30+thermal+and+nonthermal+components+from+90+cm+VLA+observations&rft.au=Kassim%2C+N+E%3BWeiler%2C+K+W&rft.aulast=Kassim&rft.aufirst=N&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - A programmatic approach to endangered species management on DOD lands AN - 41358553; 1988021 AU - Divittorio, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41358553?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=A+programmatic+approach+to+endangered+species+management+on+DOD+lands&rft.au=Divittorio%2C+J&rft.aulast=Divittorio&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASA, 677 South Segoe Road, Madison, WI 53711 (USA). Telephone: (608)-273-8080. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Variation in adult populations of the potato leafhopper and feeding injury among clones of red maple AN - 41356841; 3348111 AU - Bentz, J AU - Townsend, A M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science KW - U 2000:Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41356841?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Variation+in+adult+populations+of+the+potato+leafhopper+and+feeding+injury+among+clones+of+red+maple&rft.au=Bentz%2C+J%3BTownsend%2C+A+M&rft.aulast=Bentz&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Entomological Society of America, 9301 Annapolis Road, Lanham, MD 20706-3115, Contact individual authors directly, or search abstracts at http://www.sheridan.com/entsoc/abs. Poster Paper No. D678 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Astrophysics with a SIMD massively parallel processor AN - 41353583; 2019603 AU - Hertz, P AU - Norris, J P AU - McMillan, SLW Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41353583?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Astrophysics+with+a+SIMD+massively+parallel+processor&rft.au=Hertz%2C+P%3BNorris%2C+J+P%3BMcMillan%2C+SLW&rft.aulast=Hertz&rft.aufirst=P&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Distribution of Rhinocyllus conicus on Carduus thistles in Maryland AN - 41353562; 2014591 AU - Tipping, P W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2000:BIOLOGY GENERAL UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41353562?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Distribution+of+Rhinocyllus+conicus+on+Carduus+thistles+in+Maryland&rft.au=Tipping%2C+P+W&rft.aulast=Tipping&rft.aufirst=P&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Conference proceedings will not be published N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Towards the establishment of a radio reference frame AN - 41347468; 2019571 AU - Russell, J L AU - Johnston, K J AU - Ma, C AU - Schaffer, D AU - Jauncey, D AU - White, G Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41347468?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Towards+the+establishment+of+a+radio+reference+frame&rft.au=Russell%2C+J+L%3BJohnston%2C+K+J%3BMa%2C+C%3BSchaffer%2C+D%3BJauncey%2C+D%3BWhite%2C+G&rft.aulast=Russell&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Visibility measurements with the Mount Wilson optical interferometer AN - 41345170; 2019651 AU - Mozurkewich, D AU - Simon, R AU - Hutter, D AU - Johnston, K AU - Colavita, M AU - Shao, M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41345170?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Visibility+measurements+with+the+Mount+Wilson+optical+interferometer&rft.au=Mozurkewich%2C+D%3BSimon%2C+R%3BHutter%2C+D%3BJohnston%2C+K%3BColavita%2C+M%3BShao%2C+M&rft.aulast=Mozurkewich&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - MG1654 + 1346: Einstein ring of a radio lobe? AN - 41345024; 2019517 AU - Langston, GI AU - Schneider, D P AU - Conner, S AU - Carilli, CL AU - Lehar, J AU - Burke, B F Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41345024?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=MG1654+%2B+1346%3A+Einstein+ring+of+a+radio+lobe%3F&rft.au=Langston%2C+GI%3BSchneider%2C+D+P%3BConner%2C+S%3BCarilli%2C+CL%3BLehar%2C+J%3BBurke%2C+B+F&rft.aulast=Langston&rft.aufirst=GI&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Numerical simulations of the rebound shock model for spicules AN - 41344823; 2019199 AU - Sterling, A C AU - Mariska, J T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41344823?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Numerical+simulations+of+the+rebound+shock+model+for+spicules&rft.au=Sterling%2C+A+C%3BMariska%2C+J+T&rft.aulast=Sterling&rft.aufirst=A&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Ca XIX X-ray emission-line signatures of impulsively heated solar flares AN - 41344516; 2018595 AU - Mariska, J T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41344516?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Ca+XIX+X-ray+emission-line+signatures+of+impulsively+heated+solar+flares&rft.au=Mariska%2C+J+T&rft.aulast=Mariska&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Astronomical Society, 2000 Florida Avenue, NW, Washington, DC 20009 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Behavior of American shad (Alosa sapidissima) and blueback herring (A. aestivalis) in an ice harbor fishway AN - 41344487; 3326951 AU - Sutherland, D AU - Kynard, B Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science KW - U 5700:Marine Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41344487?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Behavior+of+American+shad+%28Alosa+sapidissima%29+and+blueback+herring+%28A.+aestivalis%29+in+an+ice+harbor+fishway&rft.au=Sutherland%2C+D%3BKynard%2C+B&rft.aulast=Sutherland&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Fisheries Society, 5410 Grosvenor Lane #110, Bethesda, MD 20814. Phone: 301-897-8616 ext. 200; Fax: 301-897-8096, Abstracts available. Price $15. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Biostructural shoreline stabilization and wetland creation at Severn River, Naval Station, Annapolis, MD AN - 41343872; 1977642 AU - Berc, J L AU - Ailstock Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41343872?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Biostructural+shoreline+stabilization+and+wetland+creation+at+Severn+River%2C+Naval+Station%2C+Annapolis%2C+MD&rft.au=Berc%2C+J+L%3BAilstock&rft.aulast=Berc&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASA, 677 South Segoe Road, Madison, WI 53711 (USA). Telephone: (608)-273-8080. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - A tree grows on Adak: Species and provenance trials for Aleutian windbreaks AN - 41343772; 1977637 AU - Briggs, W R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:ANIMAL AND PLANT SCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41343772?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=A+tree+grows+on+Adak%3A+Species+and+provenance+trials+for+Aleutian+windbreaks&rft.au=Briggs%2C+W+R&rft.aulast=Briggs&rft.aufirst=W&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASA, 677 South Segoe Road, Madison, WI 53711 (USA). Telephone: (608)-273-8080. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Application of piezoelectric composite for large-area hydrophone arrays AN - 41342726; 2003077 AU - Geil, F G AU - Ting, R Y Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41342726?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Application+of+piezoelectric+composite+for+large-area+hydrophone+arrays&rft.au=Geil%2C+F+G%3BTing%2C+R+Y&rft.aulast=Geil&rft.aufirst=F&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Institute of Physics, Subscription Fulfillment Division, 335 East 45th Street, New York, NY 10017 (USA), Abstracts will be published in the Journal of Acoustical Society of America. Supplement 1. Vol. 84 Fall 1988. ISSN: 0163-0962 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Interaction of a shallow, supercritical marine boundary layer with steep coastal orography AN - 41340262; 3323447 AU - Burk, S D AU - Haack, T AU - Thompson, W T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41340262?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Interaction+of+a+shallow%2C+supercritical+marine+boundary+layer+with+steep+coastal+orography&rft.au=Burk%2C+S+D%3BHaack%2C+T%3BThompson%2C+W+T&rft.aulast=Burk&rft.aufirst=S&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected abstracts available. Price $60. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Tropical cyclone surface wind information from satellite scatterometers and SSM/I data AN - 41337041; 3317350 AU - Hawkins, J D AU - Helveston, MJ Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41337041?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Tropical+cyclone+surface+wind+information+from+satellite+scatterometers+and+SSM%2FI+data&rft.au=Hawkins%2C+J+D%3BHelveston%2C+MJ&rft.aulast=Hawkins&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - SSM/I derived tropical cyclone intensities AN - 41336923; 3317331 AU - May, DA AU - Sandidge, J AU - Holyer, R AU - Hawkins, J D Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41336923?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=SSM%2FI+derived+tropical+cyclone+intensities&rft.au=May%2C+DA%3BSandidge%2C+J%3BHolyer%2C+R%3BHawkins%2C+J+D&rft.aulast=May&rft.aufirst=DA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Automating the subjective analysis of satellite-observed tropical cyclone intensity AN - 41335157; 3317336 AU - Bankert, R L AU - Tag, P M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41335157?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Automating+the+subjective+analysis+of+satellite-observed+tropical+cyclone+intensity&rft.au=Bankert%2C+R+L%3BTag%2C+P+M&rft.aulast=Bankert&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Utilization of satellite-derived tropical rainfall for analysis and assimilation into a numerical weather prediction model AN - 41334634; 3317492 AU - Turk, J AU - Rohaly, G D AU - Arkin, P A Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41334634?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Utilization+of+satellite-derived+tropical+rainfall+for+analysis+and+assimilation+into+a+numerical+weather+prediction+model&rft.au=Turk%2C+J%3BRohaly%2C+G+D%3BArkin%2C+P+A&rft.aulast=Turk&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Estimates of the inherent and practical limits of predictability of mean forecast track errors of tropical cyclones: Part II AN - 41334564; 3317405 AU - Abbey, RF Jr AU - Leslie, L M AU - Holland, G J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41334564?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Estimates+of+the+inherent+and+practical+limits+of+predictability+of+mean+forecast+track+errors+of+tropical+cyclones%3A+Part+II&rft.au=Abbey%2C+RF+Jr%3BLeslie%2C+L+M%3BHolland%2C+G+J&rft.aulast=Abbey&rft.aufirst=RF&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Automated tropical cyclone forecasting system (version 3.0) AN - 41331498; 3317669 AU - Sampson, C R AU - Schrader, A J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41331498?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Automated+tropical+cyclone+forecasting+system+%28version+3.0%29&rft.au=Sampson%2C+C+R%3BSchrader%2C+A+J&rft.aulast=Sampson&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - NOGAPS 1996 tropical cyclone forecast performance AN - 41331472; 3317668 AU - Goerss, J S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41331472?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=NOGAPS+1996+tropical+cyclone+forecast+performance&rft.au=Goerss%2C+J+S&rft.aulast=Goerss&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Examination of initial condition sensitivity in the forecast of a tropical cyclone AN - 41331401; 3317489 AU - Rohaly, G D AU - Langland, R H AU - Gelaro, R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41331401?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Examination+of+initial+condition+sensitivity+in+the+forecast+of+a+tropical+cyclone&rft.au=Rohaly%2C+G+D%3BLangland%2C+R+H%3BGelaro%2C+R&rft.aulast=Rohaly&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Performance evaluation of the naval research laboratory coamps on the forecast of typhoon Herb in the Western Pacific in 1996 AN - 41330495; 3317622 AU - Peng AU - Chang, S W AU - Hodur, R M Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41330495?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Performance+evaluation+of+the+naval+research+laboratory+coamps+on+the+forecast+of+typhoon+Herb+in+the+Western+Pacific+in+1996&rft.au=Peng%3BChang%2C+S+W%3BHodur%2C+R+M&rft.aulast=Peng&rft.aufirst=&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Two- and three-dimensional turbulence budgets in the presence of roll-like structures AN - 41325366; 3323356 AU - Glendening, J W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience KW - U 4300:Environmental Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41325366?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Two-+and+three-dimensional+turbulence+budgets+in+the+presence+of+roll-like+structures&rft.au=Glendening%2C+J+W&rft.aulast=Glendening&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected abstracts available. Price $60. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Successful applications of thermal spray on U.S. naval ship restoration parts AN - 41321770; 1956145 AU - Gato, F AU - Herbstritt, J AU - Travis, R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41321770?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Successful+applications+of+thermal+spray+on+U.S.+naval+ship+restoration+parts&rft.au=Gato%2C+F%3BHerbstritt%2C+J%3BTravis%2C+R&rft.aulast=Gato&rft.aufirst=F&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Customer Service Center, ASM International, Metals Park, OH 44073 (USA). Telephone: 216 338 5151. Fax: 216 338 4634., Price: $85.00 (ASM Members-$68.00) Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Development and use of fish indices of biotic integrity to assess the effects of acidification on Maryland streams AN - 41320856; 3327033 AU - Klauda, RJ AU - Stranko, SA AU - Kazyak, P F AU - Roth, N E AU - Southerland, M T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science KW - U 5700:Marine Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41320856?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Development+and+use+of+fish+indices+of+biotic+integrity+to+assess+the+effects+of+acidification+on+Maryland+streams&rft.au=Klauda%2C+RJ%3BStranko%2C+SA%3BKazyak%2C+P+F%3BRoth%2C+N+E%3BSoutherland%2C+M+T&rft.aulast=Klauda&rft.aufirst=RJ&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Fisheries Society, 5410 Grosvenor Lane #110, Bethesda, MD 20814. Phone: 301-897-8616 ext. 200; Fax: 301-897-8096, Abstracts available. Price $15. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Singular vectors, sensitivity analysis, and adaptive observations for tropical cyclones AN - 41320022; 3317491 AU - Gelaro, R AU - Rohaly, G D Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41320022?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Singular+vectors%2C+sensitivity+analysis%2C+and+adaptive+observations+for+tropical+cyclones&rft.au=Gelaro%2C+R%3BRohaly%2C+G+D&rft.aulast=Gelaro&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Impact behaviour of fibre-reinforced ceramic matrix composites AN - 41312556; 1865009 AU - Hasson, D F AU - Fishman, S G Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41312556?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Impact+behaviour+of+fibre-reinforced+ceramic+matrix+composites&rft.au=Hasson%2C+D+F%3BFishman%2C+S+G&rft.aulast=Hasson&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Canadian Institute of Mining and Metallurgy, Suite 400, 1130 Sherbrooke Street, West, Montreal, Que. H3A 2M8 (Canada) Telephone (514) 842-3461, Telex 055-62344 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Estimates of central Appalachian coal reserves by cost of production and sulfur content AN - 41312200; 1955602 AU - Watkins, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:GEOSCIENCE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41312200?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Estimates+of+central+Appalachian+coal+reserves+by+cost+of+production+and+sulfur+content&rft.au=Watkins%2C+J&rft.aulast=Watkins&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: AAPG, Box 979, Tulsa, OK 74101 (USA) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Metal spray coatings--marine performance and mechanisms AN - 41297731; 1955885 AU - Shaw, BA AU - Morton, T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41297731?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Metal+spray+coatings--marine+performance+and+mechanisms&rft.au=Shaw%2C+BA%3BMorton%2C+T&rft.aulast=Shaw&rft.aufirst=BA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Customer Service Center, ASM International, Metals Park, OH 44073 (USA). Telephone: 216 338 5151. Fax: 216 338 4634., Price: $85.00 (ASM Members-$68.00) N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Eyes under the sea--the U.S. Navy and underwater imaging AN - 41291854; 1863011 AU - Harris, D J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41291854?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Eyes+under+the+sea--the+U.S.+Navy+and+underwater+imaging&rft.au=Harris%2C+D+J&rft.aulast=Harris&rft.aufirst=D&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: SPIE, P.O. Box 10, Bellingham, WA 98227-0010 (USA). Telephone: (206) 676-3290 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Sea surface temperature and the 1995 hurricane season AN - 41287034; 3317367 AU - Strong, A E AU - Valdivia, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41287034?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Sea+surface+temperature+and+the+1995+hurricane+season&rft.au=Strong%2C+A+E%3BValdivia%2C+J&rft.aulast=Strong&rft.aufirst=A&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Meteorological Society, 45 Beacon Street, Boston, MA 02108-3693, Selected full papers available. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Attenuation of seismic waveforms through methane hydrate and gas stability zones on the Blake Ridge AN - 41283989; 3294972 AU - Wood, W T AU - Holbrook, W S AU - Hoskins, H AU - Rowe, M M AU - Gettrust, J Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41283989?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Attenuation+of+seismic+waveforms+through+methane+hydrate+and+gas+stability+zones+on+the+Blake+Ridge&rft.au=Wood%2C+W+T%3BHolbrook%2C+W+S%3BHoskins%2C+H%3BRowe%2C+M+M%3BGettrust%2C+J&rft.aulast=Wood&rft.aufirst=W&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Geophysical Union, 2000 Florida Avenue, NW, Washington, DC 20009, Abstracts available. Price $25. Paper No. OG31C-8 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Observations and mesoscale modeling of a summertime coastal low-level jet AN - 41280082; 3293480 AU - Burk, S AU - Thompson, W AU - Haack, T AU - Holt, T AU - Hodur, R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41280082?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Observations+and+mesoscale+modeling+of+a+summertime+coastal+low-level+jet&rft.au=Burk%2C+S%3BThompson%2C+W%3BHaack%2C+T%3BHolt%2C+T%3BHodur%2C+R&rft.aulast=Burk&rft.aufirst=S&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Geophysical Union, 2000 Florida Avenue, NW, Washington, DC 20009, Abstracts available. Price $25. Paper No. A41B-8 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Satellite passive microwave remote sensing of sea ice in the Laptev Sea AN - 41279318; 3295675 AU - Brigham, L W Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41279318?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Satellite+passive+microwave+remote+sensing+of+sea+ice+in+the+Laptev+Sea&rft.au=Brigham%2C+L+W&rft.aulast=Brigham&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Geophysical Union, 2000 Florida Avenue, NW, Washington, DC 20009, Abstracts available. Price $25. Paper No. OS22D-9 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Filaments structure along the Oman coast during the 1995 monsoon AN - 41277908; 3295409 AU - Arnone, R A AU - Martinolich, P AU - Kindle, J AU - Brink, KH AU - Lee, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41277908?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Filaments+structure+along+the+Oman+coast+during+the+1995+monsoon&rft.au=Arnone%2C+R+A%3BMartinolich%2C+P%3BKindle%2C+J%3BBrink%2C+KH%3BLee%2C+C&rft.aulast=Arnone&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Geophysical Union, 2000 Florida Avenue, NW, Washington, DC 20009, Abstracts available. Price $25. Paper No. OS72C-11 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Rayleigh-Taylor instability: Comparison of hybrid and non-ideal MHD simulations AN - 41268373; 3297200 AU - Huba, J D AU - Schwartz, I AU - Winske, D AU - Strasburg, S Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41268373?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Rayleigh-Taylor+instability%3A+Comparison+of+hybrid+and+non-ideal+MHD+simulations&rft.au=Huba%2C+J+D%3BSchwartz%2C+I%3BWinske%2C+D%3BStrasburg%2C+S&rft.aulast=Huba&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Geophysical Union, 2000 Florida Avenue, NW, Washington, DC 20009, Abstracts available. Price $25. Poster Paper No. SM21B-8 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - OMVPE growth of device quality AlInAs/InGaAs and AlInAs/InP heterostructures AN - 41267079; 1778329 AU - Aina, L AU - Mattingly, M AU - Martin, E AU - Stecker, L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 4000:ELECTRICAL ENGINEERING KW - U 6000:MATERIALS SCIENCE AND ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41267079?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=OMVPE+growth+of+device+quality+AlInAs%2FInGaAs+and+AlInAs%2FInP+heterostructures&rft.au=Aina%2C+L%3BMattingly%2C+M%3BMartin%2C+E%3BStecker%2C+L&rft.aulast=Aina&rft.aufirst=L&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: The Metallurgical Society, 420 Commonwealth Drive, Warrendale, PA 15086 (USA). Telephone (412) 776-9080; Fax (412) 776-3770; Telex 9103809397 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Predicting the ductile-to-brittle transition in nuclear pressure vessel steels from charpy surveillance specimens AN - 41260378; 3299851 AU - Joyce, JA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:Chemistry and Chemical Engineering UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41260378?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Predicting+the+ductile-to-brittle+transition+in+nuclear+pressure+vessel+steels+from+charpy+surveillance+specimens&rft.au=Joyce%2C+JA&rft.aulast=Joyce&rft.aufirst=JA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: The Minerals, Metals, and Materials Society, Customer Service, 420 Commonwealth Drive, Warrendale, PA 15086; phone: (412)776-9000, ext. 270; fax: (412)776-3770, Full papers available. N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Determination of seabed parameters from far field acoustic data AN - 41246298; 3288107 AU - Buchanan, J L AU - Gilbert, R P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:Mathematics and Computer Science UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41246298?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Determination+of+seabed+parameters+from+far+field+acoustic+data&rft.au=Buchanan%2C+J+L%3BGilbert%2C+R+P&rft.aulast=Buchanan&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Mathematical Society, PO Box 6248, Providence, RI 02940. Phone: 1-800-321-4267 or 1-401-455-4000, Abstracts available. Paper No. 915-86-241 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - John A. Davidson: Entomologist, naturalist, philosopher, theorist, and part-time fisherman AN - 41238386; 3286595 AU - Gimpel, WF Jr Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 1000:Animal and Plant Science KW - U 2000:Biology UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41238386?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=John+A.+Davidson%3A+Entomologist%2C+naturalist%2C+philosopher%2C+theorist%2C+and+part-time+fisherman&rft.au=Gimpel%2C+WF+Jr&rft.aulast=Gimpel&rft.aufirst=WF&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Entomological Society of America, 9301 Annapolis Road, Lanham, MD 20706-3115, Contact authors directly for individual papers. Paper No. 0048 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Comparison of two commercial liquid microclimate cooling systems AN - 41226672; 1696730 AU - Pimental, NA AU - Janik, C R AU - Avellini, BA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 0500:AEROSPACE SCIENCES AND ENGINEERING KW - U 3500:CLINICAL MEDICINE UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41226672?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Comparison+of+two+commercial+liquid+microclimate+cooling+systems&rft.au=Pimental%2C+NA%3BJanik%2C+C+R%3BAvellini%2C+BA&rft.aulast=Pimental&rft.aufirst=NA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Abstract No. 164 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Absorption heat pumping for district heating now practical AN - 41220486; 1707454 AU - Davidson, W F AU - Erickson, D C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41220486?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Absorption+heat+pumping+for+district+heating+now+practical&rft.au=Davidson%2C+W+F%3BErickson%2C+D+C&rft.aulast=Davidson&rft.aufirst=W&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: A.S.H.R.A.E., 1791 Tullie Circle N.E., Atlanta, GA 30329 (USA); telephone (404) 636-8400, Proceedings $110; pre-print papers $4 each Paper No. DA-88-4-1 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Comparing human performance on spatially dynamic tasks using volumetric, perspective, and stereoscopic 3D displays AN - 41216819; 3271344 AU - Broyles, J W AU - Van Orden, KF Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3500:Clinical Medicine UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41216819?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Comparing+human+performance+on+spatially+dynamic+tasks+using+volumetric%2C+perspective%2C+and+stereoscopic+3D+displays&rft.au=Broyles%2C+J+W%3BVan+Orden%2C+KF&rft.aulast=Broyles&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Human Factors & Ergonomics Society, PO Box 1369, Santa Monica, CA 90406-1369, Abstracts and full papers available. Poster Paper N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Stars & Stripes: The design/technology team AN - 41209536; 1699754 AU - Salvesen, N Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 7000:MUTIDISCIPLINARY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41209536?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Stars+%26amp%3B+Stripes%3A+The+design%2Ftechnology+team&rft.au=Salvesen%2C+N&rft.aulast=Salvesen&rft.aufirst=N&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: American Association for the Advancement of Science, 1333 H Street N.W., Washington, DC 20005 (USA), AAAS Publication 87-31 contains abstracts of papers presented at the meeting N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - VLA observations of the radio position of UX Ari AN - 41207406; 1643470 AU - Johnston, K J AU - Stolovy, S AU - Russell, J AU - Florkowski, D AU - DeVegt, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41207406?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=VLA+observations+of+the+radio+position+of+UX+Ari&rft.au=Johnston%2C+K+J%3BStolovy%2C+S%3BRussell%2C+J%3BFlorkowski%2C+D%3BDeVegt%2C+C&rft.aulast=Johnston&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 8.05 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Optimal performance of a cascade endoreversible cycle AN - 41205029; 1676797 AU - Wu, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 3000:CIVIL AND MECHANICAL ENGINEERING UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41205029?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Optimal+performance+of+a+cascade+endoreversible+cycle&rft.au=Wu%2C+C&rft.aulast=Wu&rft.aufirst=C&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: ASME, 22 Law Drive, P.O. Box 2900, Fairfield, NJ 07007-2900 (USA), Papers and proceedings volumes available airfield, NJ 07007-2900 (USA) Paper No. 87-WA/DSC-6 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Astrometric radio and optical observations of T Tau AN - 41195148; 1645496 AU - Russell, J AU - Johnston, K J AU - Schwartz, PR AU - DdVegt, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41195148?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Astrometric+radio+and+optical+observations+of+T+Tau&rft.au=Russell%2C+J%3BJohnston%2C+K+J%3BSchwartz%2C+PR%3BDdVegt%2C+C&rft.aulast=Russell&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 46.24 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Sunspot - cycle variations of the interplanetary field strength: Implications for coronal models AN - 41193198; 1646231 AU - Wang, Y-M AU - Sheeley, NR Jr AU - DeVore, C R Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41193198?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Sunspot+-+cycle+variations+of+the+interplanetary+field+strength%3A+Implications+for+coronal+models&rft.au=Wang%2C+Y-M%3BSheeley%2C+NR+Jr%3BDeVore%2C+C+R&rft.aulast=Wang&rft.aufirst=Y-M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 70.09 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Production of heat energy in a potential magnetic field AN - 41192913; 1646016 AU - Dahlburg, RB AU - Mariska, J T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41192913?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Production+of+heat+energy+in+a+potential+magnetic+field&rft.au=Dahlburg%2C+RB%3BMariska%2C+J+T&rft.aulast=Dahlburg&rft.aufirst=RB&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 62.03 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - New, high precision metal meshes for IR astronomy fabricated with microelectronic techniques AN - 41192568; 1644086 AU - Smith, HA AU - fischer, J AU - Taylor, J AU - Ade, P AU - Davis, G AU - Furniss, I Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41192568?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=New%2C+high+precision+metal+meshes+for+IR+astronomy+fabricated+with+microelectronic+techniques&rft.au=Smith%2C+HA%3Bfischer%2C+J%3BTaylor%2C+J%3BAde%2C+P%3BDavis%2C+G%3BFurniss%2C+I&rft.aulast=Smith&rft.aufirst=HA&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 29.07 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - VLBI observations of interferometric phase scintillation in the IPM AN - 41191801; 1644091 AU - Simon, R S AU - Dennison, B AU - Ananthakrishnan, S AU - Fiedler, R L Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41191801?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=VLBI+observations+of+interferometric+phase+scintillation+in+the+IPM&rft.au=Simon%2C+R+S%3BDennison%2C+B%3BAnanthakrishnan%2C+S%3BFiedler%2C+R+L&rft.aulast=Simon&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 29.10 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Effects of compressibility on dynamic alignment in the solar wind AN - 41190741; 1646079 AU - Picone, J M AU - Dahlburg, RB AU - Karpen, J T Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41190741?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Effects+of+compressibility+on+dynamic+alignment+in+the+solar+wind&rft.au=Picone%2C+J+M%3BDahlburg%2C+RB%3BKarpen%2C+J+T&rft.aulast=Picone&rft.aufirst=J&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 62.12 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Search for super(56)CO gamma -ray lines from SN1987A AN - 41187368; 1645591 AU - Share, G H AU - Matz, S M AU - Leising, MD AU - Chupp, EL AU - Vestrand, W T AU - Reppin, C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41187368?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Search+for+super%2856%29CO+gamma+-ray+lines+from+SN1987A&rft.au=Share%2C+G+H%3BMatz%2C+S+M%3BLeising%2C+MD%3BChupp%2C+EL%3BVestrand%2C+W+T%3BReppin%2C+C&rft.aulast=Share&rft.aufirst=G&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 48.05 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - High density material in molecular outflows AN - 41187097; 1646139 AU - Mead, K N AU - Evans, N J AU - Kutner, M L AU - Natta, A Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41187097?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=High+density+material+in+molecular+outflows&rft.au=Mead%2C+K+N%3BEvans%2C+N+J%3BKutner%2C+M+L%3BNatta%2C+A&rft.aulast=Mead&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 65.03 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Chromospheric and transition zone flows in a solar active region AN - 41185393; 1645980 AU - Dere, K P AU - Schmieder, B Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41185393?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Chromospheric+and+transition+zone+flows+in+a+solar+active+region&rft.au=Dere%2C+K+P%3BSchmieder%2C+B&rft.aulast=Dere&rft.aufirst=K&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 61.08 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Application of a maximum likelihood analysis to detection of sources in the ROSAT database AN - 41181751; 1635097 AU - Cruddace, R G AU - Hasinger, G R AU - Schmitt, J H Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 6500:MATHEMATICS KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41181751?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=Application+of+a+maximum+likelihood+analysis+to+detection+of+sources+in+the+ROSAT+database&rft.au=Cruddace%2C+R+G%3BHasinger%2C+G+R%3BSchmitt%2C+J+H&rft.aulast=Cruddace&rft.aufirst=R&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: No ordering information available at the present time, Poster Papers N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - VLA observations of Galactic SNR candidates from the Clark Lake Galactic Plane Survey AN - 41177006; 1644651 AU - Kassim, N E AU - Erickson, W C Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41177006?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=VLA+observations+of+Galactic+SNR+candidates+from+the+Clark+Lake+Galactic+Plane+Survey&rft.au=Kassim%2C+N+E%3BErickson%2C+W+C&rft.aulast=Kassim&rft.aufirst=N&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 45.05 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - X-ray diffraction analysis of strain and mosaic structure in (001) oriented homoepitaxial diamond films AN - 41172135; 3250834 AU - Alexander, W B AU - Pehrsson, P E AU - Black, D AU - Butler, JE Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 2500:Chemistry and Chemical Engineering UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41172135?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=X-ray+diffraction+analysis+of+strain+and+mosaic+structure+in+%28001%29+oriented+homoepitaxial+diamond+films&rft.au=Alexander%2C+W+B%3BPehrsson%2C+P+E%3BBlack%2C+D%3BButler%2C+JE&rft.aulast=Alexander&rft.aufirst=W&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Materials Research Society, 9800 McKnight Road, Pittsburgh, PA 15237, Abstracts available. Paper No. E5.3 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - SPARTAN-1 X-ray image of the Perseus Cluster AN - 41170717; 1644303 AU - Kowalski, M P AU - Synder, WA AU - Cruddace, R G AU - Fritz, G G AU - Middleditch, I AU - Ulmer, M P Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 8000:PHYSICS AND ASTRONOMY UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41170717?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&rfr_id=info:sid/ProQ%3Acpi&rft_val_fmt=info:ofi/fmt:kev:mtx:journal&rft.genre=conference&rft.jtitle=&rft.atitle=SPARTAN-1+X-ray+image+of+the+Perseus+Cluster&rft.au=Kowalski%2C+M+P%3BSynder%2C+WA%3BCruddace%2C+R+G%3BFritz%2C+G+G%3BMiddleditch%2C+I%3BUlmer%2C+M+P&rft.aulast=Kowalski&rft.aufirst=M&rft.date=2000-12-31&rft.volume=&rft.issue=&rft.spage=&rft.isbn=&rft.btitle=&rft.title=&rft.issn=&rft_id=info:doi/ LA - English DB - ProQuest Environmental Science Collection N1 - SuppNotes - Availability: Bulletin of the American Astronomical Society, American Institute of Physics, 500 Sunnyside Boulevard, Woodmere, NY 11797 (USA), Paper No. 42.05 N1 - Last updated - 2010-05-03 ER - TY - CPAPER T1 - Recollections of acoustics at Brown University in the early fifties AN - 41170584; 3226524 AU - Elder, SA Y1 - 2000/12/31/ PY - 2000 DA - 2000 Dec 31 KW - CPI, Conference Papers Index KW - U 5500:Geoscience UR - http://libproxy.lib.unc.edu/login?url=http://search.proquest.com/docview/41170584?accountid=14244 L2 - http://vb3lk7eb4t.search.serialssolutions.com/?ctx_ver=Z39.88-2004&ctx_enc=info:of